The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	0	6785	6179177	transposase	uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_004118622.1|22_1522_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_103448923.1|1599_3501_-	NTPase KAP	NA	NA	NA	NA	NA
WP_032693499.1|3657_4473_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	42.6	9.7e-52
WP_032693500.1|5840_6785_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.5	1.3e-55
>prophage 2
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	19811	27662	6179177		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_032693510.1|19811_22499_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.8	3.6e-71
WP_032693511.1|22549_22981_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	42.8	8.5e-23
WP_032693512.1|23514_24600_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032693513.1|24599_27662_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	22.2	1.2e-25
>prophage 3
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	36792	38061	6179177	integrase	Pseudomonas_phage(100.0%)	1	32799:32812	38077:38090
32799:32812	attL	ATCAGGATTACGAT	NA	NA	NA	NA
WP_003030858.1|36792_38061_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	41.1	3.6e-77
WP_003030858.1|36792_38061_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	41.1	3.6e-77
38077:38090	attR	ATCAGGATTACGAT	NA	NA	NA	NA
>prophage 4
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	49552	49738	6179177		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003036401.1|49552_49738_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	52.0	4.3e-08
>prophage 5
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	65132	66080	6179177		Caulobacter_phage(100.0%)	1	NA	NA
WP_003036351.1|65132_66080_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.3	1.2e-53
>prophage 6
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	70276	71445	6179177	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_098141323.1|70276_71445_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	6.9e-168
>prophage 7
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	76178	76982	6179177		Streptococcus_phage(100.0%)	1	NA	NA
WP_003036327.1|76178_76982_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.3	1.8e-34
>prophage 8
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	89753	90668	6179177		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032693825.1|89753_90668_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	30.2	1.5e-08
>prophage 9
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	131898	136878	6179177		Stx2-converting_phage(50.0%)	3	NA	NA
WP_088168343.1|131898_133071_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.2	8.1e-185
WP_014230018.1|133245_134670_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_014838912.1|134775_136878_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	6.3e-63
>prophage 10
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	150269	152327	6179177		uncultured_virus(50.0%)	2	NA	NA
WP_014230029.1|150269_151094_+	Fe-S cluster assembly protein NifU	NA	A0A218MKD1	uncultured_virus	45.1	9.5e-23
WP_032693845.1|151124_152327_+	cysteine desulfurase NifS	NA	A0A1X7C038	Faustovirus	27.5	2.6e-29
>prophage 11
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	167133	168033	6179177		Cellulophaga_phage(100.0%)	1	NA	NA
WP_032693852.1|167133_168033_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	5.4e-11
>prophage 12
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	173577	192210	6179177		Escherichia_phage(18.18%)	16	NA	NA
WP_004122447.1|173577_174177_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	34.2	1.5e-17
WP_032693854.1|174260_175580_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	7.4e-09
WP_032693855.1|175711_176845_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_032693856.1|176857_177751_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004852435.1|177747_178902_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	40.9	3.0e-75
WP_032693857.1|178920_180813_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_004852439.1|180826_181567_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.8	1.1e-06
WP_004138730.1|181566_182334_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032693858.1|183639_184644_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	30.1	3.6e-32
WP_139512586.1|185115_185238_+	small membrane protein	NA	NA	NA	NA	NA
WP_032693859.1|185811_186978_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.0e-112
WP_014230057.1|187151_187706_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	7.3e-51
WP_014230058.1|187721_188612_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	2.4e-27
WP_032693860.1|188643_189513_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.7	1.7e-110
WP_032693861.1|189526_190591_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.2e-104
WP_014838945.1|190803_192210_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	4.3e-39
>prophage 13
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	196008	198456	6179177		Catovirus(50.0%)	2	NA	NA
WP_032693866.1|196008_196779_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	30.8	2.2e-05
WP_071993377.1|196806_198456_-	hypothetical protein	NA	A0A0U3C9T3	Klebsiella_phage	34.5	1.8e-81
>prophage 14
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	208911	215798	6179177		Bacillus_phage(25.0%)	5	NA	NA
WP_085956067.1|208911_209802_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	5.6e-45
WP_032693729.1|210784_212371_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	2.9e-36
WP_014230076.1|212609_214457_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004852489.1|214484_215066_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	1.3e-31
WP_004122537.1|215156_215798_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
>prophage 15
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	228689	229664	6179177		Planktothrix_phage(100.0%)	1	NA	NA
WP_032693722.1|228689_229664_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.5e-19
>prophage 16
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	248165	256560	6179177	tRNA	Bacillus_phage(33.33%)	8	NA	NA
WP_032693716.1|248165_249701_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	2.8e-28
WP_014230101.1|249697_250420_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_016946932.1|250738_252100_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	91.8	6.1e-200
WP_009654032.1|252344_253238_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.9	8.8e-14
WP_014230103.1|253238_253709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693715.1|253695_254496_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230105.1|254912_255686_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
WP_014230106.1|255696_256560_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.9e-11
>prophage 17
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	265194	266562	6179177		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_032693709.1|265194_266562_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.3	1.2e-43
>prophage 18
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	274601	276578	6179177		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032693706.1|274601_276578_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.5	3.1e-160
>prophage 19
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	285041	293994	6179177	tRNA	Enterobacteria_phage(60.0%)	10	NA	NA
WP_032693702.1|285041_287075_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.5	8.0e-55
WP_014230129.1|287275_287743_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_004852612.1|287846_288314_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	79.9	5.1e-66
WP_014230130.1|288367_289087_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_004852614.1|289080_290769_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	1.9e-259
WP_014839041.1|290979_291738_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.8	4.7e-77
WP_142394549.1|291803_292058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004103838.1|292237_292351_+	protein YohO	NA	NA	NA	NA	NA
WP_014839042.1|292325_293063_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014230133.1|293046_293994_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	6.2e-10
>prophage 20
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	300567	301122	6179177		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004138576.1|300567_301122_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	3.9e-20
>prophage 21
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	305317	306052	6179177		Streptococcus_phage(100.0%)	1	NA	NA
WP_032693698.1|305317_306052_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.6	2.1e-50
>prophage 22
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	321961	323482	6179177		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_014230153.1|321961_323482_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 23
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	327240	331207	6179177		Cellulophaga_phage(50.0%)	3	NA	NA
WP_004103895.1|327240_327909_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	6.9e-56
WP_014839058.1|328277_329114_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_032693692.1|329233_331207_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
>prophage 24
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	335324	336182	6179177		Catovirus(100.0%)	1	NA	NA
WP_014230162.1|335324_336182_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.5	1.5e-23
>prophage 25
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	347408	351716	6179177		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_014839067.1|347408_348875_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	6.6e-43
WP_014230172.1|348993_349971_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_014230173.1|350012_350720_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004122922.1|351146_351716_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	5.2e-12
>prophage 26
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	357475	425713	6179177	plate,holin,protease	Vibrio_phage(12.5%)	53	NA	NA
WP_014230176.1|357475_359065_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	4.7e-18
WP_004122937.1|359068_359413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230177.1|359743_360940_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.8	2.8e-23
WP_014230178.1|360936_361656_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_032693688.1|361804_363562_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	5.8e-102
WP_004114143.1|363699_363984_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_032693687.1|364045_364639_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014230181.1|364719_365478_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004122954.1|365527_366535_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	3.1e-84
WP_004133900.1|366713_366941_+	YejL family protein	NA	NA	NA	NA	NA
WP_014230182.1|366960_368721_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_014230184.1|369168_369621_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032693685.1|369613_370156_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032693684.1|370130_371234_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014839078.1|371188_372952_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032693683.1|372975_373710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230189.1|373774_373969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839080.1|373958_374321_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014230191.1|374320_377740_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_014230192.1|377726_378887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230193.1|378890_379157_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_014230194.1|379186_379867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014230195.1|379863_381768_-	LysM peptidoglycan-binding domain-containing protein	NA	S6BFI4	Thermus_phage	53.5	3.2e-05
WP_014230196.1|381776_382316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839083.1|382308_384924_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_014230199.1|385215_385857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839086.1|387466_387958_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_014839087.1|387962_389591_-	OmpA family protein	NA	NA	NA	NA	NA
WP_014839088.1|389690_390344_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_014839089.1|390340_391678_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014230204.1|391696_393247_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_014230205.1|393283_393781_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009653963.1|394762_395869_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014230206.1|396071_396563_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_014230207.1|396607_398242_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_014230208.1|398521_399769_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.3	9.5e-67
WP_014230209.1|399731_401168_-	magnesium transporter	NA	NA	NA	NA	NA
WP_014230210.1|401336_402980_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.6	1.2e-08
WP_014230211.1|403056_403707_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_014230212.1|403706_404771_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
WP_014230213.1|404843_405896_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_014230214.1|405998_407117_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.5	1.9e-119
WP_014230215.1|407888_410549_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_004103995.1|410565_411216_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_014230216.1|411260_414107_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	3.4e-43
WP_004852752.1|414237_416871_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.8	1.6e-92
WP_014230217.1|417056_417785_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_014839096.1|418129_420415_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	3.5e-285
WP_004852757.1|420518_421649_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
WP_004104002.1|421648_421903_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
WP_014230219.1|422095_423640_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	28.3	3.0e-38
WP_014230220.1|423684_424641_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230221.1|424645_425713_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
>prophage 27
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	433569	434775	6179177		Oenococcus_phage(100.0%)	1	NA	NA
WP_014839100.1|433569_434775_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.8e-25
>prophage 28
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	437880	440370	6179177	transposase	Tupanvirus(50.0%)	2	NA	NA
WP_014230229.1|437880_439329_+	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
WP_014230230.1|439377_440370_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.3	2.7e-72
>prophage 29
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	461938	462490	6179177	integrase	Escherichia_phage(100.0%)	1	452002:452015	463528:463541
452002:452015	attL	CGAGACCAGCCAGC	NA	NA	NA	NA
WP_014839116.1|461938_462490_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
WP_014839116.1|461938_462490_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	2.1e-50
463528:463541	attR	CGAGACCAGCCAGC	NA	NA	NA	NA
>prophage 30
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	481479	482079	6179177		Salmonella_phage(100.0%)	1	NA	NA
WP_004852850.1|481479_482079_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 31
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	493895	494915	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032694831.1|493895_494915_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.7	3.6e-19
>prophage 32
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	499181	501386	6179177		Salmonella_phage(66.67%)	4	NA	NA
WP_032694834.1|499181_499436_+	hypothetical protein	NA	J9Q735	Salmonella_phage	44.7	8.3e-10
WP_032694836.1|499439_500006_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	61.3	1.2e-45
WP_046877205.1|500073_500571_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004852881.1|500612_501386_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.7	3.9e-10
>prophage 33
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	505679	507197	6179177		Mollivirus(100.0%)	1	NA	NA
WP_004123211.1|505679_507197_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.4e-88
>prophage 34
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	513619	514756	6179177		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_009654654.1|513619_514756_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	1.5e-21
>prophage 35
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	523169	524258	6179177		Pandoravirus(100.0%)	1	NA	NA
WP_014230282.1|523169_524258_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 36
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	533377	538334	6179177		Enterobacteria_phage(33.33%)	5	NA	NA
WP_032694845.1|533377_534274_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	78.2	8.5e-126
WP_014230292.1|534501_534837_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_004852922.1|535507_535762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032694846.1|536357_537221_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	25.2	4.5e-07
WP_014230296.1|537401_538334_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	6.1e-10
>prophage 37
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	543495	544239	6179177		Clostridioides_phage(100.0%)	1	NA	NA
WP_032694853.1|543495_544239_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.6	9.5e-14
>prophage 38
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	562165	572040	6179177		Lactobacillus_phage(25.0%)	9	NA	NA
WP_032693079.1|562165_563092_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	8.8e-09
WP_004852990.1|563181_564180_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_004123346.1|564176_564395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693084.1|564387_566412_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.1	6.8e-147
WP_103449164.1|566486_567503_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_009654873.1|567736_568498_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032693088.1|568657_569629_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	1.1e-75
WP_002913505.1|570010_570268_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_032693091.1|570312_572040_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.0	3.3e-17
>prophage 39
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	576288	584881	6179177		Streptococcus_phage(25.0%)	10	NA	NA
WP_014230319.1|576288_577200_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.1	1.0e-57
WP_014230320.1|577266_578361_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	1.4e-29
WP_014230321.1|578350_579226_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_004123378.1|579225_580059_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_014230322.1|580058_581075_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_032693095.1|581300_582200_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	1.9e-24
WP_014839169.1|582293_582869_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_004853030.1|582932_583382_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_004853033.1|583368_583794_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_004870750.1|584005_584881_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	7.5e-18
>prophage 40
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	618370	620070	6179177		Rhodococcus_phage(50.0%)	2	NA	NA
WP_014839185.1|618370_619237_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	34.5	9.7e-34
WP_004104417.1|619356_620070_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.4e-38
>prophage 41
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	627336	628626	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004853099.1|627336_628626_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	9.2e-65
>prophage 42
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	632129	633805	6179177		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_004853107.1|632129_633167_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.4e-71
WP_014230347.1|633163_633805_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.2	1.2e-28
>prophage 43
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	646227	646437	6179177		Escherichia_phage(100.0%)	1	NA	NA
WP_014230352.1|646227_646437_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	73.9	2.5e-20
>prophage 44
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	650417	653419	6179177		Klosneuvirus(50.0%)	2	NA	NA
WP_014230355.1|650417_651884_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	9.8e-87
WP_032693140.1|652042_653419_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	3.8e-40
>prophage 45
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	666861	667293	6179177		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004114414.1|666861_667293_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 46
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	679464	685822	6179177		Mycoplasma_phage(20.0%)	8	NA	NA
WP_014230371.1|679464_680751_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.6	3.4e-35
WP_004104502.1|680857_681058_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004104503.1|681059_681395_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_014230372.1|681396_683247_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.8	1.9e-103
WP_004104505.1|683262_683778_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_004104506.1|683851_684175_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|684194_684581_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_004134936.1|684607_685822_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
>prophage 47
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	700144	715778	6179177	tRNA	Bacillus_phage(33.33%)	12	NA	NA
WP_009654385.1|700144_701398_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.3e-99
WP_032693157.1|701723_702914_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|702972_703311_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_014230390.1|703376_704714_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	3.0e-10
WP_032693159.1|704700_705405_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_103449170.1|705418_706855_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.0	1.3e-11
WP_032693171.1|707417_711305_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	1.0e-130
WP_014839219.1|711479_713096_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_071846082.1|713092_713638_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	4.5e-05
WP_004853258.1|713657_714293_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_014230398.1|714502_715351_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004114478.1|715517_715778_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.2e-17
>prophage 48
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	718785	722482	6179177		Micromonas_sp._RCC1109_virus(50.0%)	3	NA	NA
WP_004104573.1|718785_719466_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
WP_014230401.1|719692_720667_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004853275.1|720682_722482_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.3	6.5e-24
>prophage 49
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	727386	794238	6179177	portal,lysis,tRNA,transposase,head,holin,tail,capsid,plate,integrase,terminase	Escherichia_phage(29.17%)	72	753895:753911	789704:789720
WP_032693322.1|727386_728127_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004853282.1|728259_729591_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.1e-44
WP_004104596.1|729636_730020_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
WP_014230405.1|730331_731021_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.2	4.6e-55
WP_014228411.1|731104_731539_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_004123719.1|731706_732780_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_004104599.1|732983_733409_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
WP_032694272.1|733478_734177_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_014839229.1|734212_736891_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_014230410.1|736984_738340_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_014839230.1|738379_738706_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_004853296.1|738708_740007_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.1e-44
WP_032694273.1|740280_740736_-	DUF4385 domain-containing protein	NA	A0A222YVL1	Synechococcus_phage	47.3	4.7e-32
WP_014226431.1|746676_749250_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	3.1e-128
WP_014226432.1|749377_750109_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_032694814.1|750105_751086_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004853303.1|751218_751956_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_004104616.1|752227_752563_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_101706155.1|752670_752718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004853306.1|752824_753985_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
753895:753911	attL	GGCATTAAAAGAGCTGG	NA	NA	NA	NA
WP_014839236.1|753981_754854_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_014226434.1|754922_756044_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_014226435.1|756053_757124_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	4.8e-91
WP_004853313.1|757468_757978_+	YfiR family protein	NA	NA	NA	NA	NA
WP_014839238.1|757970_759194_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_032694812.1|759205_759688_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032694811.1|759692_761063_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014839240.1|761116_761554_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_014343376.1|761786_762818_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	83.7	1.6e-173
WP_103449172.1|762820_763693_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	44.2	3.9e-67
WP_101989659.1|763816_764044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103448931.1|764075_764585_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	93.5	2.7e-84
WP_040205177.1|764592_764793_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	71.0	1.2e-16
WP_103448933.1|764873_765161_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	57.0	1.8e-24
