The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	607	44419	6190364	terminase,capsid,transposase,integrase,holin,tail,portal,protease,head	Escherichia_phage(23.91%)	52	389:413	45190:45214
389:413	attL	TTATATCCATTTAACTAAGGGGACG	NA	NA	NA	NA
WP_032750825.1|607_1789_+|integrase	integrase family protein	integrase	A0A2R2Z2Y0	Escherichia_phage	84.5	4.5e-199
WP_140356938.1|1844_2693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071995741.1|2746_2932_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	59.6	5.2e-14
WP_032750822.1|4555_5635_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	73.0	9.5e-148
WP_032750820.1|5631_6420_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	8.4e-61
WP_032750819.1|6419_6719_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	45.7	5.5e-13
WP_103468726.1|7141_8299_-	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	28.6	2.4e-35
WP_032750818.1|8470_8953_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	41.5	1.7e-11
WP_071995740.1|9055_9325_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	49.3	2.9e-13
WP_103468727.1|9353_9584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032750814.1|9584_10040_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.8	2.3e-66
WP_071988277.1|10277_10490_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	1.7e-16
WP_032750813.1|10446_11361_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	59.6	3.1e-30
WP_103468728.1|11357_12167_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	71.5	3.6e-115
WP_032750809.1|12176_12566_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	73.6	3.6e-49
WP_032750807.1|12580_13276_+	antirepressor	NA	G0ZND1	Cronobacter_phage	65.2	1.6e-76
WP_103468729.1|13272_14253_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	68.4	2.2e-135
WP_032750803.1|14266_14845_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.8	5.8e-51
WP_032750801.1|14995_15235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004121584.1|15400_15796_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	93.9	3.2e-61
WP_017145564.1|15782_16064_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.3e-37
WP_032750800.1|16063_16693_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.5	3.4e-105
WP_032750799.1|16700_16976_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	51.7	1.9e-15
WP_032750798.1|16926_17124_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.2	1.5e-22
WP_032750796.1|17194_17683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408646.1|17769_18153_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	94.5	5.2e-64
WP_032750795.1|18219_18465_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	61.7	4.2e-19
WP_032750793.1|18563_18998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032750792.1|19120_19471_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	2.7e-51
WP_032750791.1|19627_20125_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.7	2.2e-62
WP_032750790.1|20124_21882_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.4	0.0e+00
WP_032408651.1|21892_22078_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	61.7	6.2e-15
WP_086013483.1|22248_23395_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
WP_103468730.1|23358_24540_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	82.9	2.3e-187
WP_032750786.1|24526_25180_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.9	7.9e-105
WP_032750785.1|25194_26403_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	82.0	1.1e-187
WP_032750784.1|26441_26645_+	hypothetical protein	NA	S5FNU1	Shigella_phage	47.0	1.4e-07
WP_032750783.1|26641_26962_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_004884319.1|26970_27309_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	6.4e-42
WP_032750782.1|27305_27755_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	8.7e-63
WP_032750781.1|27751_28099_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	60.2	2.3e-31
WP_032750779.1|28155_28860_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	3.6e-79
WP_032750777.1|28890_29295_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.7	7.2e-32
WP_032750775.1|29297_29603_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	66.0	9.5e-29
WP_158656809.1|29657_29813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019441.1|29850_30831_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_000019441.1|33786_34767_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_032750770.1|36271_36745_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.5	2.7e-54
WP_032750768.1|36731_37217_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.9	1.8e-53
WP_032750767.1|37226_37607_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_032750765.1|37603_40681_+	kinase	NA	A0A286S259	Klebsiella_phage	67.8	0.0e+00
WP_050597584.1|40756_44419_+	hypothetical protein	NA	A0A286S1R8	Klebsiella_phage	90.4	0.0e+00
45190:45214	attR	TTATATCCATTTAACTAAGGGGACG	NA	NA	NA	NA
>prophage 2
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	138769	218073	6190364	terminase,capsid,transposase,holin,tail,portal,protease,head	Enterobacteria_phage(13.64%)	69	NA	NA
WP_014839101.1|138769_139750_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.7	1.8e-73
WP_032750700.1|139798_141247_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	6.9e-101
WP_004123076.1|141516_142059_+	membrane protein	NA	NA	NA	NA	NA
WP_032750698.1|142155_143352_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_004852774.1|143556_144339_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839100.1|144352_145558_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.8e-25
WP_004852770.1|145610_146900_+	MFS transporter	NA	NA	NA	NA	NA
WP_025106698.1|146914_147718_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_032750696.1|147740_148919_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_032750695.1|148915_150175_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_014230223.1|150164_151787_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_032750694.1|153414_154485_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	3.9e-08
WP_004104002.1|154556_154811_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
WP_004852757.1|154810_155941_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	7.3e-175
WP_004852755.1|156044_158330_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.8	1.3e-284
WP_032750693.1|158674_159403_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_014839094.1|159588_162222_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	6.2e-92
WP_048252457.1|162352_165199_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.3	3.4e-43
WP_004103995.1|165243_165894_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_032750692.1|165910_168571_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_032750690.1|169342_170461_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	2.0e-116
WP_032750688.1|170563_171616_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_032750686.1|171688_172753_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	47.2	1.4e-18
WP_032750685.1|172752_173403_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_032750684.1|173479_175123_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.3	2.4e-09
WP_014230209.1|175291_176728_+	magnesium transporter	NA	NA	NA	NA	NA
WP_032750682.1|176690_177938_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	44.3	1.2e-66
WP_025106713.1|178217_179852_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_032750679.1|179896_180388_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_009653963.1|180659_181766_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_032750677.1|182353_183454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032750675.1|183569_184748_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	30.8	3.6e-31
WP_032751902.1|184750_184960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086013483.1|185172_186319_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
WP_016809733.1|186558_186750_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	85.7	1.7e-23
WP_103468735.1|186899_187949_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.0	1.5e-169
WP_103468736.1|188331_188772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468737.1|188768_190058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015370231.1|190281_190707_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	1.1e-59
WP_048258054.1|190703_190859_+	DUF3927 family protein	NA	A0A0A0YRI9	Escherichia_phage	68.8	4.2e-09
WP_103468739.1|191337_191748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004139418.1|191990_192380_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	80.3	2.4e-48
WP_014228560.1|192369_192648_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	76.1	4.0e-34
WP_103468740.1|192647_193277_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.8	3.8e-88
WP_103468741.1|193279_193555_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.9	6.6e-21
WP_158656811.1|194196_194442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050849666.1|194481_194823_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	76.6	9.3e-49
WP_064398049.1|195004_195469_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	2.8e-48
WP_103468744.1|195422_197159_+|terminase	terminase large subunit	terminase	M4QNU0	Tetraselmis_viridis_virus	44.6	2.9e-138
WP_103468745.1|197165_198485_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	59.1	4.4e-139
WP_014838140.1|198460_199168_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	6.4e-68
WP_103468746.1|199177_200398_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.5	7.5e-141
WP_014838142.1|200443_200698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032734570.1|200703_201036_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_103468747.1|201048_201387_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	2.8e-37
WP_103468748.1|201383_201833_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	81.2	9.7e-62
WP_103468749.1|201829_202177_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.1	1.8e-31
WP_017145575.1|202233_202944_+|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	68.6	3.7e-84
WP_049069900.1|202974_203379_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.5	2.5e-32
WP_016809743.1|203381_203687_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.0	6.2e-28
WP_103468750.1|203878_204394_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	70.1	1.4e-61
WP_103468751.1|204586_205141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749742.1|205198_206392_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.7	1.5e-141
WP_103468752.1|206515_209908_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	55.0	3.8e-283
WP_047720936.1|209929_210403_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.2e-54
WP_103468753.1|210389_210866_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.1	6.7e-53
WP_032750673.1|210878_211259_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	82.5	2.0e-60
WP_032750671.1|211255_214333_+	kinase	NA	A0A286S259	Klebsiella_phage	61.2	0.0e+00
WP_053067550.1|214410_218073_+	hypothetical protein	NA	A0A286S1R8	Klebsiella_phage	90.0	0.0e+00
>prophage 3
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	224220	233198	6190364		Pseudomonas_phage(66.67%)	6	NA	NA
WP_004152765.1|224220_225705_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152765.1|226129_227614_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_050346433.1|228185_229523_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	8.2e-32
WP_032751822.1|229947_231432_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_032751898.1|231511_231931_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.9	4.7e-34
WP_032750660.1|231932_233198_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	1.6e-207
>prophage 4
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	378640	387034	6190364	tRNA	Planktothrix_phage(33.33%)	8	NA	NA
WP_032751891.1|378640_379504_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	3.0e-11
WP_014230105.1|379514_380288_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.8e-27
WP_032693715.1|380704_381505_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014230103.1|381491_381962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528250.1|381962_382856_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.4	2.0e-13
WP_103468758.1|383100_384462_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.0	1.6e-200
WP_014230101.1|384779_385502_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	2.4e-30
WP_016946933.1|385498_387034_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.6	2.8e-28
>prophage 5
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	447887	457524	6190364	transposase	Enterobacteria_phage(37.5%)	9	NA	NA
WP_103468763.1|447887_449294_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	4.3e-39
WP_014230060.1|449506_450571_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.2e-104
WP_049070182.1|450584_451454_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.7	8.3e-110
WP_064378512.1|451485_452376_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	2.4e-27
WP_014230057.1|452391_452946_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	7.3e-51
WP_032693859.1|453119_454286_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.0e-112
WP_139512586.1|454859_454982_-	small membrane protein	NA	NA	NA	NA	NA
WP_032416385.1|455232_456156_+|transposase	IS5-like element IS903 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
