The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	2817	45963	5103533	portal,transposase,terminase,tail,lysis,head	Enterobacteria_phage(40.0%)	48	NA	NA
WP_088415734.1|2817_3969_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	5.8e-42
WP_001557860.1|5546_5654_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000887491.1|5698_5911_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001325325.1|6369_6648_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
WP_001047135.1|7711_8464_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|8741_8831_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|8885_9098_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|9398_9614_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|10367_10583_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000191859.1|10587_10863_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	77.0	4.4e-25
WP_000066495.1|11961_12174_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|12184_12373_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122985912.1|12375_12441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|12520_12676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|12847_13021_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|13172_13583_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|13640_13874_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453603.1|14262_14808_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_001549229.1|14782_16708_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|16704_16911_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001324962.1|16907_18509_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000123333.1|18489_19809_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
WP_001549228.1|19818_20151_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_085451751.1|20332_21010_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.8	6.6e-22
WP_000624622.1|21009_21357_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|21376_22948_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000158873.1|23980_24376_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.8e-57
WP_000752994.1|24387_24741_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975060.1|24752_25331_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	5.0e-79
WP_000683143.1|25327_25723_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001439072.1|25730_26471_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_000479139.1|26486_26909_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_000459480.1|26890_27325_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_000840345.1|27317_29897_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.3	0.0e+00
WP_000847345.1|29893_30223_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152580.1|30222_30921_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.4e-131
WP_000140764.1|30926_31670_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
WP_000090905.1|31606_32209_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	5.6e-89
WP_000515751.1|32269_35749_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_001233182.1|35816_36416_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	2.5e-105
WP_000279189.1|36480_39831_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
WP_000885610.1|39830_40406_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086522.1|40503_41094_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|41410_41644_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|41712_41826_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_103215913.1|42428_43664_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001101446.1|43695_44721_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001118619.1|45039_45963_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
>prophage 2
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	90406	134427	5103533	integrase,transposase	Acinetobacter_phage(28.57%)	29	93784:93843	124085:124852
WP_085947771.1|90406_91568_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_016239971.1|92297_93104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016239970.1|93121_93562_-	hypothetical protein	NA	NA	NA	NA	NA
93784:93843	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000589340.1|95866_96670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611902.1|96728_98075_-|transposase	ISNCY-like element ISLad2 family transposase	transposase	NA	NA	NA	NA
WP_004883463.1|98312_98945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883460.1|98973_100377_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_016239968.1|100652_102044_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016239967.1|102036_103587_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016239966.1|103583_105938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087451024.1|106248_107368_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_085947598.1|107552_108715_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001549210.1|109433_110084_-	TIGR02646 family protein	NA	NA	NA	NA	NA
WP_001549209.1|110086_111739_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	30.5	4.9e-10
WP_001549208.1|111735_112671_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001549206.1|113399_116390_-	DEAD/DEAH box helicase family protein	NA	A0A2H4UTW8	Bodo_saltans_virus	24.3	5.7e-09
WP_001296758.1|117756_118320_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001195158.1|118680_119391_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001549205.1|119432_119804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088765672.1|119800_121073_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_103215916.1|124121_124523_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_016239964.1|124504_124996_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
124085:124852	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCAACCACCTATTCTGCTTTATCCGCAGATAGCGTTATTAAAATTAGCGGGCGCGTCCTCGATTATGGCTGCACAGTCTCATCGGATTCGCTTAATTTTACCGTAGATCTCCAAAAAAACAGTGCCAGACAATTTCCAACGACCGGTAGCACAAGTCCAGCCGTCCCTTTTCAGATTACGTTAAGTGAATGCAGCAAAGGGACAACGGGGGTTCGGGTTGCATTTAACGGTATTGAGGATGCAGAAAATAATACTCTGTTGAAACTGGATGAAGGAAGCAATACGGCTTCCGGTTTGGGTATAGAAATACTGGACGGAAATATGCGTCCGGTGAAATTGAATGACCTTCATGCCGGGATGCAGTGGATCGGTTCCTGTTAGCTACGTTTTGCGCGTTATTCACAGCAACTCTCCAGGCCGCCGATGTCACTATCACTGTTAATGGTCGGGTAGTCGCTAAACCCTGCACTATTCAAACCAAAGAAGCTAACGTTAATCTCGGGGATCTTTATACGCGCAATCTGCAACAACCTGGTTCTGCATCTGGCTGGCACAATATTACTCTGTCATTAACCGATTGTCCGGTTGAAACAAGTGTAGTGACGGCAATCGTGACAGGTTCAACTGACAATACGGGTTATTACAAAAATGAAGGTACTGCCGAAAATATTCAGATAGAGCTGAGGGATGACCAGGATGCGACGTTAAAA	NA	NA	NA	NA
WP_016239963.1|125055_125970_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000726743.1|126303_128583_+	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_001295684.1|129288_130971_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_001299007.1|131022_132180_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_122633168.1|132145_132268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215917.1|132470_133406_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_023135683.1|133410_134427_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 3