WP_071458047.1|765226_765451_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	71.9	4.4e-15
WP_103448935.1|765450_765672_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	78.1	9.3e-26
WP_103448936.1|765672_765951_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	75.0	1.2e-33
WP_103448938.1|765943_766948_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	5.0e-66
WP_103448940.1|766944_769164_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.3	0.0e+00
WP_014343387.1|769285_769468_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	78.3	5.3e-19
WP_023317755.1|769471_769702_+	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	69.7	2.8e-25
WP_101989668.1|769781_770513_+	hypothetical protein	NA	Q37850	Escherichia_phage	93.8	6.7e-129
WP_103448942.1|770635_771253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103448945.1|771568_772612_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	4.4e-166
WP_103448947.1|772611_774381_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	88.3	2.5e-307
WP_065807922.1|774546_775401_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	1.6e-126
WP_065807923.1|775474_776533_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.2	2.3e-162
WP_103448949.1|776536_777280_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	80.3	1.1e-99
WP_009309691.1|777376_777883_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_004175163.1|777882_778086_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	80.6	4.2e-25
WP_032433564.1|778090_778381_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	80.6	2.2e-35
WP_103448950.1|778367_778865_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	87.3	7.9e-81
WP_103448952.1|778861_779293_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	64.0	3.4e-40
WP_064388398.1|779388_779856_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	73.5	2.6e-62
WP_064388396.1|779848_780298_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	7.2e-49
WP_064388395.1|780366_781008_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.9	5.7e-92
WP_042346036.1|781004_781352_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	78.3	1.3e-45
WP_064388393.1|781356_782265_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	70.9	1.4e-112
WP_064388392.1|782257_782854_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	51.4	3.1e-47
WP_064388390.1|782861_784775_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0U3DL17	Klebsiella_phage	42.4	8.2e-110
WP_064388389.1|784771_785026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103448954.1|785069_786230_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	41.7	7.8e-47
WP_103448956.1|786340_787522_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.1	8.7e-195
WP_014343412.1|787535_788051_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_004195711.1|788111_788387_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_103448958.1|788401_788539_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	88.9	6.4e-17
WP_070544303.1|788531_790973_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	73.0	2.4e-295
789704:789720	attR	GGCATTAAAAGAGCTGG	NA	NA	NA	NA
WP_032420037.1|790986_791466_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.7	6.9e-66
WP_103448960.1|791465_792626_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	81.2	1.2e-175
WP_071839001.1|792706_792925_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	84.7	7.8e-33
WP_004104634.1|793083_793431_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_004104636.1|793470_794238_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 50
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	803796	804279	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004104655.1|803796_804279_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
>prophage 51
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	814285	817465	6179177		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_032694798.1|814285_817465_-	transporter substrate-binding domain-containing protein	NA	Q6XM27	Feldmannia_irregularis_virus	21.6	2.9e-19
>prophage 52
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	825697	827218	6179177		Pithovirus(100.0%)	1	NA	NA
WP_032694794.1|825697_827218_+	amino acid ABC transporter permease/ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	3.9e-14
>prophage 53
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	834587	835229	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_032694815.1|834587_835229_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	23.9	2.6e-12
>prophage 54
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	838293	841779	6179177		Mollivirus(50.0%)	4	NA	NA
WP_014839276.1|838293_839070_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	4.2e-12
WP_014839277.1|839215_840136_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032694789.1|840175_840949_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032694788.1|840984_841779_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	28.6	3.5e-06
>prophage 55
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	857717	863008	6179177		Gordonia_phage(25.0%)	5	NA	NA
WP_004853449.1|857717_857963_+	glutaredoxin-like protein NrdH	NA	A0A0E3T8B5	Gordonia_phage	37.3	6.1e-10
WP_004104769.1|857959_858370_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_032694780.1|858342_860487_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	2.0e-189
WP_014839293.1|860497_861460_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	70.8	1.2e-130
WP_014226499.1|861805_863008_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.2	2.9e-28
>prophage 56
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	877891	886175	6179177	tRNA	Vibrio_phage(20.0%)	9	NA	NA
WP_000906486.1|877891_878077_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_032694773.1|878315_880943_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	39.0	9.9e-82
WP_014226510.1|881073_881574_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_004104808.1|881645_882704_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	5.2e-114
WP_014226512.1|882784_883282_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.8	1.3e-27
WP_014226513.1|883486_883714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032694771.1|883750_884629_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014226515.1|884637_885501_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_032694770.1|885497_886175_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	3.5e-07
>prophage 57
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	891783	892749	6179177		Tetraselmis_virus(100.0%)	1	NA	NA
WP_014226519.1|891783_892749_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	4.0e-36
>prophage 58
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	934335	935157	6179177		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014226545.1|934335_935157_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.6e-12
>prophage 59
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	943126	946456	6179177		Cedratvirus(33.33%)	3	NA	NA
WP_032694640.1|943126_943906_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.8	1.3e-10
WP_014226554.1|944097_945351_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	Q6A202	Oenococcus_phage	30.9	1.3e-44
WP_032694641.1|945688_946456_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.9	1.4e-20
>prophage 60
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	959286	964498	6179177		Planktothrix_phage(66.67%)	3	NA	NA
WP_032694647.1|959286_961230_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.9	1.7e-30
WP_014226569.1|961229_962390_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_032694648.1|962386_964498_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.2	1.5e-16
>prophage 61
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	981811	989146	6179177	integrase	Cellulophaga_phage(25.0%)	5	982454:982468	989406:989420
WP_032694658.1|981811_982321_+	helix-turn-helix domain-containing protein	NA	M1PL54	Cellulophaga_phage	48.8	2.4e-40
982454:982468	attL	CATGCTAACAAAATA	NA	NA	NA	NA
WP_070083009.1|982587_984171_-	hypothetical protein	NA	P79669	Escherichia_phage	32.5	4.7e-79
WP_032694660.1|984373_984955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032694661.1|984964_986419_-|integrase	integrase	integrase	A0A0R6PHE0	Moraxella_phage	28.7	4.4e-23
WP_032694732.1|986578_989146_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.5	3.9e-30
989406:989420	attR	TATTTTGTTAGCATG	NA	NA	NA	NA
>prophage 62
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	995255	999030	6179177		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_004104962.1|995255_996248_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_032694666.1|996407_997526_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	6.5e-06
WP_009651549.1|997648_998275_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	2.4e-34
WP_032694667.1|998268_999030_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	2.2e-58
>prophage 63
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1002103	1004136	6179177		Tupanvirus(50.0%)	2	NA	NA
WP_004853621.1|1002103_1002709_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	36.5	6.1e-27
WP_014226587.1|1002708_1004136_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.3	3.9e-32
>prophage 64
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1012317	1013466	6179177		unidentified_phage(100.0%)	1	NA	NA
WP_025106434.1|1012317_1013466_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	38.3	2.3e-35
>prophage 65
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1020137	1025462	6179177		Vibrio_phage(33.33%)	4	NA	NA
WP_004124321.1|1020137_1020809_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.5e-15
WP_025106430.1|1021269_1022379_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004124327.1|1022445_1023744_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	2.8e-130
WP_004105009.1|1023824_1025462_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	1.1e-155
>prophage 66
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1028884	1034293	6179177		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_014226597.1|1028884_1030228_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.6	1.4e-34
WP_103448966.1|1030350_1033104_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.6	1.2e-48
WP_014226599.1|1033153_1034293_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	7.2e-45
>prophage 67
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1041734	1042580	6179177		Vibrio_phage(100.0%)	1	NA	NA
WP_004853651.1|1041734_1042580_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 68
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1054978	1055734	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_025108014.1|1054978_1055734_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.1	4.2e-09
>prophage 69
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1066453	1069028	6179177	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_014226621.1|1066453_1067659_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	4.4e-69
WP_014839393.1|1067658_1068096_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_009651598.1|1068218_1069028_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	2.5e-15
>prophage 70
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1074061	1074877	6179177		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_014226625.1|1074061_1074877_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.8	2.5e-07
>prophage 71
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1108828	1119942	6179177		Deep-sea_thermophilic_phage(25.0%)	5	NA	NA
WP_014226651.1|1108828_1110082_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	29.4	5.0e-15
WP_004853841.1|1110309_1111641_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_014839419.1|1111682_1113518_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	42.5	2.6e-04
WP_064388452.1|1113514_1117060_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.9	8.0e-10
WP_032694699.1|1117056_1119942_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.7	9.9e-59
>prophage 72
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1125416	1144412	6179177		Geobacillus_virus(16.67%)	16	NA	NA
WP_004124584.1|1125416_1126211_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.0	2.6e-118
WP_014226659.1|1126217_1127093_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_014226660.1|1127388_1129635_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	22.9	1.5e-09
WP_004124593.1|1129647_1130178_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_014226661.1|1130860_1131556_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_004105253.1|1131637_1132351_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	1.0e-44
WP_004105255.1|1132475_1132694_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_014226662.1|1132931_1133972_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_032694706.1|1134071_1135265_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
WP_032694707.1|1135257_1137417_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	4.9e-18
WP_014226665.1|1138039_1139056_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_032694708.1|1139016_1139496_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004105268.1|1139492_1140266_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032694709.1|1140334_1141762_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.6	4.5e-36
WP_032694710.1|1141769_1143107_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_014226669.1|1143401_1144412_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.8	3.4e-30
>prophage 73
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1155806	1156934	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_014226681.1|1155806_1156934_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	3.9e-11
>prophage 74
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1165013	1167505	6179177		Aichi_virus(50.0%)	2	NA	NA
WP_014226687.1|1165013_1166432_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.2	1.6e-25
WP_004124661.1|1166743_1167505_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	1.4e-20
>prophage 75
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1198549	1202396	6179177		Acinetobacter_phage(50.0%)	3	NA	NA
WP_004124798.1|1198549_1200103_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	6.6e-158
WP_014226713.1|1200600_1201023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009654966.1|1201622_1202396_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	6.8e-23
>prophage 76
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1209694	1211251	6179177		Catovirus(100.0%)	1	NA	NA
WP_014226721.1|1209694_1211251_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.2	8.7e-17
>prophage 77
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1218613	1219789	6179177		Streptococcus_phage(100.0%)	1	NA	NA
WP_032694028.1|1218613_1219789_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.8	7.7e-42
>prophage 78
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1224931	1227066	6179177		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_014839481.1|1224931_1225357_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	1.2e-50
WP_014839482.1|1225370_1226663_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.8	7.4e-171
WP_014839483.1|1226715_1227066_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.4	1.3e-24
>prophage 79
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1232356	1233037	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_032694024.1|1232356_1233037_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.0e-30
>prophage 80
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1239339	1240191	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032694017.1|1239339_1240191_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.9	6.8e-48
>prophage 81
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1243197	1270477	6179177	transposase,integrase	Escherichia_phage(33.33%)	26	1249362:1249375	1270306:1270319
WP_032694013.1|1243197_1243449_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	57.7	1.5e-08
WP_032694012.1|1244498_1245740_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_103449176.1|1245847_1246666_-|integrase	site-specific integrase	integrase	Q7M297	Enterobacteria_phage	61.4	9.0e-90
WP_103448975.1|1246687_1247807_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_087855188.1|1248731_1249881_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	5.4e-48
1249362:1249375	attL	AAAATCTGCTGAAA	NA	NA	NA	NA
WP_103448978.1|1249894_1250992_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BVE3	unidentified_phage	33.6	3.4e-07
WP_032694010.1|1251004_1252792_-	hypothetical protein	NA	A0A291LB80	Escherichia_phage	34.2	1.9e-39
WP_032694009.1|1252796_1252985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032694008.1|1253087_1254128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050595141.1|1254146_1254518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032694006.1|1254518_1254761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032694004.1|1255639_1256086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032694003.1|1256364_1256742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050595140.1|1256865_1257501_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	50.3	3.7e-43
WP_158657241.1|1257500_1257653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032694002.1|1257656_1257860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032694001.1|1257860_1258178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070083014.1|1258188_1259655_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_032693792.1|1259792_1259981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567369.1|1261483_1262116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|1262144_1263548_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_032693793.1|1264455_1264731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023309080.1|1265407_1266589_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_023309081.1|1266724_1267921_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_103448984.1|1267942_1268623_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	73.0	1.3e-73
WP_103448986.1|1268623_1270477_-	hypothetical protein	NA	A0A291LB80	Escherichia_phage	30.6	6.7e-32
1270306:1270319	attR	TTTCAGCAGATTTT	NA	NA	NA	NA
>prophage 82
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1277083	1280579	6179177	integrase	Bacillus_phage(33.33%)	3	1272925:1272937	1278523:1278535
1272925:1272937	attL	AAGAAGAAAGAAC	NA	NA	NA	NA
WP_032654919.1|1277083_1277662_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	25.8	1.0e-10
WP_050597046.1|1277708_1279091_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	34.4	1.6e-09
1278523:1278535	attR	GTTCTTTCTTCTT	NA	NA	NA	NA
WP_004854045.1|1279853_1280579_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.0	2.5e-11
>prophage 83
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1285237	1291320	6179177	tRNA	Catovirus(25.0%)	5	NA	NA
WP_004134430.1|1285237_1286755_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	7.7e-87
WP_100248296.1|1286764_1287863_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_032693806.1|1287948_1289682_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	1.2e-59
WP_032693807.1|1289687_1290401_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004105555.1|1290423_1291320_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.6e-31
>prophage 84
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1303566	1309468	6179177		Pandoravirus(50.0%)	4	NA	NA
WP_103448993.1|1303566_1305000_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	25.9	5.1e-32
WP_004854083.1|1305190_1305682_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032693812.1|1305790_1306534_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032693813.1|1306594_1309468_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.5	5.7e-264
>prophage 85
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1317645	1318878	6179177		Catovirus(100.0%)	1	NA	NA
WP_004115297.1|1317645_1318878_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	1.4e-102
>prophage 86
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1336371	1337028	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_032693819.1|1336371_1337028_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.4	5.3e-08
>prophage 87
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1344304	1345459	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014226830.1|1344304_1345459_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	8.1e-129
>prophage 88
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1363473	1364559	6179177		Geobacillus_virus(100.0%)	1	NA	NA
WP_014839539.1|1363473_1364559_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	3.8e-11
>prophage 89
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1369628	1369835	6179177		Vibrio_phage(100.0%)	1	NA	NA
WP_032692858.1|1369628_1369835_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.2	8.1e-16
>prophage 90
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1378384	1379755	6179177		Streptococcus_phage(100.0%)	1	NA	NA
WP_025105933.1|1378384_1379755_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	35.4	3.3e-44
>prophage 91
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1401677	1404188	6179177		Staphylococcus_phage(33.33%)	3	NA	NA
WP_025105927.1|1401677_1402505_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	2.1e-62
WP_025105926.1|1402603_1403059_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.9e-21
WP_075209483.1|1403153_1404188_-	DUF3362 domain-containing protein	NA	M1QSD9	Pseudomonas_phage	70.4	2.1e-104
>prophage 92
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1407660	1408811	6179177	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_087855188.1|1407660_1408811_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	5.4e-48
>prophage 93
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1414146	1415256	6179177		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_017384070.1|1414146_1415256_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.7	2.2e-30
>prophage 94
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1418548	1421200	6179177		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_012561117.1|1418548_1421200_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.1	5.4e-152
>prophage 95
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1431687	1432443	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038423655.1|1431687_1432443_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
>prophage 96
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1446007	1449743	6179177		Bacillus_virus(50.0%)	3	NA	NA
WP_014226868.1|1446007_1448266_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	5.7e-86
WP_009651841.1|1448388_1449258_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839568.1|1449335_1449743_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	52.2	1.5e-21
>prophage 97
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1453034	1454930	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_004854242.1|1453034_1454930_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	1.4e-90
>prophage 98
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1459252	1466233	6179177		Erwinia_phage(25.0%)	8	NA	NA
WP_004125303.1|1459252_1459921_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	48.1	4.7e-36
WP_025105920.1|1459926_1461087_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	1.3e-89
WP_014226877.1|1461133_1461925_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_025105919.1|1462118_1462889_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_004854262.1|1462950_1463604_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	1.2e-44
WP_004854265.1|1463981_1464263_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_004854266.1|1464316_1464526_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_014226884.1|1464799_1466233_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	5.1e-40
>prophage 99
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1471343	1472585	6179177		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_014226887.1|1471343_1472585_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.6	2.7e-90
>prophage 100
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1481970	1487535	6179177	tRNA	Moraxella_phage(33.33%)	4	NA	NA
WP_032692889.1|1481970_1482984_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.5e-107
WP_001144069.1|1483221_1483437_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014226898.1|1483671_1485417_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	4.1e-76
WP_004105908.1|1485690_1487535_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 101
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1500708	1507297	6179177	tRNA	Klosneuvirus(50.0%)	4	NA	NA
WP_014226908.1|1500708_1502115_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	9.2e-34
WP_014226909.1|1502152_1502485_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_014226910.1|1502704_1503688_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_032693225.1|1504204_1507297_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.6	4.1e-159
>prophage 102
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1518661	1520149	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_014226925.1|1518661_1520149_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W8CYL7	Bacillus_phage	28.6	1.6e-07
>prophage 103
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1532577	1533546	6179177		Escherichia_phage(100.0%)	1	NA	NA
WP_032693241.1|1532577_1533546_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.6	2.2e-39
>prophage 104
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1549782	1550928	6179177		Streptococcus_phage(100.0%)	1	NA	NA
WP_014226948.1|1549782_1550928_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	38.6	2.2e-46
>prophage 105
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1567154	1577316	6179177		Escherichia_phage(16.67%)	12	NA	NA
WP_014226962.1|1567154_1567928_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	2.6e-22
WP_014226964.1|1568997_1569861_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.2	2.1e-49
WP_032693253.1|1569924_1572006_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_014226966.1|1571963_1572350_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|1572372_1572963_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_004125578.1|1572972_1573548_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_032693254.1|1573655_1574696_-	permease	NA	NA	NA	NA	NA