WP_032693858.1|456519_457524_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	30.1	3.6e-32
>prophage 6
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	598922	634476	6190364	lysis,tail,terminase,integrase	uncultured_Caudovirales_phage(33.33%)	48	590263:590276	600391:600404
590263:590276	attL	TGCTTAATCAGGTT	NA	NA	NA	NA
WP_103468773.1|598922_599939_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.8	2.5e-126
WP_103468774.1|599922_600168_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	35.2	1.2e-05
WP_049099642.1|600377_600563_-	hypothetical protein	NA	NA	NA	NA	NA
600391:600404	attR	TGCTTAATCAGGTT	NA	NA	NA	NA
WP_103215520.1|600564_601125_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	58.4	2.6e-48
WP_103468775.1|601124_603335_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.1	4.1e-97
WP_103468776.1|603367_603652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215518.1|603680_603926_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	55.0	2.8e-15
WP_103468777.1|603933_604257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819180.1|604890_605346_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	54.3	1.2e-35
WP_000364674.1|605454_605688_+	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
WP_082236706.1|605750_606197_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.0e-26
WP_015365921.1|606280_606439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468906.1|606456_607425_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.3	1.6e-37
WP_103468907.1|607433_608828_+	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	46.9	1.4e-103
WP_103468778.1|608866_609535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365925.1|609538_609772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158236443.1|609768_609939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468779.1|609935_610526_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	84.7	5.7e-94
WP_103468780.1|610528_610759_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	38.7	2.9e-06
WP_015365929.1|610755_611373_+	hypothetical protein	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	24.9	2.3e-05
WP_103468781.1|611385_611724_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	1.7e-47
WP_041165550.1|611906_612098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080528177.1|612166_612763_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	70.7	1.4e-79
WP_103468782.1|612774_613077_+	DUF968 domain-containing protein	NA	A0A2H4FS95	Methylophilaceae_phage	51.7	1.2e-23
WP_158656817.1|613064_613229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365933.1|613232_613529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468783.1|613556_613997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409891.1|614007_614229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468784.1|614232_615858_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	59.3	3.4e-173
WP_032409894.1|615854_616088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468785.1|616074_616923_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	42.5	1.2e-44
WP_103468786.1|616956_617421_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	70.0	2.5e-60
WP_103468787.1|617456_617864_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	68.3	5.5e-40
WP_103468788.1|618081_618987_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	39.6	1.3e-44
WP_064167266.1|619046_619610_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	49.7	3.4e-48
WP_103468789.1|619609_621601_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.3	9.5e-186
WP_077269610.1|621600_622053_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	44.3	1.2e-22
WP_040200578.1|622055_622544_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	49.0	3.5e-09
WP_103468790.1|622549_625264_+	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	58.6	2.0e-287
WP_103468791.1|625263_628143_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	68.0	0.0e+00
WP_072041777.1|628185_628512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047063212.1|628584_628926_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	48.2	1.5e-19
WP_103468792.1|628922_630533_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	71.0	4.0e-227
WP_103468793.1|630549_633030_+	hypothetical protein	NA	A0A0A8JA02	Klebsiella_phage	35.3	4.6e-97
WP_158656819.1|633071_633296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365951.1|633375_633600_+|lysis	phage lysis protein S	lysis	A0A0P0ZFW5	Escherichia_phage	70.1	2.0e-20
WP_103468794.1|633583_634120_+	lysozyme	NA	K7PM52	Enterobacteria_phage	68.8	6.1e-71
WP_103468795.1|634116_634476_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	43.1	1.3e-16
>prophage 7
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	986116	1060704	6190364	integrase,transposase,plate	Escherichia_phage(40.0%)	56	1021752:1021768	1047694:1047710
WP_032749823.1|986116_987457_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032749821.1|987453_988143_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032749819.1|988139_989852_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014839086.1|989856_990348_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032749817.1|990636_991002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749816.1|990998_993524_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	6.1e-20
WP_032749815.1|993510_994743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468800.1|994749_995112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749813.1|995559_995790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749811.1|998221_1000510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749810.1|1000513_1001206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749809.1|1001940_1002138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047723683.1|1002379_1003126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749807.1|1003157_1004366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749804.1|1004362_1007830_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_000019441.1|1009668_1010649_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_032749800.1|1011064_1011499_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_050597577.1|1014175_1014598_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_139134510.1|1015464_1015848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749793.1|1015960_1017715_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032749791.1|1017678_1018764_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032749789.1|1018741_1019287_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032749787.1|1019789_1020878_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025105882.1|1020949_1022719_+	iron ABC transporter permease	NA	NA	NA	NA	NA
1021752:1021768	attL	CGCTGGTGATGCTCCAG	NA	NA	NA	NA
WP_032692928.1|1022711_1023782_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-31
WP_014838693.1|1023838_1024609_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_014838692.1|1024632_1026312_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_004851637.1|1026322_1027102_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_014229640.1|1027208_1028081_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.3e-05
WP_004136705.1|1028109_1028322_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_032749785.1|1029128_1030316_+	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_032749783.1|1030308_1031727_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_004851627.1|1031850_1031991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032749782.1|1032306_1033215_+	DUF535 family protein	NA	NA	NA	NA	NA
WP_032749780.1|1033330_1034002_-	cyclic nucleotide-binding protein	NA	NA	NA	NA	NA
WP_025105874.1|1034995_1035523_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_032749778.1|1035568_1036570_-	fimbrial protein	NA	NA	NA	NA	NA
WP_032749777.1|1036585_1039156_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025105871.1|1039216_1039906_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_032749776.1|1040006_1040525_-	fimbrial protein	NA	NA	NA	NA	NA
WP_032749775.1|1040981_1041530_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	7.2e-51
WP_032749774.1|1041954_1044360_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_025105867.1|1044435_1045401_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.0	9.2e-17
WP_032749773.1|1045397_1046378_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	4.0e-12
WP_032749772.1|1047321_1048281_-	ABC transporter permease	NA	NA	NA	NA	NA
1047694:1047710	attR	CTGGAGCATCACCAGCG	NA	NA	NA	NA
WP_032749771.1|1048324_1050028_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032749769.1|1050297_1050936_-	CatA-like O-acetyltransferase	NA	NA	NA	NA	NA
WP_025105857.1|1050966_1051350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004851588.1|1051443_1052214_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.7	3.6e-16
WP_014229623.1|1052227_1052857_-	LysE family transporter	NA	NA	NA	NA	NA
WP_004119381.1|1053081_1053717_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_025105856.1|1053823_1054630_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032749766.1|1054652_1055537_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.1	5.7e-82
WP_032749764.1|1055910_1056303_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_032750193.1|1056515_1058126_-	FAD-NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_001118616.1|1059780_1060704_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
>prophage 8
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	1740729	1749153	6190364	holin,tail	Cronobacter_phage(28.57%)	14	NA	NA
WP_004850357.1|1740729_1741344_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	69.6	1.2e-67
WP_032749340.1|1741511_1742246_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	83.2	1.6e-125
WP_025107965.1|1742247_1743000_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	76.3	5.7e-115
WP_032749341.1|1742996_1743344_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	60.0	2.4e-36
WP_032749342.1|1743366_1744476_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	48.5	5.9e-52
WP_048263674.1|1744560_1744806_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	40.0	2.3e-09
WP_004850345.1|1744868_1745180_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	62.1	1.5e-32
WP_014229127.1|1745252_1745915_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	65.0	7.0e-77
WP_004850340.1|1746034_1746454_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	51.5	9.4e-35
WP_004850338.1|1746509_1747052_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	66.7	5.2e-70
WP_032749344.1|1747059_1747332_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	55.4	2.2e-16
WP_009653048.1|1747321_1747714_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	66.2	1.3e-38
WP_014229124.1|1747790_1748153_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	57.5	7.1e-31
WP_009653037.1|1748616_1749153_-	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	49.7	5.2e-30
>prophage 9
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	1753802	1798153	6190364	tRNA,protease,transposase,plate	Escherichia_phage(36.36%)	45	NA	NA
WP_000019441.1|1753802_1754783_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_009652979.1|1754882_1755989_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.4	4.9e-107
WP_004850325.1|1756142_1756355_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004101601.1|1756437_1756872_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_014229121.1|1757060_1757351_+	hypothetical protein	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
WP_025107976.1|1757749_1758688_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_032749348.1|1759025_1759298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004850317.1|1759501_1760437_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	5.4e-139
WP_032749350.1|1760481_1761855_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	6.8e-50
WP_004850311.1|1762338_1763322_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_025107979.1|1763664_1764285_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_032749353.1|1764901_1765645_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.2	8.6e-15
WP_032693679.1|1765661_1766729_+	oxidoreductase	NA	NA	NA	NA	NA
WP_025107982.1|1766801_1768067_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.4	3.5e-157
WP_004850301.1|1768066_1768489_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.2	2.6e-32
WP_014229113.1|1768776_1768971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004850297.1|1769127_1769319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118616.1|1769688_1770612_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_071995723.1|1770655_1770877_+	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_014229112.1|1770931_1771495_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_032720811.1|1771691_1772273_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_014838304.1|1772398_1773028_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071532263.1|1773389_1773578_-	cold-shock protein	NA	NA	NA	NA	NA
WP_032749356.1|1774293_1775274_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_032749357.1|1775432_1776317_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014838299.1|1776430_1777315_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229103.1|1777486_1778623_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032749358.1|1778832_1779954_+	MFS transporter	NA	NA	NA	NA	NA