WP_032693255.1|1574765_1575416_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_004854517.1|1575544_1576063_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.0	2.4e-11
WP_014226969.1|1576042_1576486_-	YhbP family protein	NA	NA	NA	NA	NA
WP_014226970.1|1576541_1576826_+	GIY-YIG nuclease family protein	NA	A0A120L170	Cnaphalocrocis_medinalis_granulovirus	50.6	5.8e-12
WP_032693256.1|1576812_1577316_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	32.7	1.7e-14
>prophage 106
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1582509	1584471	6179177		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_014839626.1|1582509_1584471_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	4.7e-52
>prophage 107
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1589870	1601511	6179177	protease	Cafeteria_roenbergensis_virus(25.0%)	8	NA	NA
WP_004106093.1|1589870_1592561_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.6	3.9e-25
WP_004854539.1|1592585_1594073_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004125659.1|1594100_1594553_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004106101.1|1595144_1596488_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	1.6e-64
WP_004106103.1|1596740_1597070_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014226977.1|1597299_1598637_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014226978.1|1598629_1599478_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.0	3.7e-22
WP_004854549.1|1599576_1601511_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	9.2e-117
>prophage 108
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1608099	1609541	6179177		Indivirus(50.0%)	2	NA	NA
WP_004854564.1|1608099_1609071_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.3e-07
WP_004854566.1|1609268_1609541_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.3	1.3e-16
>prophage 109
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1613600	1627583	6179177		Staphylococcus_phage(28.57%)	16	NA	NA
WP_032693262.1|1613600_1614413_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	4.8e-19
WP_032693263.1|1614622_1615600_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004854583.1|1615614_1616601_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.2	3.5e-40
WP_004854584.1|1616615_1617182_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.8	1.3e-58
WP_004854587.1|1617178_1617754_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004125703.1|1617722_1618268_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004125705.1|1618274_1619000_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_004854591.1|1619047_1620481_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004106167.1|1620503_1620791_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004854593.1|1620856_1621345_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004106169.1|1621390_1622245_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_004106170.1|1622241_1622514_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_014226984.1|1622566_1623292_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_014226985.1|1623288_1623942_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_014839635.1|1624176_1626516_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	6.0e-38
WP_032693264.1|1626647_1627583_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.3	2.9e-15
>prophage 110
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1636291	1640287	6179177	protease	Burkholderia_virus(50.0%)	4	NA	NA
WP_032693265.1|1636291_1637779_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	1.3e-09
WP_014839641.1|1637885_1638779_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_032693266.1|1638898_1639705_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_014226996.1|1639798_1640287_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.7	4.9e-27
>prophage 111
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1644191	1645559	6179177	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014226999.1|1644191_1645559_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.2	4.3e-20
>prophage 112
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1652707	1653976	6179177		Oenococcus_phage(100.0%)	1	NA	NA
WP_032694499.1|1652707_1653976_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.7	3.0e-60
>prophage 113
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1672869	1673913	6179177		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|1672869_1673913_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 114
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1702817	1704289	6179177	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_004854751.1|1702817_1703327_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_032693886.1|1703341_1704289_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.8	1.7e-07
>prophage 115
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1724170	1729742	6179177		Tupanvirus(33.33%)	7	NA	NA
WP_004097636.1|1724170_1725355_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004115957.1|1725425_1727540_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	6.2e-58
WP_004106370.1|1727636_1728107_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_002920115.1|1728202_1728577_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_025107828.1|1728701_1728989_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_004854839.1|1728996_1729356_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_014227040.1|1729355_1729742_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	1.2e-20
>prophage 116
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1735377	1748229	6179177		Tupanvirus(14.29%)	12	NA	NA
WP_004854860.1|1735377_1737282_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.1	3.8e-75
WP_032693747.1|1737343_1738834_-	nicotinate phosphoribosyltransferase	NA	K4F7Y4	Cronobacter_phage	49.9	9.1e-141
WP_032693737.1|1738838_1739708_-	ribose-phosphate pyrophosphokinase	NA	A0A2P1CBA5	Salmonella_phage	41.3	2.4e-48
WP_032693738.1|1739904_1740624_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.3	7.3e-19
WP_004854871.1|1740705_1741728_+	hydrolase	NA	NA	NA	NA	NA
WP_004125965.1|1741724_1741943_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.8	4.0e-05
WP_004854874.1|1741978_1742851_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_004854875.1|1742894_1743299_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|1743603_1744236_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_014839675.1|1744287_1746366_+	membrane protein	NA	H9YQA8	environmental_Halophage	86.2	1.8e-62
WP_014839676.1|1746355_1747576_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_014227049.1|1747665_1748229_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.1	4.3e-59
>prophage 117
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1760544	1761372	6179177		Vibrio_phage(100.0%)	1	NA	NA
WP_014227055.1|1760544_1761372_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	51.1	1.2e-70
>prophage 118
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1776303	1783110	6179177		Staphylococcus_phage(50.0%)	3	NA	NA
WP_032693746.1|1776303_1777926_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.9	4.5e-141
WP_014227067.1|1778615_1780709_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_009654839.1|1780719_1783110_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	1.2e-14
>prophage 119
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1786600	1787359	6179177		Escherichia_phage(100.0%)	1	NA	NA
WP_004106478.1|1786600_1787359_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	3.0e-23
>prophage 120
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1790370	1792818	6179177		Dickeya_phage(100.0%)	1	NA	NA
WP_014227071.1|1790370_1792818_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 121
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1810513	1812321	6179177		Enterococcus_phage(50.0%)	2	NA	NA
WP_014227082.1|1810513_1811254_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	26.1	3.1e-12
WP_025107858.1|1811250_1812321_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 122
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1820660	1822159	6179177		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
WP_004126158.1|1820660_1821374_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	7.2e-11
WP_004855045.1|1821391_1822159_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.4e-14
>prophage 123
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1830093	1835854	6179177		Klosneuvirus(25.0%)	5	NA	NA
WP_014839711.1|1830093_1831359_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	3.7e-26
WP_014839712.1|1831476_1832991_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.9	1.5e-13
WP_004106554.1|1833023_1833878_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
WP_025106848.1|1834134_1835193_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004106557.1|1835185_1835854_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
>prophage 124
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1838947	1843013	6179177		Dickeya_phage(50.0%)	4	NA	NA
WP_004855080.1|1838947_1839574_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	5.5e-31
WP_032694227.1|1839652_1841857_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.0	4.2e-118
WP_004106582.1|1841935_1842181_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_004126198.1|1842347_1843013_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	6.2e-57
>prophage 125
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1866790	1870897	6179177		Tupanvirus(66.67%)	3	NA	NA
WP_032694218.1|1866790_1868776_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	1.6e-20
WP_004126208.1|1868772_1869756_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	32.7	2.8e-37
WP_004855110.1|1869757_1870897_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.2	2.3e-27
>prophage 126
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1878635	1879406	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_032694213.1|1878635_1879406_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.9	2.5e-17
>prophage 127
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1882573	1883527	6179177		Cedratvirus(100.0%)	1	NA	NA
WP_025106833.1|1882573_1883527_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	33.9	5.6e-35
>prophage 128
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1895711	1897754	6179177		Indivirus(100.0%)	1	NA	NA
WP_032694209.1|1895711_1897754_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	1.3e-44
>prophage 129
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1908734	1910812	6179177		Bacillus_phage(100.0%)	2	NA	NA
WP_001157751.1|1908734_1909454_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_004855221.1|1909450_1910812_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.3e-11
>prophage 130
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1941619	1942732	6179177	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
WP_032694189.1|1941619_1942732_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	88.6	9.4e-191
>prophage 131
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1958832	1965044	6179177		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_050595143.1|1958832_1960944_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	33.9	3.3e-35
WP_014227183.1|1960964_1961768_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_032694180.1|1961758_1962337_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_014227185.1|1963050_1964064_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.4	2.5e-17
WP_032694179.1|1964060_1965044_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	1.1e-14
>prophage 132
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1982998	1983970	6179177		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_009652700.1|1982998_1983970_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.5	1.4e-17
>prophage 133
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1987328	1989260	6179177		Morganella_phage(50.0%)	2	NA	NA
WP_004126446.1|1987328_1987541_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	71.4	6.0e-22
WP_014227198.1|1987640_1989260_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	25.4	2.8e-26
>prophage 134
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1993647	1994643	6179177		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_032692958.1|1993647_1994643_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.2	6.6e-10
>prophage 135
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	1999584	2001126	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032692959.1|1999584_2001126_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.3e-17
>prophage 136
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2022722	2024564	6179177		Tupanvirus(100.0%)	1	NA	NA
WP_014227224.1|2022722_2024564_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	2.0e-12
>prophage 137
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2041997	2051271	6179177		Rhizobium_phage(20.0%)	9	NA	NA
WP_004106850.1|2041997_2042249_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	7.6e-16
WP_032695101.1|2042360_2042792_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_014227235.1|2043037_2044582_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_025107808.1|2044591_2045863_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.9	2.1e-08
WP_103449011.1|2045914_2046802_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_032695103.1|2046798_2047596_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004855475.1|2047757_2048783_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.0e-18
WP_032695104.1|2048792_2049986_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	1.7e-36
WP_014227239.1|2050326_2051271_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	8.6e-36
>prophage 138
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2064133	2068872	6179177		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_004106901.1|2064133_2064610_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	2.4e-26
WP_014227251.1|2064733_2065543_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.8e-24
WP_003024094.1|2065742_2065910_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002436699.1|2065930_2066167_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004126657.1|2066383_2067049_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_014227252.1|2067224_2068436_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.8	5.8e-45
WP_103449180.1|2068416_2068872_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	62.6	4.0e-47
>prophage 139
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2074439	2079466	6179177		Pseudomonas_phage(33.33%)	4	NA	NA
WP_032695110.1|2074439_2076116_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.0	9.6e-22
WP_004126677.1|2076373_2076997_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	2.6e-20
WP_004106927.1|2077051_2077327_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_004855514.1|2077345_2079466_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	2.8e-10
>prophage 140
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2090582	2091434	6179177		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004855525.1|2090582_2091434_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	1.3e-14
>prophage 141
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2095039	2096431	6179177		environmental_Halophage(100.0%)	1	NA	NA
WP_004855527.1|2095039_2096431_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.9	1.6e-67
>prophage 142
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2118685	2123762	6179177		Wolbachia_phage(50.0%)	6	NA	NA
WP_071886348.1|2118685_2119714_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	46.6	3.8e-77
WP_032695123.1|2119869_2120475_-	shikimate kinase	NA	NA	NA	NA	NA
WP_014227279.1|2120662_2121130_+	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
WP_032695124.1|2121242_2122250_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004855548.1|2122251_2122554_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014227281.1|2122712_2123762_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	4.5e-70
>prophage 143
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2139352	2140519	6179177		Salmonella_phage(100.0%)	1	NA	NA
WP_014227296.1|2139352_2140519_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	6.5e-25
>prophage 144
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2145006	2145984	6179177	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_032695133.1|2145006_2145984_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	1.0e-68
>prophage 145
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2153270	2154383	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_014227307.1|2153270_2154383_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	34.5	8.6e-27
>prophage 146
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2166731	2172073	6179177		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
WP_004855639.1|2166731_2168420_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	6.9e-60
WP_004107123.1|2168522_2168618_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004107126.1|2169199_2169289_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_004855646.1|2169360_2169807_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014227319.1|2169877_2170711_+	EamA family transporter	NA	NA	NA	NA	NA
WP_004855651.1|2170888_2172073_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	2.9e-12
>prophage 147
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2183469	2184430	6179177		Synechococcus_phage(50.0%)	2	NA	NA
WP_032694291.1|2183469_2183898_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	3.2e-14
WP_004126917.1|2184016_2184430_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	35.4	1.3e-17
>prophage 148
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2187927	2191020	6179177	transposase	Oenococcus_phage(50.0%)	3	NA	NA
WP_014227329.1|2187927_2189076_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	4.7e-52
WP_014227330.1|2189072_2189690_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_098141323.1|2189851_2191020_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	6.9e-168
>prophage 149
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2195760	2203289	6179177		Bacillus_virus(33.33%)	7	NA	NA
WP_004126944.1|2195760_2198175_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	4.8e-115
WP_032694288.1|2198203_2199277_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004107206.1|2199425_2200526_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.3	6.9e-53
WP_004871826.1|2200530_2201931_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004871828.1|2202552_2202693_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004871829.1|2202708_2203068_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004871831.1|2203031_2203289_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	7.1e-17
>prophage 150
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2210765	2212103	6179177		Moraxella_phage(100.0%)	1	NA	NA
WP_014839859.1|2210765_2212103_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	36.4	5.8e-62
>prophage 151
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2217982	2225585	6179177		Bacillus_phage(25.0%)	6	NA	NA
WP_004855746.1|2217982_2218756_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.1	9.9e-14
WP_032694282.1|2218803_2219694_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004107261.1|2219693_2220653_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004127017.1|2220845_2221886_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.4	4.0e-50
WP_014227346.1|2222202_2224032_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.7	1.6e-126
WP_032694281.1|2224214_2225585_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.4	9.6e-36
>prophage 152
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2240166	2241159	6179177		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_032694277.1|2240166_2241159_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	7.1e-49
>prophage 153
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2244328	2250207	6179177		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_014227355.1|2244328_2246197_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	1.4e-66
WP_004855789.1|2246382_2246802_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_032694275.1|2246812_2248318_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.5	8.9e-19
WP_004855792.1|2248323_2249289_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_004855794.1|2249316_2250207_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.5	7.4e-05
>prophage 154
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2264399	2267189	6179177		uncultured_virus(100.0%)	1	NA	NA
WP_032693315.1|2264399_2267189_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.6	3.3e-75
>prophage 155
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2271081	2273549	6179177		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_032693312.1|2271081_2272491_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004127098.1|2272499_2273549_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.2e-08
>prophage 156
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2280373	2281291	6179177		Pandoravirus(100.0%)	1	NA	NA
WP_014836999.1|2280373_2281291_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	30.0	4.2e-19
>prophage 157
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2342184	2343696	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_014227417.1|2342184_2343696_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	5.1e-14
>prophage 158
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2352000	2355527	6179177		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_004127220.1|2352000_2352621_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_014227423.1|2352692_2353367_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004107505.1|2353458_2354832_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_004127228.1|2354828_2355527_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 159
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2360145	2361480	6179177		Erwinia_phage(100.0%)	1	NA	NA
WP_004127247.1|2360145_2361480_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
>prophage 160
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2373851	2376551	6179177		Escherichia_phage(50.0%)	3	NA	NA
WP_032693279.1|2373851_2374601_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	1.0e-23
WP_032693278.1|2374729_2375833_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_004107558.1|2375888_2376551_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
>prophage 161
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2391278	2393147	6179177		Acinetobacter_phage(100.0%)	1	NA	NA
WP_032693275.1|2391278_2393147_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.7	2.8e-06
>prophage 162
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2403341	2404988	6179177		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014227445.1|2403341_2404988_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	33.0	1.6e-66
>prophage 163
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2414678	2425513	6179177		Vibrio_phage(20.0%)	9	NA	NA
WP_032693769.1|2414678_2415407_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.0	1.2e-21
WP_032693768.1|2415509_2417528_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.5	1.9e-112
WP_032693767.1|2417531_2418494_-	ribokinase	NA	NA	NA	NA	NA
WP_014837065.1|2418477_2419893_-	purine-cytosine permease	NA	NA	NA	NA	NA
WP_032693766.1|2419911_2420928_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	25.3	2.2e-08
WP_004097500.1|2421149_2421890_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014227453.1|2421954_2423442_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_004127388.1|2423576_2424842_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.8	8.3e-42
WP_004097507.1|2425183_2425513_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
>prophage 164
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2429563	2433841	6179177		Catovirus(33.33%)	4	NA	NA
WP_004097518.1|2429563_2430694_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.3	1.9e-26
WP_014227455.1|2430690_2431953_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.6	2.8e-26
WP_014837069.1|2432031_2432706_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_004097526.1|2432710_2433841_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.5	5.1e-19
>prophage 165
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2457203	2461062	6179177		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_009651718.1|2457203_2458106_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	2.3e-17
WP_014227468.1|2458105_2458822_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_014227469.1|2458899_2461062_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	1.3e-116
>prophage 166
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2464911	2466738	6179177		Catovirus(100.0%)	1	NA	NA
WP_103449018.1|2464911_2466738_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	2.8e-83
>prophage 167
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2477542	2483721	6179177		Alteromonas_phage(33.33%)	7	NA	NA
WP_032693755.1|2477542_2478991_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	56.4	6.8e-08
WP_004097585.1|2479061_2479817_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_014227479.1|2479830_2480436_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_032693754.1|2480432_2482073_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.9	1.5e-40
WP_032693753.1|2482150_2482402_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_014227481.1|2482405_2482945_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004097593.1|2482947_2483721_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.0	1.5e-25
>prophage 168
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2492926	2493541	6179177		Streptococcus_phage(100.0%)	1	NA	NA
WP_014227487.1|2492926_2493541_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.1	1.4e-18
>prophage 169
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2503422	2523140	6179177		uncultured_Mediterranean_phage(16.67%)	14	NA	NA
WP_014227490.1|2503422_2504373_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.6	3.0e-28
WP_004097636.1|2505374_2506559_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004097638.1|2506791_2507175_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002438628.1|2507176_2507722_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	3.1e-14
WP_004097640.1|2507875_2508304_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004097642.1|2508307_2509012_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004097644.1|2509431_2509929_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004097645.1|2509995_2510361_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_103449020.1|2510686_2514715_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	30.2	1.1e-23
WP_032692785.1|2514791_2519015_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.3	1.3e-67
WP_004097650.1|2519424_2520765_+	anaerobic C4-dicarboxylate transporter DcuB	NA	NA	NA	NA	NA
WP_004097651.1|2520808_2521126_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004097653.1|2521129_2521435_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014227493.1|2521607_2523140_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.7	3.8e-09
>prophage 170
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2531685	2540458	6179177		Klosneuvirus(25.0%)	9	NA	NA
WP_025107530.1|2531685_2532357_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.2	9.5e-21
WP_004097673.1|2532399_2532990_+	YjaG family protein	NA	NA	NA	NA	NA
WP_004097675.1|2533176_2533449_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
WP_004097677.1|2533461_2534154_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_032692777.1|2534157_2534592_-	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_014227505.1|2534844_2536233_+	two-component system sensor histidine kinase ZraS	NA	NA	NA	NA	NA
WP_032692776.1|2536229_2537564_+	sigma-54-dependent response regulator transcription factor ZraR	NA	Q6XM27	Feldmannia_irregularis_virus	29.9	2.4e-07
WP_014227507.1|2537560_2538853_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_032692775.1|2538868_2540458_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.1e-67
>prophage 171
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2554259	2557943	6179177		Dickeya_phage(100.0%)	1	NA	NA
WP_025107717.1|2554259_2557943_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 172
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2587964	2589074	6179177		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004097762.1|2587964_2589074_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 173
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2596274	2596883	6179177		Lactococcus_phage(100.0%)	1	NA	NA
WP_004097774.1|2596274_2596883_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	7.8e-14
>prophage 174
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2602723	2605364	6179177		Escherichia_phage(50.0%)	2	NA	NA
WP_004097788.1|2602723_2604139_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	2.8e-200
WP_014227545.1|2604284_2605364_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	2.6e-28
>prophage 175
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2609466	2614766	6179177		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_004097797.1|2609466_2612292_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004097799.1|2612538_2613066_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.4	3.5e-55
WP_103449021.1|2613152_2614766_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	2.5e-06
>prophage 176
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2626578	2627928	6179177		Moraxella_phage(100.0%)	1	NA	NA
WP_014227555.1|2626578_2627928_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.8	6.7e-159
>prophage 177
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2640199	2651306	6179177		Staphylococcus_phage(33.33%)	8	NA	NA
WP_032695086.1|2640199_2642158_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	3.5e-92
WP_004109428.1|2642569_2643883_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_014837150.1|2643919_2644603_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_077598876.1|2644809_2646957_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	4.1e-33
WP_032695088.1|2647213_2648125_-	allose kinase	NA	NA	NA	NA	NA
WP_032695089.1|2648108_2648804_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_014837152.1|2648814_2649795_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_014837153.1|2649773_2651306_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	26.5	1.4e-11
>prophage 178
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2656973	2658616	6179177		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_004097859.1|2656973_2657660_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.9	1.1e-08
WP_014227581.1|2657857_2658616_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	25.8	2.2e-13
>prophage 179
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2663941	2670876	6179177		Burkholderia_virus(25.0%)	8	NA	NA
WP_025107668.1|2663941_2665444_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.0	7.0e-56
WP_004097873.1|2665590_2665896_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_014227587.1|2665895_2666816_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	43.8	9.7e-08
WP_032695093.1|2666966_2667647_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.7	9.3e-32
WP_103449023.1|2667870_2668653_+	DsbA family protein	NA	NA	NA	NA	NA
WP_014227589.1|2668686_2669283_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014837165.1|2669398_2669986_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032695096.1|2670441_2670876_+	hypothetical protein	NA	E5AGC9	Erwinia_phage	38.3	5.7e-19
>prophage 180
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2675462	2676830	6179177		Escherichia_phage(100.0%)	1	NA	NA
WP_032676543.1|2675462_2676830_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	54.2	2.3e-122
>prophage 181
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2680205	2692484	6179177	transposase	Klebsiella_phage(20.0%)	14	NA	NA
WP_001178480.1|2680205_2680436_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	46.6	2.0e-07
WP_032676549.1|2680514_2681747_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038423655.1|2682640_2683396_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
WP_004118622.1|2683392_2684892_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_103449025.1|2684964_2685228_+	DUF1845 family protein	NA	NA	NA	NA	NA
WP_032676550.1|2685241_2687251_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	27.6	5.5e-40
WP_032676551.1|2687879_2688371_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_032676552.1|2688443_2688647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676553.1|2688664_2689213_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	61.4	1.4e-51
WP_001144085.1|2689291_2689534_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_000155614.1|2689517_2689766_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_032676556.1|2690074_2690953_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032676557.1|2690955_2691828_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_032676558.1|2691824_2692484_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.6	5.8e-15
>prophage 182
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2705771	2706893	6179177	integrase	Pseudomonas_phage(100.0%)	1	2699337:2699349	2707790:2707802
2699337:2699349	attL	GCCCGCCGCGCCG	NA	NA	NA	NA
WP_032676573.1|2705771_2706893_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	45.3	2.9e-46
WP_032676573.1|2705771_2706893_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	45.3	2.9e-46
2707790:2707802	attR	CGGCGCGGCGGGC	NA	NA	NA	NA
>prophage 183
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2727468	2730156	6179177		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032676599.1|2727468_2730156_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	19.2	3.1e-06
>prophage 184
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2737439	2739967	6179177	integrase	Macacine_betaherpesvirus(33.33%)	3	2729267:2729281	2738695:2738709
2729267:2729281	attL	AGCTGAGAAATTACG	NA	NA	NA	NA
WP_032676605.1|2737439_2738231_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	81.7	5.7e-49
WP_032676606.1|2738258_2739533_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	3.1e-153
2738695:2738709	attR	CGTAATTTCTCAGCT	NA	NA	NA	NA
WP_032676607.1|2739532_2739967_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	4.7e-29
>prophage 185
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2747623	2752035	6179177	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
WP_038423655.1|2747623_2748379_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
WP_004118622.1|2748375_2749875_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_103449032.1|2750043_2750562_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_032676618.1|2750601_2752035_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	75.3	1.1e-37
>prophage 186
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2759304	2762156	6179177		Caulobacter_phage(50.0%)	3	NA	NA
WP_032676633.1|2759304_2760297_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.6	5.3e-52
WP_000493293.1|2760388_2761342_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000793034.1|2761472_2762156_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	37.6	9.6e-29
>prophage 187
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2780171	2785701	6179177		Cronobacter_phage(33.33%)	5	NA	NA
WP_003855929.1|2780171_2780465_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
WP_014227597.1|2780508_2782155_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	1.0e-188
WP_004097909.1|2782288_2782642_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_014837171.1|2782688_2783555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032695141.1|2783577_2785701_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.0	1.2e-29
>prophage 188
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2796597	2801815	6179177		Morganella_phage(33.33%)	6	NA	NA
WP_014227610.1|2796597_2797128_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-45
WP_004097938.1|2797268_2797628_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_004097939.1|2797638_2798034_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_004109180.1|2798044_2798779_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_014227611.1|2798771_2800562_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	26.8	2.2e-16
WP_014227612.1|2800837_2801815_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.2e-27
>prophage 189
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2809066	2809612	6179177		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004097954.1|2809066_2809612_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	7.7e-29
>prophage 190
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2814350	2817582	6179177		Vibrio_phage(50.0%)	2	NA	NA
WP_014227620.1|2814350_2815682_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	4.3e-17
WP_032695149.1|2815692_2817582_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.2e-59
>prophage 191
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2823108	2827470	6179177		Pithovirus(50.0%)	3	NA	NA
WP_004097979.1|2823108_2824407_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
WP_004097980.1|2824556_2824982_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_004097981.1|2825019_2827470_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.9	3.2e-66
>prophage 192
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2867536	2874088	6179177		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_004098041.1|2867536_2868064_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.1e-56
WP_032695162.1|2868467_2869424_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014837206.1|2869533_2871036_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	2.2e-09
WP_014227645.1|2871046_2872072_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004098052.1|2872058_2873045_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_004098053.1|2873089_2874088_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 193
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2893084	2896010	6179177		Cronobacter_phage(50.0%)	2	NA	NA
WP_014227659.1|2893084_2893549_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	8.5e-53
WP_032695170.1|2893871_2896010_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	3.4e-266
>prophage 194
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2903838	2911621	6179177		Enterobacteria_phage(25.0%)	6	NA	NA
WP_014227667.1|2903838_2904786_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.0	1.3e-12
WP_032695172.1|2905164_2907873_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	1.7e-47
WP_009652347.1|2907940_2908327_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_038423978.1|2908481_2909951_-	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.5	1.4e-21
WP_004098115.1|2910211_2910673_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_032695174.1|2910685_2911621_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.0e-52
>prophage 195
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2916765	2925815	6179177	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_004098127.1|2916765_2919621_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	6.0e-141
WP_032695176.1|2919620_2920064_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004098131.1|2920186_2921698_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_004098132.1|2922091_2923189_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_014227676.1|2923188_2924271_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_014227677.1|2924312_2925815_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	8.8e-83
>prophage 196
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2941738	2946609	6179177		Planktothrix_phage(50.0%)	5	NA	NA
WP_032694862.1|2941738_2942809_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.6e-22
WP_032694863.1|2942814_2943639_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_032694864.1|2943649_2944537_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004128303.1|2944526_2945399_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004128305.1|2945589_2946609_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.3	2.6e-46
>prophage 197
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2951459	2952299	6179177		uncultured_marine_virus(100.0%)	1	NA	NA
WP_064388776.1|2951459_2952299_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	33.2	1.5e-20
>prophage 198
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2968178	2969543	6179177		Burkholderia_virus(100.0%)	1	NA	NA
WP_014227732.1|2968178_2969543_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.3e-45
>prophage 199
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2982236	2987951	6179177		Staphylococcus_phage(50.0%)	3	NA	NA
WP_032693048.1|2982236_2984966_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	1.7e-20
WP_032693056.1|2984962_2986030_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032693045.1|2986553_2987951_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	3.4e-20
>prophage 200
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	2996372	2999759	6179177	holin	Serratia_phage(100.0%)	1	NA	NA
WP_032693038.1|2996372_2999759_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	7.4e-05
>prophage 201
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3005636	3006221	6179177		Moraxella_phage(100.0%)	1	NA	NA
WP_004098242.1|3005636_3006221_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.3	5.0e-10
>prophage 202
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3014417	3018391	6179177		Acinetobacter_phage(50.0%)	2	NA	NA
WP_032693022.1|3014417_3015887_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.6	1.1e-34
WP_032693021.1|3015961_3018391_-	DEAD/DEAH box helicase family protein	NA	A0A0K1LLU7	Rhodobacter_phage	23.9	6.7e-08
>prophage 203
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3030832	3032670	6179177		Streptococcus_phage(50.0%)	2	NA	NA
WP_032693014.1|3030832_3032044_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.5	7.9e-58
WP_014227775.1|3032043_3032670_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.3	3.2e-55
>prophage 204
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3069058	3070081	6179177		Tupanvirus(100.0%)	1	NA	NA
WP_032692995.1|3069058_3070081_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	28.4	3.6e-11
>prophage 205
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3077294	3080462	6179177	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_014227808.1|3077294_3078356_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.3	2.1e-06
WP_089046413.1|3078352_3079384_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_032692991.1|3079523_3080462_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.9	8.5e-68
>prophage 206
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3083624	3084904	6179177		Shigella_phage(50.0%)	2	NA	NA
WP_014227813.1|3083624_3084362_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.3e-63
WP_032692989.1|3084364_3084904_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	60.6	7.1e-27
>prophage 207
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3098212	3100917	6179177		Streptococcus_phage(50.0%)	3	NA	NA
WP_004098388.1|3098212_3099802_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.3	2.4e-30
WP_014227828.1|3100019_3100631_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003856556.1|3100755_3100917_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
>prophage 208
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3105585	3106908	6179177		Geobacillus_virus(100.0%)	1	NA	NA
WP_014227832.1|3105585_3106908_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.4	2.6e-78
>prophage 209
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3113207	3118427	6179177		Enterococcus_phage(33.33%)	3	NA	NA
WP_004098414.1|3113207_3114440_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.1e-86
WP_014227837.1|3114548_3116216_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.4e-41
WP_014227838.1|3116489_3118427_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	3.6e-12
>prophage 210
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3122391	3123816	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_014227844.1|3122391_3123816_+	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	27.7	2.1e-17
>prophage 211
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3134899	3135853	6179177		Cyanophage(100.0%)	1	NA	NA
WP_004098458.1|3134899_3135853_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	2.8e-10
>prophage 212
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3140240	3148524	6179177		Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
WP_004128758.1|3140240_3142157_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_014837364.1|3142244_3143381_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	3.6e-28
WP_014227855.1|3143548_3144496_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014227856.1|3144620_3144968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014227857.1|3145045_3145579_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	55.5	2.6e-53
WP_014227858.1|3145595_3146039_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_042944266.1|3146424_3148524_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	4.0e-33
>prophage 213
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3153161	3159849	6179177	tRNA	uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_014227862.1|3153161_3154337_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.1	8.4e-89
WP_014227863.1|3154389_3155289_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_003018940.1|3155455_3155719_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_004098483.1|3156049_3156988_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_014227864.1|3157032_3159849_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.4	6.7e-76
>prophage 214
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3186145	3187294	6179177		Halovirus(100.0%)	1	NA	NA
WP_032694438.1|3186145_3187294_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	3.1e-48
>prophage 215
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3194037	3195406	6179177		Bacillus_phage(50.0%)	2	NA	NA
WP_004098524.1|3194037_3194517_+	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	40.9	6.7e-29
WP_014227890.1|3194557_3195406_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	30.7	9.9e-07
>prophage 216
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3207947	3213399	6179177		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_025106476.1|3207947_3210854_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.9e-21
WP_032694434.1|3211041_3213399_-	DNA polymerase II	NA	D0FZR7	Heterocapsa_circularisquama_DNA_virus	37.1	8.0e-06
>prophage 217
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3219612	3220314	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_014227903.1|3219612_3220314_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.7	1.3e-20
>prophage 218
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3241082	3242807	6179177		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_025106489.1|3241082_3242807_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.3	1.0e-34
>prophage 219
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3268924	3269968	6179177		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_009654638.1|3268924_3269968_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.6	2.2e-101
>prophage 220
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3274297	3274849	6179177		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_014227932.1|3274297_3274849_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	32.8	1.9e-14
>prophage 221
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3286097	3287522	6179177		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_032694416.1|3286097_3287522_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 222
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3297303	3298074	6179177		Escherichia_phage(100.0%)	1	NA	NA
WP_032694412.1|3297303_3298074_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	37.0	1.3e-29
>prophage 223
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3302952	3309533	6179177		Mamastrovirus(33.33%)	5	NA	NA
WP_032694408.1|3302952_3304554_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	47.5	3.3e-19
WP_014227949.1|3304654_3307045_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_014227950.1|3307248_3307785_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	2.7e-18
WP_004098666.1|3307836_3308499_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_014227952.1|3308606_3309533_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.8e-22
>prophage 224
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3322136	3328902	6179177	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_071881716.1|3322136_3323534_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	4.9e-27
WP_014837424.1|3323585_3324467_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_004098689.1|3324527_3324983_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_014227967.1|3325147_3325864_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_032694401.1|3325863_3326400_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_064388485.1|3326472_3328902_+	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	31.6	9.6e-39
>prophage 225
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3350936	3355592	6179177	transposase	Planktothrix_phage(50.0%)	4	NA	NA
WP_004098728.1|3350936_3351734_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	1.2e-14
WP_014227987.1|3351733_3352624_+	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_064388482.1|3352620_3354603_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_014227989.1|3354662_3355592_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	40.7	2.4e-59
>prophage 226
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3358758	3359103	6179177		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004098733.1|3358758_3359103_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.6e-27
>prophage 227
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3363234	3369038	6179177	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_004098740.1|3363234_3364674_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.8e-24
WP_004098741.1|3364865_3366023_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032694387.1|3366059_3369038_-	viral enhancin protein	NA	A9YMZ4	Helicoverpa_armigera_granulovirus	23.7	5.7e-41
>prophage 228
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3379562	3380321	6179177		Flavobacterium_phage(100.0%)	1	NA	NA
WP_004098751.1|3379562_3380321_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	2.1e-24
>prophage 229
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3389155	3393273	6179177		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_103449040.1|3389155_3389752_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	4.6e-27
WP_014837451.1|3389790_3393273_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.3	2.7e-204
>prophage 230
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3408044	3409076	6179177		Planktothrix_phage(100.0%)	1	NA	NA
WP_004098793.1|3408044_3409076_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	1.9e-36
>prophage 231
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3415760	3416564	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032693178.1|3415760_3416564_+	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	36.0	2.1e-38
>prophage 232
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3420608	3424819	6179177		Lactobacillus_phage(33.33%)	5	NA	NA
WP_004129156.1|3420608_3421976_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	30.6	4.3e-12
WP_014837463.1|3422047_3422803_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_014228026.1|3422835_3423558_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004129160.1|3423554_3424022_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.7	3.8e-53
WP_014228028.1|3424087_3424819_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.0	4.6e-37
>prophage 233
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3428920	3429502	6179177		Caulobacter_phage(100.0%)	1	NA	NA
WP_004099149.1|3428920_3429502_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	1.1e-12
>prophage 234
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3464516	3465992	6179177		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_014228053.1|3464516_3465992_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	1.7e-46
>prophage 235
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3471263	3471737	6179177		Burkholderia_phage(100.0%)	1	NA	NA
WP_032693194.1|3471263_3471737_-	hypothetical protein	NA	K4NX96	Burkholderia_phage	34.4	2.8e-19
>prophage 236
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3488409	3493280	6179177		Catovirus(50.0%)	5	NA	NA