WP_071995735.1|1780051_1780396_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_032749360.1|1780497_1781226_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	2.1e-45
WP_032749361.1|1781468_1781903_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_032749362.1|1781899_1782619_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032749366.1|1782615_1783875_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032749367.1|1783876_1784599_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_032749368.1|1784595_1785819_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032749369.1|1785815_1786349_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_014229093.1|1786363_1787323_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_032749371.1|1787386_1788769_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_025107999.1|1789660_1791115_+	MFS transporter	NA	NA	NA	NA	NA
WP_032749373.1|1791169_1792849_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_032749375.1|1793011_1794346_-	membrane protein	NA	NA	NA	NA	NA
WP_014838282.1|1794369_1794825_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032749377.1|1794826_1795366_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_032749379.1|1795343_1796429_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032749381.1|1796392_1798153_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	1975679	2039272	6190364	terminase,plate,tRNA,integrase,tail,portal,capsid,head	Enterobacteria_phage(52.94%)	69	1980967:1980984	2018021:2018038
WP_032749533.1|1975679_1976180_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_004138309.1|1976343_1976790_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_032749534.1|1976773_1977565_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032749535.1|1977665_1978850_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_032749536.1|1978887_1979580_-	CTP synthase	NA	NA	NA	NA	NA
WP_032749537.1|1979742_1980252_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014228940.1|1980238_1980583_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_025106943.1|1980577_1980817_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
1980967:1980984	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|1981079_1981331_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_103468816.1|1981374_1982514_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.7	3.0e-144
WP_103468817.1|1982669_1983842_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.2	3.2e-157
WP_103468818.1|1983841_1984357_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.8	5.7e-58
WP_004131585.1|1984402_1984720_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|1984719_1984878_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_103468819.1|1984864_1987840_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	2.3e-220
WP_103468820.1|1987855_1988347_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	3.3e-55
WP_103468821.1|1988560_1990402_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_103468822.1|1991113_1992211_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	45.6	4.8e-06
WP_103468823.1|1992195_1992411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468824.1|1992407_1995437_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	3.7e-24
WP_103468825.1|1995426_1996350_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.9	3.4e-53
WP_103468826.1|1996351_1996702_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	55.7	6.0e-27
WP_103468827.1|1996698_1997286_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.0	1.4e-60
WP_103468828.1|1997282_1997918_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.0	1.1e-55
WP_103468829.1|1997914_1998382_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	3.1e-47
WP_158656823.1|1998382_1998718_-	peptidase	NA	NA	NA	NA	NA
WP_103468830.1|1998904_1999450_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	8.2e-31
WP_103468831.1|1999446_1999731_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_004131559.1|1999721_1999922_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_103468832.1|1999921_2000437_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	2.2e-41
WP_103468833.1|2000541_2001408_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.1	7.6e-71
WP_103468834.1|2001456_2002491_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	49.7	1.1e-95
WP_103468835.1|2002500_2003340_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	67.4	3.0e-96
WP_103468836.1|2003496_2005224_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
WP_103468837.1|2005217_2006279_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.7	1.3e-141
WP_158656825.1|2006743_2008495_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_103468839.1|2008491_2009925_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_068815154.1|2012616_2013633_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.5e-65
WP_103468840.1|2013906_2014473_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	31.0	2.3e-12
WP_004213098.1|2014469_2014694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719966.1|2014761_2015034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468841.1|2015049_2015427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468842.1|2015442_2015661_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	47.3	1.6e-06
WP_023300862.1|2015794_2016010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023300861.1|2016114_2016384_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.8	3.9e-42
WP_038423230.1|2016506_2016806_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.7	3.5e-36
WP_031593607.1|2016921_2017935_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.5	7.6e-155
WP_032749538.1|2018167_2019181_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
2018021:2018038	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004101234.1|2019238_2019340_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_100248259.1|2019339_2019414_+	protein YoaJ	NA	NA	NA	NA	NA
WP_086074258.1|2019554_2019680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004131510.1|2019728_2019992_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_025106941.1|2020121_2020760_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004138325.1|2020850_2021765_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
WP_032749539.1|2022308_2023097_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032749540.1|2023356_2023878_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_103468843.1|2023867_2024827_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_032749541.1|2024924_2027261_+	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_032749542.1|2027319_2028222_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032749545.1|2028218_2029217_+	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.4	1.2e-11
WP_025106936.1|2029213_2030167_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_032749547.1|2030167_2030935_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.7	6.8e-15
WP_009653379.1|2030971_2032015_-	type II asparaginase	NA	NA	NA	NA	NA
WP_014228927.1|2032294_2033485_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_032749549.1|2033562_2035347_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.2	7.3e-20
WP_004131480.1|2035492_2036743_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
WP_004138338.1|2036979_2037630_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_025106932.1|2037650_2038127_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032749565.1|2038165_2039272_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	3617249	3694730	6190364	terminase,plate,tRNA,transposase,integrase,tail,portal,capsid,head,protease	Enterobacteria_phage(32.5%)	80	3621032:3621072	3658068:3658108
WP_025108460.1|3617249_3618236_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004107505.1|3618285_3619659_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_004127228.1|3619655_3620354_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_004855993.1|3620503_3621007_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
3621032:3621072	attL	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTT	NA	NA	NA	NA
WP_032751862.1|3621191_3622172_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	83.0	1.4e-153
WP_032751863.1|3622241_3622535_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	74.2	1.3e-35
WP_032751864.1|3622685_3622871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032751865.1|3622858_3623065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032751866.1|3623186_3623459_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	85.6	8.2e-40
WP_032751867.1|3623485_3623704_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	48.1	3.6e-06
WP_032705924.1|3623719_3623950_+	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	68.6	1.5e-23
WP_032705922.1|3623964_3624237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032751868.1|3624306_3624534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032751869.1|3624526_3625072_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	26.1	5.5e-11
WP_032751871.1|3625304_3625499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032751873.1|3625491_3626445_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	54.9	2.8e-82
WP_032751875.1|3627028_3628039_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	55.9	4.1e-100
WP_032751878.1|3628272_3630519_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	43.4	9.6e-134
WP_032750325.1|3631154_3631847_+	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	70.3	5.3e-91
WP_032750322.1|3632019_3633168_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_032723903.1|3633157_3633676_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_032750321.1|3634099_3635152_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.1e-140
WP_032750320.1|3635151_3636873_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.0	3.1e-225
WP_032750319.1|3637030_3637864_+|capsid	phage capsid scaffolding protein	capsid	B9A7B4	Serratia_phage	73.3	9.4e-111
WP_032750317.1|3637888_3638938_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.8	2.3e-106
WP_032750314.1|3638985_3639882_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	75.3	5.4e-88
WP_032750312.1|3639984_3640482_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	68.5	3.8e-59
WP_032750311.1|3640481_3640682_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	5.7e-14
WP_032750310.1|3640672_3640954_+	hypothetical protein	NA	B9A7B8	Serratia_phage	55.8	1.1e-18
WP_032750309.1|3640950_3641502_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	1.3e-28
WP_071995736.1|3641742_3642042_+	peptidase	NA	NA	NA	NA	NA
WP_032750302.1|3642038_3642500_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.1	2.2e-32
WP_032750301.1|3642496_3643138_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	46.8	9.9e-44
WP_032750299.1|3643137_3643722_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.6	2.8e-61
WP_032750298.1|3643718_3644087_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.3	1.8e-29
WP_032750297.1|3644073_3644973_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	61.9	4.0e-91
WP_103468859.1|3644965_3645568_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	47.7	3.0e-42
WP_158656831.1|3645570_3649227_+	hypothetical protein	NA	A0A286S1R8	Klebsiella_phage	76.6	0.0e+00
WP_048252579.1|3649281_3650310_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	45.6	1.1e-25
WP_032747298.1|3650408_3650897_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	60.9	4.4e-52
WP_050597564.1|3650911_3653671_-|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	70.6	1.1e-208
WP_071836356.1|3653660_3653837_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	3.0e-11
WP_032747300.1|3653833_3654133_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	72.6	3.4e-31
WP_032749998.1|3654187_3654703_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	2.2e-57
WP_032747303.1|3654702_3655884_-|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.8	2.7e-156
WP_032747308.1|3656036_3657191_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	2.5e-178
WP_071995702.1|3657235_3657484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032750008.1|3657583_3657967_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	57.5	6.8e-40
WP_014227425.1|3658191_3659088_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
3658068:3658108	attR	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTT	NA	NA	NA	NA
WP_004127238.1|3659290_3660253_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_004127241.1|3660312_3660798_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_032747309.1|3660890_3661817_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004127247.1|3662007_3663342_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
WP_004107530.1|3663351_3663882_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_071846047.1|3663972_3664941_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_004856005.1|3665032_3666061_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_032747314.1|3666211_3668407_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_004107543.1|3668648_3668864_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_004107547.1|3668961_3669279_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_014227429.1|3669545_3670706_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_014227430.1|3670708_3673141_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_004856015.1|3673180_3673552_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_032747315.1|3673642_3674548_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004856019.1|3674714_3675602_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_014227432.1|3675724_3676474_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.1	6.0e-24
WP_014227433.1|3676602_3677706_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_004107558.1|3677762_3678425_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
WP_025106568.1|3678630_3679494_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032747320.1|3679645_3680293_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_032747324.1|3680389_3683041_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_025106570.1|3683299_3684451_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_004870566.1|3684635_3685640_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_086544362.1|3685646_3686423_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_014227439.1|3686500_3687874_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_014227441.1|3688141_3689059_+	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_004116922.1|3689041_3690442_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_004107582.1|3690638_3691274_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_004856046.1|3691289_3691649_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_032719444.1|3691695_3692796_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_001567368.1|3693326_3694730_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	4956298	5023072	6190364	terminase,tRNA,transposase,integrase,lysis,head,coat	Enterobacteria_phage(24.07%)	82	4979308:4979345	5027940:5027977
WP_016947617.1|4956298_4957279_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_032748354.1|4960220_4961582_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_032748356.1|4961742_4963050_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_032748359.1|4963071_4964217_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	42.3	4.8e-49
WP_032748362.1|4964353_4965136_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_032748363.1|4965146_4966382_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_032748364.1|4966403_4967453_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_032748365.1|4967768_4969436_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_032748367.1|4969445_4970705_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_032748369.1|4970714_4971509_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_032748371.1|4971518_4972412_+	carbamate kinase	NA	NA	NA	NA	NA
WP_014228235.1|4972675_4973743_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004848424.1|4973739_4974249_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_032748374.1|4974345_4974675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032748376.1|4974780_4975503_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004099775.1|4975506_4976001_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004848430.1|4976174_4977560_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
WP_025107125.1|4977854_4978067_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004099791.1|4978068_4978935_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
4979308:4979345	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAACCCTGTAGGG	NA	NA	NA	NA
WP_103468874.1|4979367_4980531_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.0	7.2e-202
WP_103468619.1|4980407_4980743_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_103468620.1|4980744_4980963_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_103468621.1|4980959_4981169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468622.1|4981165_4981822_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.9	3.8e-115
WP_032748397.1|4981818_4981995_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	50.0	7.7e-07
WP_032748399.1|4982006_4982711_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.6	3.0e-25
WP_023339053.1|4982722_4983391_-	AAA family ATPase	NA	G9L667	Escherichia_phage	44.3	1.1e-48
WP_032748402.1|4983392_4984052_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	33.3	6.0e-20
WP_032748404.1|4984182_4984578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064353467.1|4984657_4984864_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	92.6	5.3e-31
WP_158656795.1|4985104_4985734_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	50.2	1.4e-53
WP_021312733.1|4986023_4986683_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
WP_004191589.1|4986791_4987010_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_047684216.1|4987050_4987272_+	bacteriophage CII family protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_047684223.1|4987497_4988397_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	1.6e-87
WP_103468623.1|4988386_4989817_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.9	3.8e-184
WP_103468624.1|4989816_4990122_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103468625.1|4990118_4990604_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.3	1.8e-13
WP_103468626.1|4990600_4990807_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	8.1e-32
WP_158656834.1|4991003_4991288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468628.1|4991287_4991500_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	6.2e-11
WP_158656836.1|4991812_4992172_+	hypothetical protein	NA	R9TQX3	Aeromonas_phage	89.1	1.9e-15
WP_158656838.1|4992259_4992568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468878.1|4992548_4992848_+	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	54.1	1.2e-15
WP_101857254.1|4992840_4993071_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	1.7e-09
WP_009652643.1|4993329_4993779_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.7	2.2e-37
WP_103468631.1|4994567_4994798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468632.1|4994794_4994935_+	YlcG family protein	NA	NA	NA	NA	NA
WP_103468633.1|4994931_4995741_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.8	5.3e-119
WP_048252288.1|4996729_4997587_+	site-specific DNA-methyltransferase	NA	H2EQJ0	Salmonella_phage	69.5	3.3e-50
WP_032748430.1|4997639_4997921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064367594.1|4998078_4998303_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	87.8	6.3e-30
WP_103468634.1|4998280_4998775_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	89.0	2.4e-82
WP_103468635.1|4998863_4999331_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	74.2	7.5e-57
WP_103468879.1|4999366_4999642_+	hypothetical protein	NA	K7P6G5	Enterobacteria_phage	61.5	5.4e-23
WP_103468880.1|4999963_5000611_+	hypothetical protein	NA	I6S676	Salmonella_phage	79.6	1.5e-100
WP_103468881.1|5000641_5001130_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	75.2	9.2e-50
WP_103468882.1|5001126_5002686_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	88.0	3.8e-291
WP_032748444.1|5002698_5004168_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.9	4.5e-148
WP_032748446.1|5004094_5005102_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.1	4.9e-114
WP_103468636.1|5005223_5006585_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.2	3.1e-127
WP_016529582.1|5006584_5007046_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_032748452.1|5007042_5008098_+|coat	phage coat protein	coat	B1GS73	Salmonella_phage	53.1	3.8e-101
WP_103468637.1|5008130_5008394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468638.1|5008396_5008777_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	9.1e-29
WP_032710897.1|5008776_5008950_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	53.6	5.4e-13
WP_043906744.1|5008949_5009312_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	50.0	1.9e-20
WP_004151265.1|5009314_5009740_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004178853.1|5009736_5010129_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	3.3e-34
WP_004151263.1|5010197_5010950_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_029884068.1|5011002_5011680_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	58.4	9.7e-74
WP_004151261.1|5011855_5012611_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|5012613_5012868_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_023328739.1|5013288_5013609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047684316.1|5013660_5014095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047685272.1|5014099_5014348_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	72.8	8.0e-26
WP_049594418.1|5014435_5014597_+	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	63.3	1.6e-11
WP_103468639.1|5015705_5019230_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	67.1	2.8e-297
WP_103468646.1|5019329_5019749_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	4.1e-30
WP_103468640.1|5019748_5020219_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	39.7	2.4e-26
WP_103468641.1|5020215_5020611_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	6.1e-36
WP_103468642.1|5020597_5023072_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	3.8e-200
5027940:5027977	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAACCCTGTAGGG	NA	NA	NA	NA
>prophage 13
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	5150753	5201984	6190364	holin,transposase,integrase	Catovirus(14.29%)	41	5145315:5145329	5172739:5172753
5145315:5145329	attL	TTGCGCTGGTGCGCA	NA	NA	NA	NA
WP_032748624.1|5150753_5152418_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	3.0e-60
WP_032748625.1|5152432_5153905_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032748626.1|5153915_5154509_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_025107047.1|5154637_5156671_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	28.1	5.8e-21
WP_004130292.1|5156893_5157046_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_032748627.1|5157240_5158026_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_032747738.1|5158303_5159284_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.9	2.1e-24
WP_032751349.1|5159720_5161370_-	glycerone kinase	NA	NA	NA	NA	NA
WP_032751347.1|5161437_5162856_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_014226902.1|5162866_5163499_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_009651831.1|5163510_5164581_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_009651847.1|5165177_5166275_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_032751345.1|5166379_5168293_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_071532228.1|5168432_5168756_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_032751344.1|5169095_5170412_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	29.8	4.6e-35
WP_032751342.1|5170642_5171284_-	OmpA family protein	NA	NA	NA	NA	NA
WP_050597589.1|5171295_5173248_-	hypothetical protein	NA	NA	NA	NA	NA
5172739:5172753	attR	TGCGCACCAGCGCAA	NA	NA	NA	NA
WP_032751341.1|5173244_5174516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468913.1|5174534_5175482_-	ATP-binding protein	NA	A0A0R6PCP6	Moraxella_phage	40.1	6.6e-44
WP_086544347.1|5176056_5176212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032751340.1|5176428_5176866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032751339.1|5177209_5177440_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_032751338.1|5177564_5178977_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_086013483.1|5179194_5180342_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
WP_095283445.1|5180519_5181335_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	29.9	9.4e-15
WP_095283446.1|5181380_5183201_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_095283447.1|5183214_5183640_-	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_095283448.1|5183636_5184227_-	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_095284383.1|5184240_5185908_-	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_095283449.1|5186309_5186738_+	heme-binding protein	NA	NA	NA	NA	NA
WP_095283450.1|5186771_5187935_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_095283451.1|5188004_5188370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095283452.1|5188372_5188921_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_095283453.1|5188898_5190824_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_103468887.1|5190948_5192049_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_103468888.1|5192641_5193712_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_095283456.1|5193722_5194355_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_103468889.1|5194371_5195793_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_095283458.1|5195877_5197530_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_032751337.1|5199018_5199549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227969.1|5200907_5201984_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP026285	Klebsiella oxytoca strain KONIH2 chromosome, complete genome	6190364	6057396	6069938	6190364	transposase	Escherichia_coli_O157_typing_phage(37.5%)	10	NA	NA
WP_032750881.1|6057396_6059874_-	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	84.2	0.0e+00
WP_032750880.1|6059877_6061686_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	71.1	6.8e-239
WP_077254520.1|6061682_6063998_-	transglycosylase SLT domain-containing protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	35.7	1.6e-107
WP_032750878.1|6064231_6064729_-	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	42.9	3.4e-07
WP_032750877.1|6064820_6065120_+	hypothetical protein	NA	A0A2H4JEE3	uncultured_Caudovirales_phage	40.3	7.4e-10