WP_014228064.1|3488409_3489942_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	35.0	1.8e-67
WP_023329014.1|3489952_3490828_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014228066.1|3490858_3491539_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004848024.1|3491541_3492186_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_032693202.1|3492182_3493280_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.2	1.0e-08
>prophage 237
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3508896	3512607	6179177		Streptococcus_phage(66.67%)	3	NA	NA
WP_032693212.1|3508896_3510150_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	2.2e-95
WP_004848066.1|3510160_3511264_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	2.4e-61
WP_004129421.1|3511554_3512607_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	1.3e-112
>prophage 238
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3517358	3518102	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_032693216.1|3517358_3518102_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	3.5e-32
>prophage 239
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3525286	3526129	6179177		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_032693217.1|3525286_3526129_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	1.6e-12
>prophage 240
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3535374	3539499	6179177		Brazilian_cedratvirus(66.67%)	5	NA	NA
WP_032693224.1|3535374_3536193_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	2.3e-16
WP_032693222.1|3536206_3537016_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004129481.1|3537738_3537921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004848112.1|3538028_3538724_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	8.1e-07
WP_014228113.1|3538716_3539499_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.7	5.1e-10
>prophage 241
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3550981	3552028	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_014228120.1|3550981_3552028_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.9e-34
>prophage 242
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3560084	3560852	6179177		Planktothrix_phage(100.0%)	1	NA	NA
WP_004848135.1|3560084_3560852_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-25
>prophage 243
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3585300	3594520	6179177		Bacillus_phage(60.0%)	7	NA	NA
WP_004099396.1|3585300_3586212_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.9	4.2e-104
WP_014228144.1|3586302_3587208_+	fructokinase	NA	NA	NA	NA	NA
WP_014228145.1|3587256_3587619_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032694136.1|3587907_3591042_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	4.9e-11
WP_014228147.1|3591038_3592241_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	34.7	6.3e-07
WP_004099401.1|3592519_3593209_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_004848171.1|3593230_3594520_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	27.9	1.0e-26
>prophage 244
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3611351	3615691	6179177	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_004129667.1|3611351_3612479_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	1.5e-90
WP_004099423.1|3612501_3612834_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_071846141.1|3612861_3614709_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004848195.1|3614719_3615691_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	7.2e-46
>prophage 245
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3620701	3622369	6179177		Indivirus(50.0%)	2	NA	NA
WP_032694145.1|3620701_3621805_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	4.2e-50
WP_004129690.1|3621898_3622369_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 246
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3639366	3641070	6179177		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032694149.1|3639366_3641070_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	27.1	3.7e-21
>prophage 247
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3656227	3661277	6179177	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_003021624.1|3656227_3656851_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_004099538.1|3656983_3658258_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	2.8e-130
WP_004099539.1|3658441_3660796_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.0e-223
WP_002444653.1|3661004_3661277_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 248
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3664654	3665350	6179177		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_014228183.1|3664654_3665350_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.4e-88
>prophage 249
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3669777	3673321	6179177		Bacillus_phage(100.0%)	2	NA	NA
WP_032694151.1|3669777_3671550_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	5.7e-49
WP_032694152.1|3671542_3673321_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	6.4e-40
>prophage 250
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3684727	3685837	6179177		Planktothrix_phage(100.0%)	1	NA	NA
WP_004848307.1|3684727_3685837_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.0e-24
>prophage 251
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3694989	3704377	6179177		Enterobacteria_phage(33.33%)	10	NA	NA
WP_014837605.1|3694989_3696063_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	40.8	4.5e-65
WP_004848323.1|3696175_3696439_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003859006.1|3696438_3696579_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_014228203.1|3696575_3697274_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032694158.1|3697375_3698830_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	2.4e-16
WP_014228205.1|3698804_3699275_-	membrane protein	NA	NA	NA	NA	NA
WP_032694159.1|3699401_3699968_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_004099646.1|3700130_3700349_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004129911.1|3700375_3700750_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_014228207.1|3701230_3704377_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	3.5e-49
>prophage 252
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3709893	3717740	6179177	transposase	Sodalis_phage(25.0%)	9	NA	NA
WP_032694160.1|3709893_3710829_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.6	4.3e-64
WP_064506547.1|3710895_3711069_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_032694161.1|3711083_3711611_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_004848353.1|3711680_3712058_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_004099669.1|3712208_3712760_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
WP_032694162.1|3712851_3714759_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	1.3e-43
WP_004099673.1|3714816_3715149_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004129946.1|3715148_3715754_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_009653565.1|3715865_3717740_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.3	5.6e-111
>prophage 253
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3732158	3735985	6179177		Pteropox_virus(50.0%)	2	NA	NA
WP_014228221.1|3732158_3733409_+	phospholipase	NA	A0A1B1MR92	Pteropox_virus	22.4	9.1e-25
WP_032694165.1|3733483_3735985_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	5.0e-115
>prophage 254
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3740880	3741561	6179177		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004848402.1|3740880_3741561_+	iron ABC transporter ATP-binding protein FetA	NA	F2Y165	Organic_Lake_phycodnavirus	31.3	2.7e-15
>prophage 255
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3744747	3745434	6179177		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228231.1|3744747_3745434_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	7.6e-34
>prophage 256
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3754277	3757038	6179177	tRNA	Moumouvirus(50.0%)	3	NA	NA
WP_004848430.1|3754277_3755663_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
WP_025107125.1|3755957_3756170_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004099791.1|3756171_3757038_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
>prophage 257
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3760220	3760469	6179177		Salmonella_phage(100.0%)	1	NA	NA
WP_032694558.1|3760220_3760469_-	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	71.8	4.7e-26
>prophage 258
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3766435	3767437	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_032694552.1|3766435_3767437_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	3.1e-28
>prophage 259
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3778987	3779863	6179177		Burkholderia_virus(100.0%)	1	NA	NA
WP_032694546.1|3778987_3779863_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.5	3.0e-19
>prophage 260
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3786641	3791716	6179177	tRNA	Acinetobacter_phage(33.33%)	4	NA	NA
WP_014228245.1|3786641_3788117_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.5	2.9e-46
WP_004848495.1|3788489_3790007_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	2.5e-85
WP_014228246.1|3790159_3790573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228247.1|3790840_3791716_-	class A extended-spectrum beta-lactamase OXY-1-1	NA	A0A1B0VBP7	Salmonella_phage	74.6	3.1e-112
>prophage 261
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3796482	3797967	6179177		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_032694598.1|3796482_3797967_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	21.2	5.7e-10
>prophage 262
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3806286	3807687	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_032694591.1|3806286_3807687_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.1	1.7e-16
>prophage 263
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3812081	3812873	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_014837719.1|3812081_3812873_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	2.7e-14
>prophage 264
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3828424	3829174	6179177		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_014228273.1|3828424_3829174_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.2	1.3e-18
>prophage 265
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3864241	3866953	6179177		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_103449191.1|3864241_3866953_+	cation-transporting P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.2	9.3e-67
>prophage 266
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3877599	3879643	6179177		Bacillus_virus(50.0%)	2	NA	NA
WP_004848592.1|3877599_3878643_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	6.0e-14
WP_032695061.1|3878632_3879643_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	1.3e-16
>prophage 267
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3884974	3894116	6179177		Planktothrix_phage(50.0%)	9	NA	NA
WP_014228326.1|3884974_3886441_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.0	1.8e-16
WP_004848610.1|3886675_3887527_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004100025.1|3887575_3888217_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032695098.1|3888231_3888897_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014228328.1|3888889_3889651_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.6e-19
WP_014228329.1|3890195_3890960_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032693521.1|3891142_3892480_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_032693522.1|3892588_3893293_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	4.0e-22
WP_032693523.1|3893279_3894116_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.1e-13
>prophage 268
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3898680	3904598	6179177	holin	Catovirus(50.0%)	4	NA	NA
WP_014837759.1|3898680_3900345_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
WP_032693525.1|3900359_3901832_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032693526.1|3901842_3902436_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_025107047.1|3902564_3904598_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	28.1	5.8e-21
>prophage 269
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3908063	3909608	6179177		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_014228343.1|3908063_3909608_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	3.1e-14
>prophage 270
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3921156	3925931	6179177		Tupanvirus(50.0%)	2	NA	NA
WP_032693530.1|3921156_3925038_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	26.9	3.1e-55
WP_014837773.1|3925136_3925931_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	25.6	9.9e-09
>prophage 271
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3930001	3932119	6179177		Plodia_interpunctella_granulovirus(100.0%)	1	NA	NA
WP_038423277.1|3930001_3932119_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	2.4e-33
>prophage 272
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3940977	3944594	6179177		Burkholderia_phage(50.0%)	4	NA	NA
WP_004100084.1|3940977_3941382_-	helix-turn-helix domain-containing protein	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	6.1e-07
WP_071889425.1|3941362_3941656_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032694347.1|3941842_3942931_-	oxidoreductase	NA	NA	NA	NA	NA
WP_014228366.1|3943091_3944594_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.3e-14
>prophage 273
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3962161	3982048	6179177	transposase	Cedratvirus(12.5%)	16	NA	NA
WP_004848726.1|3962161_3963190_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.1	1.7e-29
WP_032694339.1|3963228_3964173_-	sugar kinase	NA	NA	NA	NA	NA
WP_004848729.1|3964184_3965186_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032694338.1|3965185_3966172_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047725149.1|3966168_3967674_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	6.6e-14
WP_032694337.1|3967718_3968699_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_064388438.1|3969237_3971547_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.1	3.9e-82
WP_014228384.1|3971730_3972273_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_032694334.1|3972269_3972959_-	acireductone synthase	NA	NA	NA	NA	NA
WP_032694333.1|3973138_3974299_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014228387.1|3974299_3974929_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.3	2.0e-52
WP_014228388.1|3974913_3976137_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.1	2.6e-61
WP_103448975.1|3976886_3978006_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_002894394.1|3979244_3979808_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_004848755.1|3979977_3981543_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
WP_004100140.1|3981619_3982048_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.5e-19
>prophage 274
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3986135	3987673	6179177		Morganella_phage(33.33%)	3	NA	NA
WP_004100146.1|3986135_3986345_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.6	4.5e-22
WP_004848768.1|3986409_3986793_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.0	5.2e-24
WP_014837805.1|3986884_3987673_+	deaminated glutathione amidase	NA	M1HKP1	Paramecium_bursaria_Chlorella_virus	24.2	2.8e-08
>prophage 275
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	3991590	3994034	6179177		Stx2-converting_phage(50.0%)	2	NA	NA
WP_004848782.1|3991590_3992790_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.7	1.4e-104
WP_032694331.1|3992933_3994034_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.0e-08
>prophage 276
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4001050	4009149	6179177	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_014228403.1|4001050_4003633_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	1.2e-188
WP_014228404.1|4003859_4004342_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_032694326.1|4004541_4006329_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.2	6.2e-27
WP_032694324.1|4006384_4008052_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004100186.1|4008423_4009149_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.7e-28
>prophage 277
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4014997	4016062	6179177		Pseudomonas_phage(100.0%)	1	NA	NA
WP_085954924.1|4014997_4016062_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.5e-48
>prophage 278
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4020717	4022379	6179177		Ostreococcus_mediterraneus_virus(100.0%)	1	NA	NA
WP_014228410.1|4020717_4022379_-	asparagine synthase B	NA	A0A0P0C0R1	Ostreococcus_mediterraneus_virus	39.7	7.9e-85
>prophage 279
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4027006	4036958	6179177	tRNA	Vibrio_phage(25.0%)	7	NA	NA
WP_014228414.1|4027006_4028959_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	3.2e-08
WP_004848839.1|4029137_4030805_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	92.4	1.3e-310
WP_004130464.1|4031243_4032647_+	chitoporin	NA	NA	NA	NA	NA
WP_004848843.1|4032693_4033026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032694321.1|4033078_4034374_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	1.4e-60
WP_014837817.1|4034428_4035568_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_103449063.1|4035554_4036958_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	3.0e-08
>prophage 280
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4039962	4040736	6179177		Mycobacterium_phage(100.0%)	1	NA	NA
WP_032694316.1|4039962_4040736_-	esterase	NA	W0LK50	Mycobacterium_phage	37.0	2.6e-06
>prophage 281
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4047180	4048665	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032694353.1|4047180_4048665_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	2.5e-21
>prophage 282
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4056932	4064424	6179177		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_014837833.1|4056932_4058981_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.9	5.5e-27
WP_032694310.1|4059002_4060682_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_009651669.1|4060681_4060771_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_004848892.1|4061080_4061287_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_032694308.1|4061531_4062980_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	32.8	4.0e-56
WP_032694307.1|4062942_4064424_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	2.9e-46
>prophage 283
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4070221	4071013	6179177		Kaumoebavirus(100.0%)	1	NA	NA
WP_014837838.1|4070221_4071013_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	7.5e-09
>prophage 284
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4110150	4113667	6179177		Vibriophage(33.33%)	4	NA	NA
WP_014228459.1|4110150_4110870_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	33.0	2.9e-23
WP_014228460.1|4110866_4111811_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.8	5.2e-25
WP_014228461.1|4111928_4112300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014228462.1|4112614_4113667_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.6	1.8e-82
>prophage 285
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4117987	4124513	6179177		Tupanvirus(33.33%)	7	NA	NA
WP_032694537.1|4117987_4119004_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.7	4.4e-78
WP_014228466.1|4119215_4120685_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	29.6	4.3e-10
WP_004848991.1|4120752_4121541_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_004848993.1|4121694_4121844_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_014228467.1|4121989_4122763_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004848997.1|4122762_4123452_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014228468.1|4123454_4124513_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.8	3.1e-18
>prophage 286
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4131686	4132418	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014228475.1|4131686_4132418_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.8	1.7e-52
>prophage 287
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4139183	4144137	6179177		Catovirus(50.0%)	4	NA	NA
WP_025108118.1|4139183_4140707_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	2.4e-80
WP_004849033.1|4140819_4142202_+	amino acid permease	NA	NA	NA	NA	NA
WP_032694532.1|4142301_4142778_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_032694541.1|4142847_4144137_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	5.0e-18
>prophage 288
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4147812	4148535	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014228488.1|4147812_4148535_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	8.1e-10
>prophage 289
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4155100	4156006	6179177		Streptococcus_phage(100.0%)	1	NA	NA
WP_014228492.1|4155100_4156006_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.7	3.1e-27
>prophage 290
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4165789	4167529	6179177		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_032694524.1|4165789_4167529_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	1.5e-17
>prophage 291
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4172670	4181207	6179177		Micromonas_pusilla_virus(20.0%)	8	NA	NA
WP_014228507.1|4172670_4173516_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.6	6.4e-06
WP_032694522.1|4173515_4174508_+	transketolase family protein	NA	NA	NA	NA	NA
WP_032694521.1|4174808_4176158_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.5	1.0e-45
WP_014228509.1|4176358_4178503_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	2.0e-43
WP_014837874.1|4178545_4179514_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_004130722.1|4179649_4179910_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004130731.1|4180194_4180461_-	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	57.3	9.5e-17
WP_004849092.1|4180529_4181207_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	31.0	3.4e-18
>prophage 292
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4187778	4192882	6179177		Planktothrix_phage(33.33%)	6	NA	NA
WP_004849106.1|4187778_4188501_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	1.5e-35
WP_004100490.1|4188497_4189157_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004849110.1|4189290_4190037_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_004130751.1|4190408_4190912_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.6	1.9e-05
WP_004100495.1|4191130_4192018_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_004130755.1|4192369_4192882_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	31.3	2.3e-14
>prophage 293
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4196791	4203847	6179177		Klosneuvirus(33.33%)	6	NA	NA
WP_025108092.1|4196791_4197832_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.0	1.0e-05
WP_025108091.1|4197983_4199360_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.0	5.0e-24
WP_025108090.1|4199430_4200147_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004130773.1|4200189_4201104_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_032694516.1|4201294_4202077_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_004849135.1|4202254_4203847_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	8.5e-60
>prophage 294
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4213293	4215726	6179177		Citrobacter_phage(100.0%)	1	NA	NA
WP_032694899.1|4213293_4215726_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
>prophage 295
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4219904	4221758	6179177		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228532.1|4219904_4221758_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	4.1e-13
>prophage 296
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4231433	4254718	6179177	holin,transposase	Klebsiella_phage(30.0%)	33	NA	NA
WP_032694894.1|4231433_4232720_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	54.5	1.3e-122
WP_004111685.1|4232719_4232935_-	DUF1233 family excisionase	NA	NA	NA	NA	NA
WP_014837895.1|4233022_4233367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049250967.1|4233363_4233588_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	58.1	4.0e-16
WP_123828190.1|4233630_4233864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032694893.1|4233929_4234223_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_103449074.1|4234844_4235261_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	50.4	2.0e-29
WP_071993411.1|4235343_4235571_+	transcriptional regulator	NA	H9C161	Pectobacterium_phage	35.1	7.1e-05
WP_009653775.1|4235554_4235980_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_103449077.1|4236244_4237321_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	41.6	5.2e-29
WP_025108069.1|4237333_4237627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004849236.1|4237623_4237836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064388665.1|4237828_4238617_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.3	4.0e-63
WP_064388667.1|4238613_4239690_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	72.9	1.2e-147
WP_074193866.1|4239829_4240024_+	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	74.2	9.7e-19
WP_032693338.1|4240024_4240357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004111726.1|4241291_4241585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032694886.1|4242005_4242239_+	DinI family protein	NA	H6WRY5	Salmonella_phage	68.8	3.7e-25
WP_014837900.1|4242367_4242550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064388672.1|4242716_4243310_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	64.8	1.3e-42
WP_074193865.1|4243306_4243951_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.0	4.3e-103
WP_009653799.1|4243947_4244088_+	YlcG family protein	NA	NA	NA	NA	NA
WP_057173860.1|4244084_4244684_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.4	7.1e-68
WP_031280382.1|4245399_4245699_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_032693350.1|4245695_4246238_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	75.8	1.3e-76