WP_048252483.1|6065187_6065697_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	41.8	6.1e-20
WP_049086103.1|6065836_6066091_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	46.5	2.4e-09
WP_032750876.1|6066400_6067663_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004853188.1|6067669_6068701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|6068921_6069938_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 1
NZ_CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	0	5701	198115		unidentified_phage(100.0%)	5	NA	NA
WP_000375812.1|1153_1720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127321.1|1724_2012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350011.1|1996_3097_+	plasmid replication protein	NA	NA	NA	NA	NA
WP_000883925.1|4133_4568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000946102.1|4585_5701_-	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
>prophage 2
NZ_CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	9342	15197	198115		Wolbachia_phage(25.0%)	10	NA	NA
WP_001326179.1|9342_10320_+	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
WP_000139698.1|10335_11196_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000591074.1|11229_11658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422768.1|11714_12074_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000919345.1|12073_12520_+	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000210756.1|12516_13035_+	nitrite reductase	NA	NA	NA	NA	NA
WP_000972663.1|13034_13265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167032.1|13251_14109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236377.1|14339_14867_+	thermonuclease family protein	NA	O64020	Bacillus_phage	37.0	1.3e-09
WP_001043047.1|14924_15197_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
>prophage 3
NZ_CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	18826	54246	198115	transposase	Pseudomonas_phage(14.29%)	46	NA	NA
WP_000286591.1|18826_19288_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
WP_000062185.1|19290_19788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434071.1|20349_21282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280522.1|21355_22819_+	AAA family ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
WP_000277953.1|22974_23304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018404.1|23308_23701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000757530.1|23749_23944_+	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_000245299.1|23937_24936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706040.1|24943_25780_-|transposase	IS5-like element ISEc61 family transposase	transposase	NA	NA	NA	NA
WP_000262467.1|26345_27140_+	APH(3')-II family aminoglycoside O-phosphotransferase	NA	Q75ZG1	Hepacivirus	74.3	6.4e-109
WP_000349358.1|27166_27526_+	BLMT family bleomycin binding protein	NA	NA	NA	NA	NA
WP_019706001.1|27688_28636_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_016809943.1|28718_29867_+	cephalosporin-hydrolyzing class C beta-lactamase FOX-5	NA	NA	NA	NA	NA
WP_016809944.1|30191_31364_+	MFS transporter	NA	NA	NA	NA	NA
WP_016809945.1|31382_32345_+	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_019706001.1|32956_33904_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_012585400.1|34625_34874_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_001173919.1|35000_35576_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
WP_001572362.1|35846_36869_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016808107.1|37433_37586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706040.1|37687_38524_+|transposase	IS5-like element ISEc61 family transposase	transposase	NA	NA	NA	NA
WP_000039129.1|38747_39095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988987.1|39091_39520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056203.1|39858_40077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001256128.1|40088_40658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435224.1|40660_41206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268395.1|41322_42261_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_001096362.1|42695_42938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258027.1|42940_43303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000098292.1|43295_43508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194038.1|43567_44323_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
WP_001274811.1|44337_45879_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_001050849.1|46123_47158_+	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
WP_000058870.1|47171_47621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|47602_47914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|48087_48873_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|48876_50058_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_000703827.1|50106_50379_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000074431.1|50431_51067_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000939033.1|51158_51302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125905.1|51620_51998_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
WP_000044824.1|51990_52272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344151.1|52246_52921_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_005507681.1|52988_53420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000348669.1|53404_53737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000647189.1|53745_54246_+	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
>prophage 4
NZ_CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	57679	60766	198115		Caulobacter_phage(50.0%)	3	NA	NA
WP_000542259.1|57679_57979_+	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
WP_000468105.1|58070_58559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366821.1|58573_60766_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.9e-42
>prophage 5
NZ_CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	92917	97553	198115		Rhizobium_phage(25.0%)	5	NA	NA
WP_000085162.1|92917_93886_+	AAA domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	2.8e-29
WP_000739139.1|93896_94805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000987165.1|94865_95396_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_001282585.1|95490_96480_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000706865.1|96542_97553_+	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
>prophage 6
NZ_CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	106788	108414	198115		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000201432.1|106788_108414_+	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
>prophage 7
NZ_CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	114975	118576	198115		Bacillus_phage(50.0%)	3	NA	NA
WP_000595210.1|114975_115827_+	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_001077335.1|116284_116671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|116848_118576_+	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
>prophage 8
NZ_CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	123973	159491	198115	transposase,integrase	Escherichia_phage(27.27%)	33	136677:136736	155555:156416
WP_022542389.1|123973_124978_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|125056_128029_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|128031_128589_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|128894_129908_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001931474.1|130113_130980_+	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
WP_001261740.1|131097_131889_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_042946310.1|131977_133327_-	group II intron reverse transcriptase/maturase	NA	H7BV81	unidentified_phage	28.1	5.2e-10
WP_001256774.1|134127_135387_+	CmlA family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_000800689.1|135511_136144_+	type B-2 chloramphenicol O-acetyltransferase CatB11	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	43.0	7.1e-26
WP_000679427.1|136333_136681_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|136674_137514_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
136677:136736	attL	GGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCG	NA	NA	NA	NA
WP_000050481.1|137918_139460_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|139792_140449_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_000259031.1|140648_141488_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|141892_143434_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002008781.1|143699_144200_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000019304.1|144199_144769_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_048228299.1|144779_145385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|145371_146385_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|146530_147064_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000186237.1|147146_147779_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|147935_148283_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259032.1|148276_149116_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001389365.1|149290_150055_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|150231_150936_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|151385_152861_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|152916_153801_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|153884_154589_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004163135.1|154479_155439_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_000946487.1|155540_156392_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
WP_000376623.1|156519_157020_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
155555:156416	attR	GGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCGCCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCGGACGCGAGGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCGTGTTTCAATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAGGATTTCCTGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGATGGCATCGCCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTCCGCCTTGCGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGGAAACATCGCTGCACGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCTTCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGATCGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGAAATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAGCATTCACCTTCCGGCCGCCCGCTA	NA	NA	NA	NA
WP_001163403.1|157195_157978_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|157967_159491_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
>prophage 9
NZ_CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	165142	182687	198115	transposase	uncultured_Caudovirales_phage(55.56%)	19	NA	NA
WP_015063453.1|165142_166837_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_000522996.1|166875_167301_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|167328_167604_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|167619_167985_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|168056_168512_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001114073.1|168848_169202_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000783215.1|169249_169612_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001556710.1|169629_171381_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000922630.1|171429_172719_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
WP_000065758.1|172731_173157_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_004118313.1|173187_173592_-	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_001556711.1|173600_174173_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
WP_011787801.1|175301_176792_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_011787802.1|176826_177681_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
WP_011787803.1|177771_178104_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_011787804.1|178221_178842_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787805.1|179011_179272_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011918375.1|179271_179583_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787830.1|179606_182687_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
>prophage 10
NZ_CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	186210	187722	198115		Pseudoalteromonas_phage(100.0%)	1	NA	NA
WP_000811656.1|186210_187722_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
>prophage 11
NZ_CP026281	Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence	198115	195050	195323	198115		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000356489.1|195050_195323_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
>prophage 1
NZ_CP026278	Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence	48636	1424	20015	48636	lysis	Enterobacteria_phage(30.77%)	33	NA	NA
WP_103468620.1|1424_1643_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	49.3	7.1e-10
WP_103468621.1|1639_1849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468622.1|1845_2502_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.9	3.8e-115
WP_032748397.1|2498_2675_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	50.0	7.7e-07
WP_032748399.1|2686_3391_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.6	3.0e-25
WP_023339053.1|3402_4071_-	AAA family ATPase	NA	G9L667	Escherichia_phage	44.3	1.1e-48
WP_032748402.1|4072_4732_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	33.3	6.0e-20
WP_032748404.1|4862_5258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064353467.1|5337_5544_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	92.6	5.3e-31
WP_158656795.1|5784_6414_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	50.2	1.4e-53
WP_021312733.1|6703_7363_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
WP_004191589.1|7471_7690_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_047684216.1|7730_7952_+	bacteriophage CII family protein	NA	A2SY75	Escherichia_phage	52.0	1.4e-05
WP_047684223.1|8177_9077_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	1.6e-87
WP_103468623.1|9066_10497_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.9	3.8e-184
WP_103468624.1|10496_10802_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103468625.1|10798_11284_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.3	1.8e-13
WP_103468626.1|11280_11487_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	8.1e-32
WP_103468627.1|11483_11969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468628.1|11968_12181_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	6.2e-11
WP_103468644.1|13032_13530_+	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	54.1	2.0e-15
WP_101857254.1|13522_13753_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	1.7e-09
WP_009652643.1|14011_14461_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.7	2.2e-37
WP_103468629.1|14453_14624_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	71.4	5.7e-15
WP_103468630.1|14616_15255_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.9	7.0e-74
WP_103468631.1|15251_15482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468632.1|15478_15619_+	YlcG family protein	NA	NA	NA	NA	NA
WP_103468633.1|15615_16425_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.8	5.3e-119
WP_048252288.1|17413_18271_+	site-specific DNA-methyltransferase	NA	H2EQJ0	Salmonella_phage	69.5	3.3e-50
WP_032748430.1|18323_18605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064367594.1|18762_18987_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	87.8	6.3e-30
WP_103468634.1|18964_19459_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	89.0	2.4e-82
WP_103468635.1|19547_20015_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	74.2	7.5e-57
>prophage 2
NZ_CP026278	Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence	48636	23380	43755	48636	head,coat	Cronobacter_phage(45.45%)	25	NA	NA
WP_032748444.1|23380_24850_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.9	4.5e-148
WP_032748446.1|24776_25784_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.1	4.9e-114
WP_103468636.1|25905_27267_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.2	3.1e-127
WP_016529582.1|27266_27728_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_032748452.1|27724_28780_+|coat	phage coat protein	coat	B1GS73	Salmonella_phage	53.1	3.8e-101
WP_103468637.1|28812_29076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468638.1|29078_29459_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	9.1e-29
WP_032710897.1|29458_29632_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	53.6	5.4e-13
WP_043906744.1|29631_29994_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	52.5	4.3e-28
WP_004151265.1|29996_30422_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004178853.1|30418_30811_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.9	3.3e-34
WP_004151263.1|30879_31632_+	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	44.9	3.2e-33
WP_029884068.1|31684_32362_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	58.4	9.7e-74
WP_004151261.1|32537_33293_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|33295_33550_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_023328739.1|33970_34291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047684316.1|34342_34777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047685272.1|34781_35030_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	72.8	8.0e-26
WP_049594418.1|35117_35279_+	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	63.3	1.6e-11
WP_064371272.1|35347_36289_+	antirepressor protein Ant	NA	I6S627	Salmonella_phage	68.0	1.5e-77
WP_103468639.1|36388_39913_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	67.1	2.8e-297
WP_103468646.1|40012_40432_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	4.1e-30
WP_103468640.1|40431_40902_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	39.7	2.4e-26
WP_103468641.1|40898_41294_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	6.1e-36
WP_103468642.1|41280_43755_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	3.8e-200
>prophage 1
NZ_CP026284	Klebsiella oxytoca strain KONIH2 plasmid pKOR-5873, complete sequence	132994	15328	104889	132994	integrase,transposase,tRNA	Escherichia_phage(27.78%)	102	86067:86085	99806:99824
WP_001067855.1|15328_16033_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000624775.1|16057_16291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046891.1|16906_17242_-	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
WP_001515734.1|17484_18048_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001348195.1|18112_18487_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001097412.1|18510_19074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|20455_21160_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_033488203.1|21421_23083_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|23402_24107_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_021242989.1|24319_27304_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.3	2.8e-306
WP_047721751.1|27382_28387_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001567383.1|28761_29028_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001567382.1|29124_29682_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001567381.1|29894_30155_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001567380.1|30185_30692_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_021243015.1|30926_31388_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_021243016.1|31377_31872_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001567368.1|32412_33816_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|33844_34477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014542884.1|34829_35108_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_015059150.1|35095_35407_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_048234297.1|35777_36209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634148.1|36315_36531_-	MbeD family mobilization/exclusion protein	NA	NA	NA	NA	NA
WP_015059161.1|36537_37029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000509966.1|37313_37919_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_103468678.1|38013_40911_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	7.9e-181
WP_004099020.1|41550_41922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011191342.1|42239_43508_+|transposase	IS4-like element ISApu1 family transposase	transposase	NA	NA	NA	NA
WP_003464965.1|45826_46270_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003464967.1|46271_46811_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003464969.1|46951_47656_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_003464971.1|47652_48621_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_002118279.1|49068_50082_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005006001.1|50154_50586_+	heme-binding protein	NA	NA	NA	NA	NA
WP_010591688.1|50644_50938_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_010591687.1|50934_51132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003464979.1|51263_51734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003464980.1|52201_52804_+	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_002118292.1|52796_53543_+	oxidoreductase	NA	NA	NA	NA	NA
WP_005005995.1|53996_54269_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	41.9	7.5e-09
WP_003464986.1|54336_54618_+	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_003464988.1|54787_55054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005993.1|55914_56289_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_003464991.1|57019_57538_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_003464995.1|57567_58413_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|59627_60332_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|60633_61338_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000108589.1|61999_62557_+	OsmC family protein	NA	NA	NA	NA	NA
WP_020277920.1|62698_63280_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021242988.1|63284_63623_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_021242987.1|63652_63982_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	7.4e-11
WP_021242986.1|64195_65302_+	alkene reductase	NA	NA	NA	NA	NA
WP_001194072.1|65367_66069_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_004729618.1|66134_66908_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023287190.1|67093_68317_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001567390.1|68450_69320_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004729622.1|69560_70313_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_107835450.1|70506_70668_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_000427623.1|70752_71757_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_103468679.1|72119_72734_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_158656805.1|72868_73006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149888860.1|73046_73289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468680.1|73285_74455_-	MFS transporter	NA	NA	NA	NA	NA
WP_103468681.1|74432_75878_-|tRNA	class I tRNA ligase family protein	tRNA	NA	NA	NA	NA
WP_103468682.1|75877_77182_-	KamA family radical SAM protein	NA	NA	NA	NA	NA
WP_103468683.1|77243_78662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097311113.1|78904_80111_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	64.0	3.6e-103
WP_158656807.1|80394_81564_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_032440553.1|81886_82096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468685.1|82088_83147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468686.1|83729_84035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468687.1|84049_84322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468688.1|84327_84906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468689.1|84907_85315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468690.1|85467_86013_-	hypothetical protein	NA	NA	NA	NA	NA
86067:86085	attL	TGTTCAAATATGAACATTT	NA	NA	NA	NA
WP_103468691.1|86153_86615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468692.1|86611_86860_+	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	56.9	1.6e-10
WP_103468693.1|86852_87440_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_103468694.1|87436_87922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468695.1|88189_88930_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	3.3e-22
WP_103468696.1|89170_90145_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	52.3	1.9e-86
WP_103468697.1|90147_90591_+	plasmid stability family protein	NA	NA	NA	NA	NA
WP_103468723.1|91113_91359_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_103468698.1|91351_91831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468699.1|91975_92239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468700.1|92742_93192_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_020805667.1|93236_93503_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103468701.1|93566_94850_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	41.2	3.3e-62
WP_103468702.1|95456_95636_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
WP_103468703.1|95708_96569_+	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	30.4	7.4e-18
WP_011091056.1|96759_97098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187345.1|97195_97426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468705.1|98043_98454_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_103468706.1|98515_98821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040027871.1|99021_99462_+	antirestriction protein	NA	NA	NA	NA	NA
WP_103468707.1|99505_99790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440567.1|99947_100181_+	hypothetical protein	NA	NA	NA	NA	NA
99806:99824	attR	AAATGTTCATATTTGAACA	NA	NA	NA	NA
WP_032440568.1|100234_100555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468724.1|100845_101157_-	MobC	NA	NA	NA	NA	NA
WP_103468708.1|101554_101866_+	mobilization protein	NA	NA	NA	NA	NA
WP_103468709.1|101868_103797_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_103468710.1|103947_104889_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.9	1.4e-73
>prophage 1
NZ_CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	0	55863	262864	transposase	Escherichia_phage(50.0%)	46	NA	NA
WP_004197677.1|702_2136_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_015632388.1|2225_3509_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004099052.1|3638_5831_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_001118616.1|6248_7172_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_022631502.1|7472_7673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425568.1|8934_9939_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000509966.1|12521_13127_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_016241527.1|13516_16204_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.5	1.2e-71