WP_014837905.1|4246234_4246579_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	82.5	4.5e-43
WP_103449079.1|4246575_4246851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032694446.1|4246801_4246993_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.5	1.3e-20
WP_103448975.1|4247254_4248375_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_142394569.1|4248443_4249385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253373.1|4249523_4250834_+	hypothetical protein	NA	A0A0K2FI18	Enterobacter_phage	31.8	7.3e-33
WP_029946969.1|4252728_4253931_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.7	4.7e-95
WP_004849345.1|4253959_4254718_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	2.0e-11
>prophage 297
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4262282	4273808	6179177		Bacillus_phage(33.33%)	13	NA	NA
WP_004100567.1|4262282_4262546_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
WP_009653259.1|4262750_4263041_+	YbjC family protein	NA	NA	NA	NA	NA
WP_025108025.1|4263024_4263747_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_009653278.1|4263850_4264753_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	2.0e-34
WP_004849367.1|4264842_4265322_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_014228600.1|4265670_4266783_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_004134592.1|4266885_4268019_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	7.7e-31
WP_014228601.1|4268029_4268983_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004130847.1|4268979_4269825_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_004100588.1|4269882_4270371_+	YbjO family protein	NA	NA	NA	NA	NA
WP_032694258.1|4270413_4271544_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.2	1.7e-25
WP_004849381.1|4271622_4272339_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	1.1e-35
WP_014228604.1|4272335_4273808_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.4	4.3e-26
>prophage 298
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4277437	4280177	6179177		Planktothrix_phage(50.0%)	4	NA	NA
WP_004111834.1|4277437_4278166_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
WP_004849391.1|4278393_4278909_-	lipoprotein	NA	NA	NA	NA	NA
WP_004100606.1|4279026_4279350_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014228608.1|4279346_4280177_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	28.9	8.2e-06
>prophage 299
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4294053	4317219	6179177	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_025108294.1|4294053_4296000_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.2	9.4e-37
WP_004100627.1|4296067_4296298_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
WP_004100628.1|4296622_4296940_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
WP_032694254.1|4296970_4299253_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	3.7e-165
WP_002211347.1|4299390_4299609_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_032694253.1|4299888_4300593_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_103449086.1|4300631_4302353_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	3.6e-16
WP_032694251.1|4302353_4304120_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	9.2e-23
WP_004849433.1|4304234_4305203_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.6e-61
WP_002439523.1|4305734_4306229_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_032694250.1|4306364_4310483_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	5.0e-88
WP_004130911.1|4310604_4311216_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004849446.1|4311224_4312568_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.7	7.8e-83
WP_009653254.1|4312659_4313952_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	3.6e-93
WP_103449088.1|4314152_4316591_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.6	1.5e-217
WP_032694248.1|4316601_4317219_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	2.2e-72
>prophage 300
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4324350	4327577	6179177		Tetraselmis_virus(100.0%)	2	NA	NA
WP_004871674.1|4324350_4325091_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.8e-20
WP_014228637.1|4325294_4327577_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.9e-161
>prophage 301
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4331625	4332714	6179177		Streptococcus_phage(100.0%)	1	NA	NA
WP_032694246.1|4331625_4332714_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.3e-80
>prophage 302
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4337007	4341560	6179177		Bacillus_phage(100.0%)	3	NA	NA
WP_004100704.1|4337007_4337295_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
WP_032694244.1|4337510_4339766_+	ComEC family protein	NA	NA	NA	NA	NA
WP_004849478.1|4339811_4341560_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	5.1e-58
>prophage 303
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4357594	4367864	6179177	transposase,tRNA	Clostridium_botulinum_C_phage(16.67%)	7	NA	NA
WP_014228411.1|4357594_4358029_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_009653304.1|4358120_4359311_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_014228653.1|4359498_4360584_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.0	1.5e-100
WP_004849497.1|4361175_4362576_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.0	5.0e-80
WP_025107499.1|4362879_4364082_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.1	6.4e-44
WP_014228655.1|4364409_4367025_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_032695054.1|4367090_4367864_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.1e-32
>prophage 304
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4374576	4376484	6179177		Tupanvirus(100.0%)	1	NA	NA
WP_004849507.1|4374576_4376484_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.6e-50
>prophage 305
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4389259	4391314	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_032695058.1|4389259_4391314_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.2	2.7e-18
>prophage 306
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4397179	4398347	6179177	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_098141323.1|4397179_4398347_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	6.9e-168
>prophage 307
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4405470	4407618	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_004849540.1|4405470_4407618_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.6e-24
>prophage 308
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4418192	4418852	6179177	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004100829.1|4418192_4418852_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
>prophage 309
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4437291	4438032	6179177		Planktothrix_phage(100.0%)	1	NA	NA
WP_032693372.1|4437291_4438032_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.4e-28
>prophage 310
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4462098	4462878	6179177		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_032693408.1|4462098_4462878_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	3.3e-17
>prophage 311
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4467145	4473766	6179177		Morganella_phage(50.0%)	5	NA	NA
WP_004849644.1|4467145_4467358_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	8.4e-24
WP_004849645.1|4468019_4468241_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	56.5	6.7e-16
WP_032693386.1|4468878_4471998_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.6	1.0e-45
WP_014838032.1|4472316_4472703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131145.1|4473061_4473766_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	5.3e-30
>prophage 312
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4487785	4488814	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_032693394.1|4487785_4488814_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.4	5.2e-18
>prophage 313
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4494344	4495727	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
WP_014228757.1|4494344_4495727_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.0	5.7e-20
>prophage 314
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4509217	4509958	6179177		Planktothrix_phage(100.0%)	1	NA	NA
WP_014228772.1|4509217_4509958_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	6.7e-36
>prophage 315
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4517406	4518309	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_014228780.1|4517406_4518309_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.1	4.7e-15
>prophage 316
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4522070	4528648	6179177		Serratia_phage(50.0%)	4	NA	NA
WP_032693405.1|4522070_4524368_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	44.2	5.0e-05
WP_032693406.1|4524419_4524740_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_004131253.1|4524760_4525837_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_014228785.1|4526146_4528648_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.9	6.1e-12
>prophage 317
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4542630	4544878	6179177		Enterobacteria_phage(100.0%)	3	NA	NA
WP_004131287.1|4542630_4542804_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	88.9	3.2e-05
WP_032692839.1|4543039_4544362_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.1	2.9e-199
WP_014228795.1|4544383_4544878_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	78.1	3.3e-39
>prophage 318
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4561502	4564633	6179177		Cronobacter_phage(50.0%)	4	NA	NA
WP_071993358.1|4561502_4562567_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.1	7.3e-92
WP_032692832.1|4562617_4562911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032692830.1|4563026_4563815_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_014228810.1|4563937_4564633_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.8	1.2e-26
>prophage 319
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4573982	4578156	6179177		Acanthocystis_turfacea_Chlorella_virus(50.0%)	6	NA	NA
WP_032692826.1|4573982_4574921_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	28.4	4.6e-05
WP_014838074.1|4575006_4575744_+	phosphatase	NA	NA	NA	NA	NA
WP_014228819.1|4575766_4576321_+	molecular chaperone	NA	NA	NA	NA	NA
WP_103449196.1|4576424_4576916_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_014228821.1|4577206_4577512_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_014228822.1|4577601_4578156_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.6	5.1e-28
>prophage 320
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4586525	4587446	6179177		Morganella_phage(100.0%)	1	NA	NA
WP_004849864.1|4586525_4587446_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.4	1.3e-57
>prophage 321
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4590676	4590922	6179177		Salmonella_phage(100.0%)	1	NA	NA
WP_004101040.1|4590676_4590922_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	47.4	7.7e-13
>prophage 322
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4612170	4617924	6179177	transposase	Trichoplusia_ni_ascovirus(25.0%)	7	NA	NA
WP_004131399.1|4612170_4612905_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.9e-15
WP_000103754.1|4613115_4613352_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_071886325.1|4613441_4614683_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_014228411.1|4614877_4615312_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_032693889.1|4615458_4616268_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_032693890.1|4616270_4617293_+	cell division protein YceG	NA	NA	NA	NA	NA
WP_004849914.1|4617282_4617924_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	5.9e-28
>prophage 323
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4633695	4633953	6179177		Erwinia_phage(100.0%)	1	NA	NA
WP_004131427.1|4633695_4633953_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.6e-05
>prophage 324
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4640245	4643996	6179177		Planktothrix_phage(50.0%)	4	NA	NA
WP_014228855.1|4640245_4640947_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	5.4e-35
WP_014228856.1|4640946_4642191_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_032693895.1|4642239_4643151_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_032693896.1|4643165_4643996_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	2.8e-22
>prophage 325
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4651100	4652051	6179177		Cyanophage(100.0%)	1	NA	NA
WP_014228865.1|4651100_4652051_+	transaldolase	NA	A0A127KMN5	Cyanophage	35.1	1.6e-13
>prophage 326
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4657331	4658468	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_014228869.1|4657331_4658468_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.6	1.3e-30
>prophage 327
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4665251	4756272	6179177	portal,tRNA,transposase,protease,holin,head,tail,capsid,integrase,terminase	Salmonella_phage(16.13%)	105	4664388:4664405	4749452:4749469
4664388:4664405	attL	CCAGCGCCGCCGCGCCCC	NA	NA	NA	NA
WP_014228873.1|4665251_4666622_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_004131471.1|4666625_4667267_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004849976.1|4667326_4668433_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_032693069.1|4668471_4668948_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032693070.1|4668957_4669620_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004131480.1|4669856_4671107_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
WP_064411135.1|4671220_4672363_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.2	1.1e-170
WP_074192178.1|4672352_4672589_-	excisionase	NA	NA	NA	NA	NA
WP_064411134.1|4672901_4673135_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	56.8	1.1e-13
WP_064411132.1|4673834_4674167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064411130.1|4674854_4675262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064411129.1|4675258_4676044_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.7e-61
WP_064411128.1|4676036_4676237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064411127.1|4676236_4676764_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.7	5.4e-64
WP_064411126.1|4676896_4677724_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	84.4	6.2e-131
WP_004123001.1|4677780_4678152_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	93.5	2.8e-59
WP_064411191.1|4679009_4679456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049091349.1|4679689_4679923_-	hypothetical protein	NA	Q56BD7	Escherichia_virus	37.0	6.6e-06
WP_064147558.1|4680169_4680802_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	1.0e-32
WP_064411125.1|4680899_4681130_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	3.6e-12
WP_049069267.1|4681158_4681710_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	69.3	3.2e-67
WP_064349867.1|4681882_4682062_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.5	5.6e-13
WP_064411124.1|4682051_4682963_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	78.0	2.4e-51
WP_049083062.1|4682959_4683418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064411123.1|4683596_4684550_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	75.0	2.2e-127
WP_049083060.1|4684542_4686513_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.9	1.4e-197
WP_064411122.1|4686509_4686986_+|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	66.2	4.5e-17
WP_064411121.1|4686982_4687381_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	70.5	6.0e-47
WP_103449107.1|4687469_4688192_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	67.9	1.4e-73
WP_004118622.1|4688249_4689749_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_038423655.1|4689745_4690501_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
WP_048258058.1|4690725_4691250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049083055.1|4691258_4692314_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.7	4.2e-108
WP_064411119.1|4692332_4693163_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	48.1	1.3e-56
WP_064411190.1|4693373_4693565_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	84.1	8.3e-23
WP_064411118.1|4693714_4694794_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.3	1.8e-170
WP_064411117.1|4695070_4695571_+	hypothetical protein	NA	Q2NPG0	Xanthomonas_virus	41.6	1.1e-21
WP_015370231.1|4695702_4696128_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	1.1e-59
WP_031280382.1|4696815_4697115_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_004206700.1|4697111_4697651_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	5.1e-102
WP_064411116.1|4697647_4697995_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.0	5.2e-39
WP_064411115.1|4697991_4698267_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	55.1	5.2e-18
WP_142367605.1|4698394_4698574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102000563.1|4698607_4699156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064411114.1|4699742_4700033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064411113.1|4700150_4700396_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	60.5	1.2e-18
WP_032694448.1|4700450_4700792_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	75.7	2.7e-48
WP_014838137.1|4700909_4701374_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	6.3e-48
WP_077253184.1|4701327_4703064_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.9	1.1e-137
WP_064411112.1|4703070_4704390_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	2.2e-138
WP_014838140.1|4704365_4705073_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	6.4e-68
WP_047934992.1|4705082_4706303_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.5	3.4e-141
WP_064411111.1|4706348_4706603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032734570.1|4706608_4706941_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_048258044.1|4706953_4707292_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	1.2e-37
WP_014838144.1|4707288_4707738_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	5.1e-63
WP_064411110.1|4707734_4708082_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	59.3	1.8e-31
WP_015370213.1|4708138_4708849_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	69.1	1.3e-84
WP_064411109.1|4708879_4709284_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.5	3.2e-32
WP_064411108.1|4709286_4709592_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.0	2.8e-28
WP_064411107.1|4709784_4710300_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	69.5	1.9e-61
WP_070082917.1|4710495_4710870_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	51.6	7.6e-28
WP_064411106.1|4710923_4714331_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	42.9	8.7e-187
WP_064411105.1|4714354_4714819_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.3	1.7e-53
WP_064411104.1|4714815_4715292_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.1	2.3e-53
WP_064411103.1|4715307_4715688_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	3.2e-58
WP_064411102.1|4715684_4718762_+	kinase	NA	A0A286S259	Klebsiella_phage	61.0	0.0e+00
WP_064411100.1|4722965_4723469_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	71.9	1.6e-52
WP_064411099.1|4723598_4723841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064411098.1|4723840_4724083_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.9	1.2e-29
WP_064411097.1|4724161_4724581_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	2.1e-34
WP_064411096.1|4724582_4725848_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_064411095.1|4725890_4726532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142394557.1|4727104_4727470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064182859.1|4727470_4727908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074188128.1|4728985_4729138_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.0	1.9e-17
WP_032693073.1|4729282_4731067_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	5.6e-20
WP_014228927.1|4731144_4732335_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_014228929.1|4733693_4734461_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.2	2.6e-14
WP_014228930.1|4734461_4735415_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_014228931.1|4735411_4736410_-	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.1	5.4e-12
WP_064388519.1|4736406_4737309_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032692760.1|4737367_4739704_-	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_014228934.1|4739802_4740750_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_014228935.1|4740746_4741268_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014228936.1|4741527_4742316_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009653416.1|4742859_4743774_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
WP_014838171.1|4743864_4744503_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004131510.1|4744632_4744896_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_086074258.1|4744944_4745070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100248259.1|4745210_4745285_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004101234.1|4745284_4745386_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_014838172.1|4745443_4746457_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_014228939.1|4746753_4746993_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014228940.1|4746987_4747332_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_014228941.1|4747318_4747828_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014838173.1|4747990_4748683_+	CTP synthase	NA	NA	NA	NA	NA
WP_032692759.1|4748720_4749905_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
4749452:4749469	attR	CCAGCGCCGCCGCGCCCC	NA	NA	NA	NA
WP_014228944.1|4750005_4750797_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004138309.1|4750780_4751227_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004850011.1|4751390_4751891_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_014228946.1|4751924_4753421_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	4.1e-08
WP_032692758.1|4753419_4753695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228948.1|4753782_4754940_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_032692757.1|4754988_4756272_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.6	2.2e-10
>prophage 328
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4759604	4760459	6179177		Indivirus(100.0%)	1	NA	NA
WP_014228950.1|4759604_4760459_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.3	3.2e-13
>prophage 329
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4764087	4766349	6179177		Tupanvirus(100.0%)	2	NA	NA
WP_032692756.1|4764087_4765341_-	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	28.3	9.1e-25
WP_032692755.1|4765707_4766349_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	39.1	2.6e-20
>prophage 330
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4772284	4774240	6179177		Streptococcus_phage(100.0%)	1	NA	NA
WP_014228966.1|4772284_4774240_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.9	4.4e-42
>prophage 331
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4778470	4779103	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_032692752.1|4778470_4779103_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.9	3.4e-12
>prophage 332
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4785113	4786334	6179177		Klosneuvirus(100.0%)	1	NA	NA
WP_032692746.1|4785113_4786334_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.2e-26
>prophage 333
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4795751	4796579	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_004850083.1|4795751_4796579_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	1.2e-70
>prophage 334
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4802794	4808534	6179177		Tupanvirus(50.0%)	5	NA	NA
WP_014228985.1|4802794_4805053_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.9	2.1e-144
WP_072351776.1|4805141_4805489_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_014228987.1|4805564_4806956_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_032692741.1|4807090_4807681_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_014228989.1|4807772_4808534_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	1.8e-15
>prophage 335
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4812909	4814226	6179177		Streptococcus_phage(100.0%)	1	NA	NA
WP_032692738.1|4812909_4814226_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.6	1.6e-40
>prophage 336
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4822739	4825697	6179177		Acinetobacter_phage(100.0%)	2	NA	NA
WP_025106981.1|4822739_4824098_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	4.7e-35
WP_004850135.1|4824101_4825697_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.7	1.1e-46
>prophage 337
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4838650	4841248	6179177		Tupanvirus(100.0%)	1	NA	NA
WP_014229012.1|4838650_4841248_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.0	2.2e-89
>prophage 338
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4846092	4846683	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004121245.1|4846092_4846683_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 339
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4852261	4858447	6179177		Bodo_saltans_virus(33.33%)	5	NA	NA
WP_032692730.1|4852261_4854196_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	25.1	1.4e-08
WP_014229020.1|4854277_4855435_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004121225.1|4855617_4856406_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004850180.1|4856643_4857453_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.6e-14
WP_014229021.1|4857454_4858447_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.7	2.1e-08
>prophage 340
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4881566	4882586	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_014229034.1|4881566_4882586_+	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.6	6.9e-15
>prophage 341
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4891452	4892247	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_050595113.1|4891452_4892247_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	1.4e-31
>prophage 342
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4906998	4907733	6179177		Planktothrix_phage(100.0%)	1	NA	NA
WP_032692711.1|4906998_4907733_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	5.3e-33
>prophage 343
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4912361	4984029	6179177	plate,protease,holin,tRNA	Enterobacteria_phage(22.22%)	65	NA	NA
WP_032694500.1|4912361_4913705_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_014229072.1|4913701_4914367_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032694501.1|4914363_4916052_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014229074.1|4916195_4916687_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_070082925.1|4916934_4919577_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	6.5e-97
WP_032694503.1|4919573_4922069_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.5	1.0e-19
WP_032694504.1|4922321_4924289_+	membrane protein	NA	A0A077K801	Ralstonia_phage	32.4	6.6e-62
WP_014229081.1|4924290_4924551_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032694505.1|4924550_4925984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064388733.1|4926125_4929359_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_014838278.1|4929454_4929733_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032694507.1|4929745_4931503_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032694508.1|4931466_4932552_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032694509.1|4932529_4933069_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032694510.1|4933070_4933526_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032694511.1|4933549_4934884_+	membrane protein	NA	NA	NA	NA	NA
WP_014229090.1|4935045_4936725_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_014229091.1|4936779_4938234_-	MFS transporter	NA	NA	NA	NA	NA
WP_014229092.1|4939115_4940498_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_032693662.1|4940561_4941521_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_032693663.1|4941535_4942069_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_014838292.1|4942065_4943289_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032693664.1|4943285_4944008_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_032693665.1|4944009_4945269_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004850270.1|4945265_4945985_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014838295.1|4945981_4946416_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_032693666.1|4946658_4947384_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	3.5e-45
WP_032693677.1|4947485_4947830_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_032693667.1|4947927_4949049_-	MFS transporter	NA	NA	NA	NA	NA
WP_071889103.1|4949257_4950394_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014838299.1|4950565_4951450_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838300.1|4951563_4952448_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103449113.1|4952606_4953578_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_032693669.1|4953622_4954453_-	oxidoreductase	NA	NA	NA	NA	NA
WP_032693678.1|4954647_4955673_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071532263.1|4956511_4956700_+	cold-shock protein	NA	NA	NA	NA	NA
WP_032693671.1|4957069_4957699_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032693672.1|4957824_4958406_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_004850292.1|4958602_4959166_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_032693673.1|4959220_4959535_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_004850297.1|4959712_4959904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014229113.1|4960060_4960255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004850301.1|4960541_4960964_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	2.6e-32
WP_014229114.1|4960963_4962229_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	1.0e-156
WP_032693679.1|4962301_4963369_-	oxidoreductase	NA	NA	NA	NA	NA
WP_032693674.1|4963385_4964129_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.6	8.6e-15
WP_032693675.1|4964745_4965366_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032693676.1|4965708_4966692_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_014229118.1|4967175_4968549_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
WP_014838310.1|4968593_4969529_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
WP_014229119.1|4970339_4971278_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_014229121.1|4971656_4971947_-	hypothetical protein	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
WP_004850323.1|4972135_4972570_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_004850325.1|4972652_4972865_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_009652979.1|4973018_4974125_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.4	4.9e-107
WP_014838312.1|4974482_4978010_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_009653037.1|4978644_4979181_+	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
WP_032693411.1|4979641_4980004_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	58.3	5.4e-31
WP_009653048.1|4980080_4980473_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
WP_032749344.1|4980462_4980735_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
WP_032693412.1|4980742_4981285_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.3	8.9e-70
WP_032693413.1|4981511_4981877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004101621.1|4982204_4982477_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014229134.1|4982473_4982914_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004112629.1|4983039_4984029_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
>prophage 344
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	4993317	4994838	6179177		Indivirus(100.0%)	1	NA	NA
WP_032693419.1|4993317_4994838_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.3	1.2e-10
>prophage 345
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5017433	5018940	6179177		Streptococcus_phage(50.0%)	2	NA	NA
WP_032693428.1|5017433_5018123_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.1	9.8e-13
WP_014229164.1|5018193_5018940_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	29.9	6.2e-05
>prophage 346
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5040527	5041598	6179177		Synechococcus_phage(100.0%)	1	NA	NA
WP_014838352.1|5040527_5041598_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	39.3	2.4e-10
>prophage 347
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5051373	5055984	6179177		Klosneuvirus(50.0%)	2	NA	NA
WP_014838357.1|5051373_5055276_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
WP_014229195.1|5055324_5055984_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	50.4	1.4e-29
>prophage 348
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5067994	5072613	6179177		Bacillus_phage(20.0%)	7	NA	NA
WP_014229205.1|5067994_5068966_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.7	2.1e-13
WP_004850536.1|5069031_5069235_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	6.0e-11
WP_014838364.1|5069527_5069725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004101739.1|5070031_5070274_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	82.3	1.6e-31
WP_025107908.1|5070499_5071027_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.7	2.4e-19
WP_004101746.1|5071196_5071472_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_014229209.1|5071494_5072613_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.5	4.7e-33
>prophage 349
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5079849	5081358	6179177		Mollivirus(100.0%)	1	NA	NA
WP_014229212.1|5079849_5081358_+	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	29.5	1.7e-30
>prophage 350
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5094703	5096668	6179177		Phage_TP(100.0%)	1	NA	NA
WP_032693487.1|5094703_5096668_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.0	3.0e-22
>prophage 351
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5103417	5104428	6179177		Mycoplasma_phage(100.0%)	1	NA	NA
WP_014229231.1|5103417_5104428_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	35.8	4.7e-24
>prophage 352
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5118546	5119272	6179177	integrase	Phage_21(100.0%)	1	5111008:5111021	5127363:5127376
5111008:5111021	attL	GGATACCGTCGACG	NA	NA	NA	NA
WP_158657246.1|5118546_5119272_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	48.2	9.5e-59
WP_158657246.1|5118546_5119272_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	48.2	9.5e-59
5127363:5127376	attR	GGATACCGTCGACG	NA	NA	NA	NA
>prophage 353
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5125593	5127690	6179177		Salmonella_phage(100.0%)	1	NA	NA
WP_101869240.1|5125593_5127690_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	68.2	4.1e-139
>prophage 354
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5138223	5139003	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_014229256.1|5138223_5139003_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	1.4e-20
>prophage 355
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5152723	5153425	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_014838416.1|5152723_5153425_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	1.1e-30
>prophage 356
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5159016	5160561	6179177		Escherichia_phage(100.0%)	1	NA	NA
WP_070082929.1|5159016_5160561_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 357
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5166663	5168154	6179177		Mycobacterium_phage(100.0%)	1	NA	NA
WP_049069851.1|5166663_5168154_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.3	1.1e-32
>prophage 358
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5178134	5179739	6179177		Planktothrix_phage(100.0%)	1	NA	NA
WP_014229286.1|5178134_5179739_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.1e-19
>prophage 359
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5183980	5188926	6179177		Tupanvirus(33.33%)	4	NA	NA
WP_004120604.1|5183980_5184991_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	2.5e-25
WP_014229291.1|5185247_5185847_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	40.6	5.3e-23
WP_074188781.1|5186648_5187176_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032695035.1|5187213_5188926_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.4	1.2e-32
>prophage 360
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5207496	5211080	6179177		Bacillus_virus(50.0%)	2	NA	NA
WP_025108277.1|5207496_5208192_+	MgtC family protein	NA	G3MA03	Bacillus_virus	43.1	6.2e-15
WP_032695024.1|5208347_5211080_+	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	25.6	1.9e-35
>prophage 361
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5219352	5220941	6179177		Bacillus_virus(50.0%)	2	NA	NA
WP_009652192.1|5219352_5220168_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	21.3	4.3e-07
WP_014838454.1|5220164_5220941_+	ABC transporter ATP-binding protein	NA	A0A140XAK6	Dickeya_phage	48.4	1.5e-17
>prophage 362
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5234129	5238248	6179177		Klosneuvirus(50.0%)	4	NA	NA
WP_032695015.1|5234129_5235515_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.5	9.7e-28
WP_014838463.1|5235822_5236758_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004850829.1|5236782_5237523_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032695014.1|5237519_5238248_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	2.8e-18
>prophage 363
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5255337	5256222	6179177		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_004850866.1|5255337_5256222_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.7	3.7e-81
>prophage 364
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5263457	5264855	6179177		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_032695001.1|5263457_5264855_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	5.3e-42
>prophage 365
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5296184	5316747	6179177		Bacillus_phage(50.0%)	5	NA	NA
WP_032694989.1|5296184_5297987_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	23.5	5.7e-20
WP_071993415.1|5297973_5299776_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.4	3.2e-31
WP_032694987.1|5299942_5300902_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_064388354.1|5301085_5307184_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.9	1.5e-32
WP_032694985.1|5307270_5316747_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	8.1e-49
>prophage 366
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5332302	5333085	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032694976.1|5332302_5333085_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	4.8e-16
>prophage 367
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5337692	5339690	6179177		Acinetobacter_phage(100.0%)	1	NA	NA
WP_086073937.1|5337692_5339690_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.3	4.2e-08
>prophage 368
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5343440	5344169	6179177		Escherichia_phage(100.0%)	1	NA	NA
WP_032694970.1|5343440_5344169_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	38.4	8.4e-23
>prophage 369
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5362363	5363200	6179177		Mycobacterium_phage(100.0%)	1	NA	NA
WP_032694956.1|5362363_5363200_-	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	38.5	1.1e-13
>prophage 370
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5372463	5373996	6179177		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032694951.1|5372463_5373996_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	5.0e-17
>prophage 371
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5381768	5385332	6179177		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_014838545.1|5381768_5382764_+	2-hydroxyacid dehydrogenase	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	30.5	4.4e-22
WP_004851075.1|5382853_5384116_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_032694947.1|5384246_5385332_-	porin	NA	Q1MVN1	Enterobacteria_phage	67.1	7.9e-142
>prophage 372
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5389760	5390570	6179177		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_014229450.1|5389760_5390570_-	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	29.4	2.8e-11
>prophage 373
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5394557	5396015	6179177		Mycoplasma_phage(100.0%)	1	NA	NA
WP_032694938.1|5394557_5396015_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.3	1.7e-38
>prophage 374
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5403323	5404064	6179177		Indivirus(100.0%)	1	NA	NA
WP_032695038.1|5403323_5404064_-	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.1	7.3e-14
>prophage 375
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5407565	5408357	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_014229467.1|5407565_5408357_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.5	1.6e-19
>prophage 376
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5428284	5429646	6179177		Bacillus_phage(100.0%)	1	NA	NA
WP_088167926.1|5428284_5429646_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.4	3.4e-17
>prophage 377
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5439778	5440159	6179177		Streptococcus_phage(100.0%)	1	NA	NA
WP_004102351.1|5439778_5440159_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	1.4e-08
>prophage 378
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5444302	5445808	6179177		Staphylococcus_phage(50.0%)	2	NA	NA
WP_014229495.1|5444302_5445001_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	6.2e-15
WP_014229496.1|5445010_5445808_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A1M7XV31	Cedratvirus	26.9	1.2e-11
>prophage 379
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5449988	5451092	6179177		uncultured_virus(100.0%)	1	NA	NA
WP_014229500.1|5449988_5451092_-	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.9	1.1e-101
>prophage 380
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5458977	5466197	6179177		Escherichia_phage(50.0%)	5	NA	NA
WP_032694473.1|5458977_5460048_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	44.6	1.3e-64
WP_032694472.1|5460255_5463363_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	60.0	0.0e+00
WP_014229511.1|5463418_5464669_+	MFS transporter	NA	NA	NA	NA	NA
WP_014838607.1|5464742_5465831_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	82.5	3.7e-176
WP_004851229.1|5465933_5466197_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	82.4	3.8e-34
>prophage 381
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5472420	5482812	6179177		Klosneuvirus(20.0%)	9	NA	NA
WP_032694468.1|5472420_5474463_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.2	1.4e-14
WP_004851244.1|5474634_5475384_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_014229523.1|5475474_5476161_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004851249.1|5476204_5476636_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	39.3	1.5e-19
WP_032694481.1|5476913_5478377_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	31.4	1.4e-45
WP_029946863.1|5478611_5479988_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_014838618.1|5480031_5481051_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004851257.1|5481065_5482280_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	9.7e-48
WP_014229526.1|5482485_5482812_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	7.6e-24
>prophage 382
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5487565	5489691	6179177		Escherichia_phage(100.0%)	3	NA	NA
WP_032694466.1|5487565_5488183_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	2.6e-73
WP_014229530.1|5488184_5489042_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_014838620.1|5489082_5489691_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.6	2.2e-24
>prophage 383
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5500065	5502222	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_014229540.1|5500065_5502222_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.0	7.8e-16
>prophage 384
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5509572	5510532	6179177		Salmonella_phage(100.0%)	1	NA	NA
WP_004851304.1|5509572_5510532_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	1.3e-52
>prophage 385
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5521457	5524235	6179177		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032694458.1|5521457_5524235_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.8	4.7e-66
>prophage 386
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5540029	5543164	6179177	integrase	Morganella_phage(33.33%)	3	5539700:5539715	5544346:5544361
5539700:5539715	attL	TCTTTTTCTTCTTCGT	NA	NA	NA	NA
WP_103449132.1|5540029_5541130_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	57.1	2.9e-115
WP_103449134.1|5541184_5541505_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	45.1	2.5e-19
WP_077253373.1|5541853_5543164_-	hypothetical protein	NA	A0A0K2FI18	Enterobacter_phage	31.8	7.3e-33
5544346:5544361	attR	TCTTTTTCTTCTTCGT	NA	NA	NA	NA
>prophage 387
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5547449	5565971	6179177	tail,head	Salmonella_phage(56.52%)	26	NA	NA
WP_075207223.1|5547449_5547635_-	hypothetical protein	NA	Q9B026	Phage_GMSE-1	42.2	4.0e-06
WP_103449140.1|5547634_5548540_-	hypothetical protein	NA	A0A1I9SEW2	Klebsiella_phage	57.5	4.7e-47
WP_049089424.1|5548539_5549316_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	57.3	1.8e-79
WP_101836810.1|5549312_5550512_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	71.4	6.2e-156
WP_101836809.1|5550511_5550865_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	6.7e-50
WP_101836808.1|5550864_5551620_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	76.8	3.3e-107
WP_142370436.1|5551668_5552121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101836806.1|5552123_5552474_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	80.8	7.9e-27
WP_101836805.1|5552476_5553541_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	73.2	5.2e-146
WP_101836804.1|5553543_5553846_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	68.0	8.8e-35
WP_101836803.1|5553845_5554433_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	77.2	1.9e-73
WP_101836802.1|5554432_5556349_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	64.5	2.8e-227
WP_101836801.1|5556338_5556491_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	80.0	4.1e-17
WP_101836800.1|5556526_5557006_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	64.7	2.2e-51
WP_101836799.1|5557009_5557450_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	80.1	1.0e-63
WP_103449142.1|5557459_5558611_-	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	82.0	4.0e-176
WP_101836797.1|5558613_5559165_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	47.2	5.0e-44
WP_101836796.1|5559157_5559562_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	73.8	1.9e-45
WP_101836795.1|5559561_5560068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101836794.1|5560064_5560484_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	63.7	1.2e-42
WP_101836793.1|5560452_5560734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049079416.1|5560779_5561721_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	3.2e-139
WP_101836792.1|5561732_5562227_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.8	6.1e-49
WP_101836791.1|5562238_5563438_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	55.1	1.9e-104
WP_101836789.1|5563915_5564464_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.7	1.1e-48
WP_101836788.1|5564519_5565971_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	67.6	1.9e-191
>prophage 388
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5570514	5588657	6179177	holin	Klebsiella_phage(73.91%)	27	NA	NA
WP_038423655.1|5570514_5571270_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
WP_049089468.1|5572254_5573019_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	46.2	2.3e-10
WP_049089470.1|5573410_5573704_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	73.2	2.6e-31
WP_094963586.1|5573700_5573856_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	76.5	2.1e-16
WP_004849284.1|5573845_5574121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049089473.1|5574117_5574462_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	86.0	7.0e-44
WP_049089475.1|5574458_5575001_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	77.5	2.6e-77
WP_031280382.1|5574997_5575297_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_023304962.1|5575991_5577077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302586.1|5577076_5578069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049090019.1|5578108_5578456_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.7	1.8e-55
WP_049286848.1|5578537_5579500_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	97.8	7.6e-181
WP_075207237.1|5579501_5581148_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	81.0	1.7e-273
WP_004152162.1|5581725_5581947_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|5582044_5582713_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|5582883_5583198_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|5583190_5583379_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|5583548_5583914_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_049090017.1|5583906_5584161_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	88.1	1.5e-35
WP_142370427.1|5584132_5584351_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	94.4	5.6e-31
WP_064342519.1|5584347_5584788_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	78.3	1.2e-56
WP_049090024.1|5584831_5585350_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	78.5	1.8e-75
WP_101836647.1|5585354_5586062_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	86.2	4.5e-106
WP_103449200.1|5586054_5586489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025714667.1|5586472_5586697_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	55.4	2.8e-17
WP_071057016.1|5586847_5587111_+	pyocin activator protein PrtN	NA	A0A1L5C290	Pseudoalteromonas_phage	45.1	7.0e-12
WP_014229564.1|5588141_5588657_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.8	4.1e-24
>prophage 389
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5602830	5605799	6179177		Molluscum_contagiosum_virus(50.0%)	3	NA	NA
WP_032692799.1|5602830_5603313_+	glutathione peroxidase	NA	A0A1S7DMQ0	Molluscum_contagiosum_virus	40.2	3.0e-16
WP_032692798.1|5603489_5604179_-	VIT family protein	NA	NA	NA	NA	NA
WP_014229576.1|5604497_5605799_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.5e-17
>prophage 390
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5617246	5617450	6179177		Salmonella_phage(100.0%)	1	NA	NA
WP_004851411.1|5617246_5617450_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	67.2	3.5e-19
>prophage 391
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5622808	5624179	6179177		Pandoravirus(100.0%)	1	NA	NA
WP_014229586.1|5622808_5624179_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	33.7	8.0e-67
>prophage 392
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5635359	5636634	6179177	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_032692908.1|5635359_5636634_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	7.2e-86
>prophage 393
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5645274	5646752	6179177		Salmonella_phage(50.0%)	2	NA	NA
WP_004119475.1|5645274_5645796_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	2.1e-47
WP_014838670.1|5645855_5646752_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	29.7	2.7e-07
>prophage 394
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5650909	5659608	6179177		Bacillus_phage(20.0%)	9	NA	NA
WP_014229604.1|5650909_5651764_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.7	4.7e-17
WP_014229605.1|5651888_5652470_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.3	2.6e-43
WP_032692912.1|5652526_5653693_-	MFS transporter	NA	NA	NA	NA	NA
WP_049082851.1|5653857_5653947_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_004851481.1|5654243_5655269_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	1.8e-31
WP_014229606.1|5655287_5656199_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032692914.1|5656311_5657496_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_014229608.1|5657794_5658943_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	6.5e-86