WP_016241528.1|16254_16686_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	44.1	2.0e-24
WP_016241530.1|17210_18296_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_103468656.1|18295_21352_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	1.9e-52
WP_016241532.1|21502_22468_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_045270086.1|22475_23051_-	phospholipid:lipid A palmitoyltransferase	NA	NA	NA	NA	NA
WP_001166628.1|23099_23555_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_031623830.1|23626_23977_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|23992_24268_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|24295_24721_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|24759_26445_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|26462_26828_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|26824_27061_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|27044_27164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|27126_27339_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001162010.1|27468_28026_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
WP_004118358.1|28110_28815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.6e-138
WP_001752509.1|29135_29636_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_004118358.1|29962_30667_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.6e-138
WP_016947617.1|30786_31767_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_000780222.1|32044_32326_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|32306_32636_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_001572362.1|33682_34705_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|37667_38372_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_156174661.1|38411_38588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085954994.1|38614_39741_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	1.4e-48
WP_103468657.1|43322_45980_+	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_007372251.1|46024_46795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372252.1|46922_47453_-	transcriptional activator	NA	NA	NA	NA	NA
WP_016241572.1|47455_47986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016241571.1|47978_48539_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016241570.1|48568_49099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372253.1|49113_50136_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_001310555.1|51459_52476_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_007372284.1|53392_53599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372285.1|53737_53977_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_007372286.1|53979_54288_+	CcdB family protein	NA	NA	NA	NA	NA
WP_007372288.1|54621_55176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372289.1|55245_55863_+	hypothetical protein	NA	A0A076G6Q2	Escherichia_phage	53.4	4.1e-63
>prophage 2
NZ_CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	65059	65902	262864		Salmonella_phage(100.0%)	1	NA	NA
WP_007372307.1|65059_65902_+	HNH endonuclease	NA	G0X580	Salmonella_phage	39.5	1.8e-16
>prophage 3
NZ_CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	69782	79222	262864		Escherichia_phage(50.0%)	10	NA	NA
WP_007372313.1|69782_70787_+	peptide transporter	NA	A0A1B0V750	Salmonella_phage	27.2	3.0e-18
WP_008786583.1|70910_71312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372314.1|71283_72984_+	AAA family ATPase	NA	A0A172JHZ0	Bacillus_phage	36.7	3.5e-96
WP_007372316.1|73625_73943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372317.1|73944_74694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241554.1|74714_75401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372318.1|75559_76735_+	ParB/RepB/Spo0J family partition protein	NA	A0A088FQX6	Escherichia_phage	31.3	6.5e-17
WP_103468658.1|76908_77430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372320.1|77426_77795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008786580.1|77803_79222_+	replicative DNA helicase	NA	O80281	Escherichia_phage	73.6	4.3e-188
>prophage 4
NZ_CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	82961	126707	262864	transposase	Salmonella_phage(41.67%)	40	NA	NA
WP_085950818.1|82961_84082_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_008786575.1|84195_84543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372327.1|84793_85144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241553.1|85176_85476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425568.1|86367_87372_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016809495.1|87450_90435_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.4	5.4e-302
WP_016809496.1|90489_91113_-	recombinase family protein	NA	NA	NA	NA	NA
WP_016809498.1|91537_93016_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	3.1e-197
WP_016809499.1|93033_93861_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.2	9.8e-52
WP_032425568.1|95263_96268_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_007372332.1|99696_100020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372333.1|100111_100303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016241551.1|100446_100971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372335.1|101042_101588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372336.1|101724_102027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241550.1|102138_102564_+	hypothetical protein	NA	A0A0K1YBA5	Cronobacter_phage	42.8	1.6e-26
WP_007372337.1|102717_103437_+	HNH endonuclease	NA	G0X580	Salmonella_phage	39.5	2.2e-07
WP_007372338.1|104965_106048_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	56.5	1.1e-79
WP_016241546.1|107009_107258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008786567.1|107830_108697_+	hypothetical protein	NA	J9Q7H0	Salmonella_phage	37.2	8.4e-46
WP_007372340.1|109107_109593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009651680.1|109680_109998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241545.1|110019_110418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372341.1|110736_110964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372342.1|111144_112068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372343.1|112103_112427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372345.1|112709_112928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071602877.1|113188_113425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372347.1|113985_115599_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	37.0	2.2e-07
WP_024196077.1|115714_116014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032951190.1|116428_116635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372348.1|116735_116987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241538.1|117023_117521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098991.1|118025_120092_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004098990.1|120088_121480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012579081.1|121641_122565_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001067855.1|123636_124341_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001515736.1|124399_124651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001325018.1|124764_125910_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001446567.1|125906_126707_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
>prophage 5
NZ_CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	132937	231362	262864	integrase,transposase	Salmonella_phage(21.74%)	114	137163:137222	184716:185936
WP_001254932.1|132937_134089_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_046092923.1|135571_136603_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_099531012.1|136741_137017_-	hypothetical protein	NA	NA	NA	NA	NA
137163:137222	attL	TGACCTGCTCCCCGTTGATTAGTACACCCCGATGTTAGTAATGTCTTCATAAGCCACATG	NA	NA	NA	NA
WP_085950818.1|137233_138353_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_009652923.1|138528_138843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|139057_140461_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|140489_141122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372199.1|143499_144462_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	41.1	9.6e-59
WP_009652914.1|144475_144862_+	plasmid stability protein	NA	NA	NA	NA	NA
WP_007372197.1|144888_145293_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_006812012.1|145494_145836_-	toxin	NA	NA	NA	NA	NA
WP_006812013.1|145856_146174_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001548171.1|146193_146415_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	38.9	3.1e-05
WP_000811693.1|146423_146900_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|146915_147374_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000194654.1|147471_147711_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032200803.1|147787_148255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468661.1|148280_148721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103468662.1|148720_148960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548933.1|148996_149698_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001548934.1|149914_150736_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	4.7e-46
WP_016154552.1|150827_151691_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001310555.1|151993_153010_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_102016203.1|153227_153386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468668.1|153382_153937_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_103468663.1|154001_155318_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	29.5	6.6e-34
WP_024196074.1|155556_155886_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_032655135.1|155937_156741_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.6e-14
WP_007372194.1|156794_158606_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_007372193.1|158616_159045_-	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_009652918.1|159047_159632_-	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_016241522.1|159643_161311_-	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_007372190.1|161702_162131_+	heme-binding protein	NA	NA	NA	NA	NA
WP_048218660.1|162153_163317_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_048218661.1|163333_163687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048218663.1|163687_164218_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003828512.1|164195_166121_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_103468664.1|166212_167310_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_007372180.1|167866_168937_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_007372179.1|168947_169580_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_103468665.1|169590_171009_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_007372177.1|171083_172733_+	glycerone kinase	NA	NA	NA	NA	NA
WP_007372176.1|172836_173607_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_007372175.1|173813_174011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075206739.1|173989_174655_+	DNA methylase	NA	NA	NA	NA	NA
WP_043016716.1|174651_177225_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_082138494.1|177315_177942_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000019445.1|177923_178904_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_103468666.1|178999_179155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103468669.1|179151_179706_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_025798965.1|179770_181087_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.0	4.6e-35
WP_103468667.1|181231_181597_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043016718.1|181928_182534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043016719.1|182544_182967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085950818.1|183583_184704_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_127649449.1|184960_185275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372161.1|185302_185983_-	hypothetical protein	NA	NA	NA	NA	NA
184716:185936	attR	CATGTGGCTTATGAAGACATTACTAACATCGGGGTGTACTAATCAACGGGGAGCAGGTCACCCAACCTACGTAAGTCACTCAAAACATTGCAGCAAAATGGCTATGTATGGAAGTACCGGAACAAAAACGATCTTACAGTTTCATTTGAGTTAACTTCATCAGGAGAACTCCAGGCAACTTCATTTCGGGTGCGAAGATTAGAGGCATGGGGCCAGGCAGACGAGTAAAACTCGTCTGCTGGTGGTTACACAGAAAGATACTTTTTACTGATAGTTAAAGCGCTGCGTCGTTTTAATGCAAATGGACGATTATCAGAAAGTCTGGAAGCATTACCGGCGCGAATGAATATGCGTTTCATCCTGCGGTCAAAATGTTCTTCTGACCAGCCGAAGGGATACGTACCCTTAATACCATCTATTGGCCCGGCAAGAATGCGAGCGGTTTCGCTACGAAGAGTACTTCCCCTTAAACCAAATGAGCTAAGTTTATTTCTTATCAGACTTACAGAAAATTTCCTGGGTTTTAAAACACCCTTAATACAGTACAGATGTTTACTCATAGCATTACCCTTTTATTATGGGAACGATTAGCTGCGCTGCATAAAGTCGATGGATTGGCGTTTGTTTTCTTCGATTATCTTCATTGCCTCTTCAAGCCATCCAGCATCTTCACCCCGGCTGGTTAGCTCTTTGTGCTTTAGTTTGAGTGCAAATACTGCGTCATCAGCACCGGCAGTAAACAATTCTTGTCTGACTTGTTGTGTGCTGGTTGTACCATTTATAACACCAACCATATAATTCACGATATCAATAACTTGGGGGAGTAAATCTGGATCCTCATGATTAATCTCCTCGATACTGACAAACGGCAGTAACCGGTCAATCAGCATATGGGCTAGGTTGGTGATATTCAGCAGGAATAGGTTATCGTTCTCGGTGTCGCTTTTGCTTTTTACTTCTGATGCGGTAAACGACTGAACCCGGCGATTGTATTCGCACTGCCACTCCTTACAGGCACTGATCATCCAGTTCTGTATCTCTTCATCAGAAGCGTTGGATGATGGAATGTCCATCGCAGCAGGGAGAACTTGATCCCACGGGTAAACATGAGAATCAATCATCACGCCTTCCGCGTTACGCATTAACTCAGATAAAGCCACTATGATGCGGCGCATCAGATGGTTTTCAGTGAGGAGAGTAAACTCTTGTTTCGATGCACCA	NA	NA	NA	NA
WP_154050669.1|186260_186614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008786804.1|186669_187227_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_046092923.1|187864_188896_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_007372157.1|189317_189770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032941601.1|189782_190088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372155.1|190093_190621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372154.1|190700_191585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020996135.1|191784_192186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009653863.1|192276_192738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008786801.1|193121_193457_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_007372153.1|193465_193777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372151.1|193892_194963_-	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	28.4	6.5e-40
WP_020996132.1|194955_195279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372150.1|195401_196391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008786799.1|196417_196822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372149.1|197148_197700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372148.1|197729_197966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372147.1|198043_198334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008786797.1|198519_198921_-	hypothetical protein	NA	Q1MVE8	Enterobacteria_phage	69.9	3.5e-47
WP_007372145.1|199469_199961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217395.1|200046_200538_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001333498.1|200708_200966_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	8.3e-18
WP_127649377.1|201254_201635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372144.1|201947_202838_-	DNA replication protein	NA	NA	NA	NA	NA
WP_009652912.1|202987_204253_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	60.6	9.8e-144
WP_008786793.1|204252_204669_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.7	1.0e-36
WP_007372141.1|204922_205426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075552836.1|205409_205682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572362.1|205782_206805_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_045269834.1|206828_209867_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	5.0e-295
WP_045269835.1|210034_210676_+	recombinase family protein	NA	NA	NA	NA	NA
WP_025760366.1|210939_212598_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000928911.1|212758_213109_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000043177.1|213413_213890_-	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
WP_016241611.1|214004_214442_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000626969.1|214602_215064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137910.1|215038_215359_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|215818_216823_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_045269836.1|216901_218299_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	32.1	1.3e-117
WP_001162010.1|218301_218859_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
WP_000993245.1|218988_219201_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|219163_219283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|219266_219503_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|219499_219865_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|219882_221568_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|221606_222032_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|222059_222335_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294653.1|222350_222746_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|222817_223273_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012561145.1|223730_224891_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_012561144.1|224932_225928_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_000792636.1|225927_226461_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_000091613.1|226633_226948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|227202_227559_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|227548_227950_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|227946_228237_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_032640605.1|228395_231362_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
>prophage 6
NZ_CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	247844	256341	262864	transposase	uncultured_Caudovirales_phage(60.0%)	8	NA	NA
WP_012817690.1|247844_250853_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_001556711.1|251016_251589_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
WP_004118313.1|251597_252002_+	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_000065758.1|252032_252458_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_000922630.1|252470_253760_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
WP_001556710.1|253808_255560_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000783215.1|255577_255940_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001114073.1|255987_256341_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
>prophage 7
NZ_CP026282	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence	262864	259343	260987	262864		Streptococcus_phage(100.0%)	1	NA	NA
WP_004197675.1|259343_260987_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
>prophage 1
NZ_CP026283	Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence	125961	1231	54345	125961	integrase,transposase	Shigella_phage(13.04%)	50	37195:37208	54428:54441
WP_032752147.1|1231_1399_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004118843.1|2399_3326_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	4.2e-19
WP_032752149.1|4002_9894_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_097311113.1|10008_11215_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	64.0	3.6e-103
WP_086013483.1|13086_14234_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
WP_004182074.1|15201_15615_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|15615_15894_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|15883_16204_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_020325128.1|16284_16509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032752153.1|16519_16732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706019.1|16792_17149_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	4.4e-25
WP_023320095.1|17780_18131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011787830.1|18627_21708_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
WP_011918375.1|21731_22043_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787805.1|22042_22303_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011787804.1|22472_23093_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787803.1|23210_23543_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_011787802.1|23633_24488_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
WP_011787801.1|24522_26013_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_032752057.1|26530_27016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426744.1|27176_27338_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_032752058.1|27554_27881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032752059.1|27877_28606_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032752061.1|28602_29034_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_032752064.1|29078_31079_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.3	7.2e-24
WP_032752067.1|31147_31396_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032752069.1|31444_31984_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	73.2	9.2e-51
WP_032752071.1|32789_33353_-	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.8	2.6e-19
WP_032752072.1|33400_34756_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001568051.1|34807_35038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032420961.1|35129_35357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032420959.1|36085_36403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032420958.1|36437_36692_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	51.3	2.3e-12
WP_004118478.1|36928_37354_-	antirestriction protein	NA	NA	NA	NA	NA
37195:37208	attL	TGAAATGCCAGAAG	NA	NA	NA	NA
WP_110222094.1|37573_37651_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_004206779.1|37876_38107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|38340_39825_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032751822.1|40249_41734_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_032752075.1|42139_42565_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	1.4e-30
WP_032752077.1|42564_43836_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.3e-155
WP_032420955.1|44002_44254_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032420954.1|44250_44538_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	1.7e-19
WP_032420989.1|45293_46040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096834042.1|46258_47383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032420949.1|48032_48425_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_032752080.1|48428_49403_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	44.2	2.9e-71
WP_017901448.1|49642_50017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901447.1|50016_50649_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	1.8e-29
WP_032420987.1|52051_52918_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032420986.1|53562_54345_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.1	2.9e-53
54428:54441	attR	CTTCTGGCATTTCA	NA	NA	NA	NA
>prophage 1
NZ_CP026280	Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence	152041	3547	47152	152041	transposase,integrase	Escherichia_phage(41.67%)	47	9544:9559	50398:50413
WP_000427614.1|3547_4552_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_023302490.1|5670_5886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|6000_6705_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_020277920.1|7273_7855_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020277919.1|7859_8198_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002431133.1|8227_8557_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
WP_006687059.1|8770_9877_+	alkene reductase	NA	NA	NA	NA	NA
9544:9559	attL	CGGTCAGCGGGAACTG	NA	NA	NA	NA
WP_020277918.1|9942_10644_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_020277917.1|10709_11483_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_020277915.1|12944_13913_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033488203.1|13902_15564_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_021242984.1|15547_16108_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	41.8	1.9e-30
WP_001567386.1|16446_16923_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001567387.1|17015_17282_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001567388.1|17422_18043_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001567390.1|18503_19373_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004729622.1|19613_20366_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001567384.1|20805_21810_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000427614.1|23936_24941_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001567377.1|25661_26156_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001567378.1|26145_26607_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_021243014.1|26630_26768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567380.1|26841_27348_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_001567381.1|27378_27639_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001567382.1|27851_28409_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001567383.1|28505_28772_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|29145_30150_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|31203_31908_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001348075.1|31954_32191_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|32264_32681_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|32677_32908_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001568025.1|33495_33714_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_004197633.1|33715_34021_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_025380813.1|34225_34585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053389906.1|34611_34926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017899884.1|34936_35953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197635.1|36150_36945_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_077253981.1|37384_37564_-	Par-like protein	NA	NA	NA	NA	NA
WP_004197649.1|37683_38310_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004098982.1|38942_39818_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197646.1|40229_41501_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_001568036.1|41500_41932_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004152765.1|42341_43826_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568038.1|44074_45046_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_032736798.1|45048_45720_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|45783_46014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032736797.1|46450_47152_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	3.2e-27
50398:50413	attR	CGGTCAGCGGGAACTG	NA	NA	NA	NA