WP_014229609.1|5658972_5659608_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	2.1e-22
>prophage 395
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5674113	5678206	6179177		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_014229621.1|5674113_5674998_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	55.8	2.8e-81
WP_014838678.1|5675019_5675826_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004119381.1|5675932_5676568_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_032692917.1|5676792_5677422_+	LysE family transporter	NA	NA	NA	NA	NA
WP_032692919.1|5677435_5678206_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.3	6.2e-16
>prophage 396
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5683271	5688668	6179177	integrase	Planktothrix_phage(33.33%)	4	5687548:5687563	5691719:5691734
WP_032692922.1|5683271_5684252_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.2e-11
WP_014229628.1|5684248_5685214_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	26.9	1.8e-09
WP_032692923.1|5685288_5687694_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
5687548:5687563	attL	TAACAGATACCAGGCG	NA	NA	NA	NA
WP_014229630.1|5688119_5688668_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
WP_014229630.1|5688119_5688668_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
5691719:5691734	attR	TAACAGATACCAGGCG	NA	NA	NA	NA
>prophage 397
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5694687	5695239	6179177	integrase	Escherichia_phage(100.0%)	1	5691930:5691944	5702163:5702177
5691930:5691944	attL	GATATGCAGGACGTT	NA	NA	NA	NA
WP_014838689.1|5694687_5695239_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
WP_014838689.1|5694687_5695239_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	55.1	2.6e-53
5702163:5702177	attR	AACGTCCTGCATATC	NA	NA	NA	NA
>prophage 398
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5698998	5699871	6179177		Lactobacillus_phage(100.0%)	1	NA	NA
WP_014229640.1|5698998_5699871_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
>prophage 399
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5703297	5704368	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_032692928.1|5703297_5704368_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	9.8e-28
>prophage 400
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5732312	5734655	6179177		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032695051.1|5732312_5734655_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.1	3.9e-05
>prophage 401
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5755534	5759862	6179177		Planktothrix_phage(50.0%)	3	NA	NA
WP_032694740.1|5755534_5756356_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	5.6e-15
WP_088168676.1|5756862_5758935_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_014838728.1|5759073_5759862_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.8	8.5e-29
>prophage 402
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5772925	5774889	6179177		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_014229695.1|5772925_5773942_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	6.0e-43
WP_025108198.1|5773938_5774889_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.9	4.8e-34
>prophage 403
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5793049	5794270	6179177		environmental_halophage(100.0%)	1	NA	NA
WP_032694061.1|5793049_5794270_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.6	2.6e-93
>prophage 404
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5811975	5829962	6179177	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_014229722.1|5811975_5814354_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	2.9e-173
WP_004851771.1|5814696_5815530_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_014229723.1|5815683_5816730_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.4	2.3e-82
WP_014229724.1|5816847_5817075_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_032694067.1|5817109_5818552_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.4	7.4e-55
WP_004134084.1|5818713_5819178_-	NLP/P60 protein	NA	NA	NA	NA	NA
WP_032694068.1|5819259_5820009_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	4.2e-09
WP_014229728.1|5820008_5820560_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_014229729.1|5820784_5821585_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_009653750.1|5821611_5822598_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004851790.1|5822698_5822998_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
WP_032694069.1|5823002_5825390_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004851795.1|5825405_5826389_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.9e-34
WP_001386830.1|5826618_5826663_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004102963.1|5826786_5827143_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|5827193_5827391_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_052746887.1|5827487_5828030_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	5.3e-14
WP_004102966.1|5828033_5829962_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.7e-128
>prophage 405
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5839325	5842222	6179177		Lactobacillus_phage(33.33%)	3	NA	NA
WP_014229737.1|5839325_5840162_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	41.2	3.9e-08
WP_103449148.1|5840207_5841212_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	28.6	6.8e-15
WP_032694075.1|5841208_5842222_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.7e-13
>prophage 406
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5850524	5860947	6179177		Erwinia_phage(20.0%)	10	NA	NA
WP_032694077.1|5850524_5851142_-	thymidine kinase	NA	A0A191ZC13	Erwinia_phage	52.6	3.3e-52
WP_004121719.1|5851697_5852105_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_004851836.1|5852239_5853142_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.5e-58
WP_004851838.1|5853339_5854353_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	3.4e-06
WP_014229740.1|5854433_5855342_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_014229741.1|5855454_5855913_+	YchJ family protein	NA	NA	NA	NA	NA
WP_004121732.1|5855955_5856798_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	46.3	1.6e-12
WP_004103123.1|5858027_5858705_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_014229743.1|5858704_5859415_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_014838755.1|5859411_5860947_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
>prophage 407
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5877381	5878170	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_014838761.1|5877381_5878170_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	1.0e-29
>prophage 408
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5883528	5889234	6179177		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_009651994.1|5883528_5883759_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.7	9.1e-08
WP_004121802.1|5884024_5885125_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_004103146.1|5885213_5886068_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	8.9e-48
WP_004851879.1|5886107_5886920_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004851880.1|5886923_5887316_-	SirB family protein	NA	NA	NA	NA	NA
WP_032694081.1|5887312_5888152_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004851884.1|5888151_5889234_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.0	1.1e-07
>prophage 409
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5892448	5895325	6179177		Tupanvirus(50.0%)	2	NA	NA
WP_004103157.1|5892448_5893396_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
WP_014229756.1|5893645_5895325_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	1.1e-22
>prophage 410
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5899001	5900009	6179177	integrase	uncultured_Caudovirales_phage(100.0%)	1	5889544:5889563	5913798:5913817
5889544:5889563	attL	GCTGGCTTCCTGCTCGACAA	NA	NA	NA	NA
WP_074193846.1|5899001_5900009_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
WP_074193846.1|5899001_5900009_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	33.4	2.1e-48
5913798:5913817	attR	TTGTCGAGCAGGAAGCCAGC	NA	NA	NA	NA
>prophage 411
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5918592	5920065	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032694095.1|5918592_5920065_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.7	2.8e-25
>prophage 412
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5923086	5923545	6179177		Acinetobacter_phage(100.0%)	1	NA	NA
WP_009651983.1|5923086_5923545_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.9	2.1e-19
>prophage 413
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5930361	5936558	6179177		Morganella_phage(25.0%)	6	NA	NA
WP_032694098.1|5930361_5930889_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	57.5	2.5e-48
WP_014229779.1|5930967_5931462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032694100.1|5931695_5933336_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	2.0e-133
WP_004851947.1|5933651_5934545_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229781.1|5934604_5935291_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.1	3.0e-06
WP_025108425.1|5935469_5936558_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	6.7e-24
>prophage 414
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5957941	5958553	6179177		Geobacillus_virus(100.0%)	1	NA	NA
WP_009651970.1|5957941_5958553_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 415
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5974043	5982128	6179177	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_014229806.1|5974043_5975729_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	4.2e-33
WP_004852007.1|5975937_5976522_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_004852009.1|5976565_5977261_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_014229807.1|5977328_5979239_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.9	4.2e-90
WP_004113724.1|5979371_5979716_+	RidA family protein	NA	NA	NA	NA	NA
WP_014229808.1|5979886_5981026_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_014229809.1|5981033_5982128_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.3	1.8e-21
>prophage 416
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5989290	5990646	6179177		Pandoravirus(100.0%)	1	NA	NA
WP_032694111.1|5989290_5990646_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.3	2.7e-43
>prophage 417
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	5994490	5996050	6179177		Moraxella_phage(100.0%)	1	NA	NA
WP_004852040.1|5994490_5996050_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	6.6e-41
>prophage 418
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6003486	6003696	6179177		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|6003486_6003696_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 419
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6007929	6011627	6179177	transposase,protease	Clostridium_botulinum_C_phage(50.0%)	3	NA	NA
WP_014228411.1|6007929_6008364_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_014229823.1|6008460_6009342_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_032694908.1|6009578_6011627_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	2.6e-85
>prophage 420
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6019095	6019749	6179177		Escherichia_phage(100.0%)	1	NA	NA
WP_014229829.1|6019095_6019749_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	52.1	1.7e-59
>prophage 421
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6028998	6029967	6179177		Pectobacterium_phage(50.0%)	2	NA	NA
WP_004103351.1|6028998_6029229_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
WP_014229839.1|6029307_6029967_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.8	2.6e-15
>prophage 422
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6037408	6043082	6179177		Cyanophage(50.0%)	4	NA	NA
WP_004122041.1|6037408_6038884_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
WP_004852107.1|6039245_6040115_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229845.1|6040240_6041683_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_014229846.1|6041747_6043082_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	62.9	1.2e-22
>prophage 423
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6048104	6054445	6179177		Listeria_phage(25.0%)	7	NA	NA
WP_014229851.1|6048104_6049427_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_014229852.1|6049442_6050387_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_014229853.1|6050465_6051218_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	3.0e-15
WP_014229854.1|6051217_6052003_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_004852130.1|6052211_6053222_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.6	8.1e-08
WP_004103390.1|6053230_6053842_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014229855.1|6053923_6054445_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 424
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6058317	6065038	6179177	tRNA	Escherichia_coli_phage(33.33%)	7	NA	NA
WP_064388207.1|6058317_6059136_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.6e-57
WP_004122068.1|6059189_6059585_+	membrane protein	NA	NA	NA	NA	NA
WP_009652021.1|6059624_6060368_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.1	1.5e-22
WP_004852151.1|6060364_6061387_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_014229858.1|6061685_6062429_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_014838837.1|6062505_6063075_-	VOC family protein	NA	NA	NA	NA	NA
WP_032693591.1|6063304_6065038_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	34.2	4.1e-84
>prophage 425
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6072061	6073576	6179177		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_014229863.1|6072061_6073576_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.5e-10
>prophage 426
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6090853	6091606	6179177		Bacillus_virus(100.0%)	1	NA	NA
WP_032693583.1|6090853_6091606_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.4e-27
>prophage 427
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6098312	6113501	6179177	integrase	Burkholderia_phage(25.0%)	14	6109611:6109626	6114501:6114516
WP_032693580.1|6098312_6099980_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.7	9.3e-17
WP_025106102.1|6100087_6100267_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_004852222.1|6100342_6101254_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_032693579.1|6101437_6102349_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_025106100.1|6102323_6102818_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.0	1.4e-32
WP_025106099.1|6102798_6104232_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.5	4.6e-97
WP_014229888.1|6104288_6104984_-	phosphohydrolase	NA	S4W232	Pandoravirus	26.5	2.3e-06
WP_004852229.1|6105026_6105308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014229889.1|6105935_6107006_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.1	5.3e-90
WP_014229890.1|6107658_6108048_+	GtrA family protein	NA	NA	NA	NA	NA
WP_014229891.1|6108044_6109037_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.5	1.3e-50
WP_032693578.1|6109033_6110491_+	glucosyl transferase GtrII family protein	NA	E5AGC8	Erwinia_phage	41.1	1.2e-100
6109611:6109626	attL	TCGTCATGCTTGATAA	NA	NA	NA	NA
WP_014229893.1|6111115_6111913_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_032693577.1|6112250_6113501_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	30.0	3.8e-47
6114501:6114516	attR	TCGTCATGCTTGATAA	NA	NA	NA	NA
>prophage 428
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6117774	6119283	6179177		Pithovirus(100.0%)	1	NA	NA
WP_032693574.1|6117774_6119283_+	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.7	1.4e-08
>prophage 429
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6132362	6135542	6179177		Enterobacteria_phage(50.0%)	4	NA	NA
WP_038423655.1|6132362_6133118_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
WP_032693565.1|6133191_6133686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007374395.1|6133930_6134683_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032693564.1|6134768_6135542_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.9	1.9e-09
>prophage 430
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6145355	6145931	6179177		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_032693556.1|6145355_6145931_+	peptidase C56	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	33.1	7.8e-24
>prophage 431
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6148958	6149876	6179177		Burkholderia_virus(100.0%)	1	NA	NA
WP_032693554.1|6148958_6149876_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.9	3.9e-09
>prophage 432
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6153205	6153400	6179177		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032693553.1|6153205_6153400_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	5.9e-08
>prophage 433
NZ_CP026275	Klebsiella oxytoca strain KONIH5 chromosome, complete genome	6179177	6173312	6174599	6179177		Enterobacteria_phage(100.0%)	1	NA	NA
WP_032693495.1|6173312_6174599_-	hypothetical protein	NA	Q858S9	Enterobacteria_phage	27.2	6.4e-42
>prophage 1
NZ_CP026276	Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence	282476	41499	98480	282476	transposase,integrase	Shigella_phage(14.29%)	52	44050:44064	111208:111222
WP_098141323.1|41499_42667_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	6.9e-168
WP_135721021.1|42706_42943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020801683.1|43300_43693_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_020801689.1|43696_44671_-	StbA protein	NA	A0A222YXF2	Escherichia_phage	44.2	1.5e-70
44050:44064	attL	TGGCTTTCGTGACCA	NA	NA	NA	NA
WP_017901448.1|44910_45285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901447.1|45284_45917_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	1.8e-29
WP_001568031.1|46909_47665_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	2.0e-136
WP_020804422.1|48203_48569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020801687.1|48586_49372_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.4	1.9e-52
WP_020801684.1|49422_49773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020801688.1|49923_50868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047718101.1|51453_51723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020317495.1|51710_52286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101740017.1|52316_52811_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004197807.1|52854_53223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098931.1|53256_53460_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004098928.1|53508_53766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009653916.1|53841_54096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|55485_56043_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|56036_56408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|56404_56905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|56901_57228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|57482_57839_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|57828_58230_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|58226_58517_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100881.1|58675_61642_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_072046527.1|64351_65224_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_073554103.1|65216_65288_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_040118434.1|65503_65773_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_051800686.1|65913_66480_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	38.8	3.0e-20
WP_071889121.1|66486_66714_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004118622.1|68026_69526_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_038423655.1|69522_70278_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.4e-33
WP_103449226.1|72329_73139_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_004118868.1|73131_74340_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_004118873.1|74351_75743_-	cytosine permease	NA	NA	NA	NA	NA
WP_004118875.1|75795_77472_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_004118884.1|80220_80778_-	HutD family protein	NA	NA	NA	NA	NA
WP_004118887.1|80774_81536_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_103449228.1|81634_83002_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_004118895.1|84723_86130_+	cytosine permease	NA	NA	NA	NA	NA
WP_004118898.1|86166_87756_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	25.0	3.6e-34
WP_004118901.1|87752_88745_+	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
WP_004118904.1|89371_89650_+|transposase	transposase	transposase	Q71TE9	Escherichia_phage	63.6	9.9e-25
WP_103449229.1|90985_91951_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004118925.1|91947_92766_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.5e-28
WP_004118928.1|92770_93433_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004118931.1|93429_94101_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004118155.1|94124_94973_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004118935.1|95129_96083_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.3	1.3e-10
WP_103449231.1|96169_97381_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_070083033.1|97556_98480_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.2	9.6e-165
111208:111222	attR	TGGCTTTCGTGACCA	NA	NA	NA	NA
>prophage 2
NZ_CP026276	Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence	282476	145739	188588	282476	transposase,integrase	uncultured_Caudovirales_phage(19.05%)	45	163323:163361	188205:188243
WP_098141323.1|145739_146907_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.8	6.9e-168
WP_064380668.1|146991_147222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064380665.1|147218_147950_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_064380663.1|147946_148378_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_064380661.1|148421_150416_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.5	5.0e-25
WP_086817662.1|150485_150734_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032693985.1|150784_151333_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.2	1.2e-50
WP_103449257.1|152187_152751_-	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.8	1.4e-17
WP_103449280.1|152799_154143_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_032693979.1|154232_154463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693977.1|155192_155510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693976.1|155538_155784_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	54.8	3.5e-13
WP_103449259.1|155843_156164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103449261.1|156206_156713_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	29.5	7.7e-07
WP_032693972.1|156756_157185_-	antirestriction protein	NA	NA	NA	NA	NA
WP_103449263.1|157913_158324_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_032693969.1|158370_158592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693968.1|158591_159293_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	35.3	1.3e-23
WP_032693967.1|160180_160411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032693966.1|160620_161046_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.3	6.4e-31
WP_032693965.1|161045_162320_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.4	3.1e-153
WP_032693964.1|162486_162738_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032693963.1|162734_163022_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	1.3e-19
WP_158657247.1|163025_163202_+	hypothetical protein	NA	NA	NA	NA	NA
163323:163361	attL	TGAATCGCCACGGATAATCTAGACACTTCCGAGCCGTTG	NA	NA	NA	NA
WP_103449265.1|163653_164736_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103449267.1|165749_166673_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	5.6e-165
WP_071993388.1|167292_167928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142394567.1|168219_168342_-	small membrane protein	NA	NA	NA	NA	NA
WP_103449269.1|168853_170671_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_103448975.1|170704_171824_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_077266142.1|171988_172936_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	3.9e-12
WP_001515717.1|174079_174820_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_000200070.1|175517_176528_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_000523812.1|177278_178445_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_004206785.1|178444_179416_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	1.0e-148
WP_032694619.1|181244_181670_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.8e-50
WP_032694618.1|181682_182972_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	3.6e-170
WP_032694617.1|183018_184770_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_032694616.1|184786_185149_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_025376942.1|185196_185550_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	48.7	1.1e-23
WP_032694615.1|185853_186195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902250.1|186609_186888_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_032694614.1|186878_187361_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032694621.1|187716_188097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537152.1|188303_188588_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	44.8	8.9e-13
188205:188243	attR	TGAATCGCCACGGATAATCTAGACACTTCCGAGCCGTTG	NA	NA	NA	NA
>prophage 1
NZ_CP026277	Klebsiella oxytoca strain KONIH5 plasmid pKPC-8bc0, complete sequence	56561	3895	13512	56561	integrase,transposase	Burkholderia_phage(42.86%)	8	3162:3179	10346:10363
3162:3179	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_001288432.1|3895_5329_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|5362_6577_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|6837_7602_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|7744_8011_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|8231_8705_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|8860_9874_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|10266_10836_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
10346:10363	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
WP_001749982.1|12792_13512_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