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	287792	304377	5103533	tRNA,integrase	Escherichia_phage(75.0%)	21	289129:289142	304748:304761
WP_001676522.1|287792_289790_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
289129:289142	attL	GCATTCACCTGCAA	NA	NA	NA	NA
WP_016239946.1|290130_290553_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	6.3e-63
WP_000450660.1|290568_291330_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_016239945.1|291352_292099_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.7	1.5e-112
WP_001396581.1|292105_292894_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|292971_293394_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|293390_293645_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|293724_294144_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001169151.1|294576_294732_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|294728_295217_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|295658_295880_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|295879_296050_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|296124_296400_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001549183.1|296501_299102_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	4.4e-247
WP_103215918.1|299094_299904_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	1.2e-105
WP_001317028.1|299960_300155_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|300147_300357_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|300435_300651_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_016239944.1|300652_301888_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_001157407.1|301939_302875_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123745.1|303003_304377_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
304748:304761	attR	GCATTCACCTGCAA	NA	NA	NA	NA
>prophage 4
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	442158	473059	5103533	tail,plate	Vibrio_phage(67.65%)	44	NA	NA
WP_023277393.1|442158_442395_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	57.6	3.0e-14
WP_023277392.1|442394_444377_+	hypothetical protein	NA	A0A0C4UR24	Shigella_phage	50.6	8.3e-190
WP_023277391.1|444472_445411_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	47.5	1.9e-75
WP_023277390.1|445415_445655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277388.1|445960_446212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277387.1|446219_446747_+	hypothetical protein	NA	A0A125RNF6	Pseudomonas_phage	57.9	3.0e-46
WP_023277386.1|446836_447493_+	hypothetical protein	NA	A0A291AUJ5	Sinorhizobium_phage	47.7	1.2e-12
WP_023277385.1|447470_447998_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	49.4	1.7e-41
WP_023277384.1|447994_448405_+	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	63.5	3.1e-38
WP_023277383.1|448408_448918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277382.1|449028_449619_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	46.7	1.7e-37
WP_023277381.1|449620_449839_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	69.4	1.0e-24
WP_023277380.1|449831_450239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277379.1|450226_450835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277378.1|450831_451038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239613.1|451038_451344_+	DUF2730 family protein	NA	M1Q558	Vibrio_phage	38.3	5.6e-13
WP_016239612.1|451356_451644_+	hypothetical protein	NA	M1PPT9	Vibrio_phage	64.5	4.6e-25
WP_023277377.1|451646_452021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277376.1|452013_452292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277375.1|452281_452860_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	55.0	9.6e-46
WP_023277374.1|452856_454440_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.9	1.0e-198
WP_023277373.1|454439_456008_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	5.1e-158
WP_023277372.1|456000_456789_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	57.6	2.1e-91
WP_023277371.1|456998_457955_+	hypothetical protein	NA	M1Q578	Vibrio_phage	50.6	9.8e-80
WP_016239604.1|457958_458852_+	hypothetical protein	NA	M4MB71	Vibrio_phage	56.4	1.3e-94
WP_023277370.1|458935_459529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239602.1|459528_459969_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	1.4e-33
WP_016239601.1|459968_460511_+	hypothetical protein	NA	M4MB67	Vibrio_phage	59.2	1.4e-54
WP_023277369.1|460507_461131_+	hypothetical protein	NA	M4MHF0	Vibrio_phage	44.5	1.7e-35
WP_016239599.1|461111_461300_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_023277368.1|461299_462778_+	hypothetical protein	NA	M1Q565	Vibrio_phage	53.8	2.2e-150
WP_016239597.1|462787_463144_+	hypothetical protein	NA	A0A2I7S9D5	Vibrio_phage	44.6	2.0e-22
WP_023277367.1|463147_463543_+	hypothetical protein	NA	M1NVT1	Vibrio_phage	42.9	5.2e-19
WP_023277365.1|463629_465531_+	hypothetical protein	NA	M4MHE6	Vibrio_phage	53.0	1.8e-120
WP_103215919.1|465530_466862_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	37.6	1.0e-74
WP_023277363.1|466861_467953_+	hypothetical protein	NA	M1PVV2	Vibrio_phage	46.0	3.7e-91
WP_023277362.1|467943_468486_+|plate	phage baseplate assembly protein V	plate	M1Q572	Vibrio_phage	40.4	2.5e-27
WP_023277361.1|468482_468935_+	hypothetical protein	NA	M1PPW1	Vibrio_phage	42.8	4.0e-23
WP_103215920.1|468924_470001_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	53.4	1.6e-102
WP_023277359.1|469985_470576_+	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	50.3	3.7e-53
WP_103215921.1|470575_471226_+	hypothetical protein	NA	O22004	Shigella_phage	37.4	6.8e-24
WP_048233359.1|471228_471651_+|tail	caudovirales tail fiber assembly family protein	tail	A0A0M4S6V4	Salmonella_phage	76.0	3.1e-25
WP_103215922.1|471622_472075_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	55.6	3.0e-39
WP_023277357.1|472504_473059_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.7	6.9e-86
>prophage 5
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	489986	580033	5103533	plate,portal,transposase,tRNA,tail,terminase,lysis,protease,holin,head,capsid	Shigella_phage(42.31%)	104	NA	NA
WP_000152925.1|489986_490571_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|490687_491779_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001325412.1|492660_495528_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001295618.1|495627_497547_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733715.1|497774_498845_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_000059411.1|498855_499488_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001325411.1|499498_500917_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000841712.1|501236_502934_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000615053.1|503012_503453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511313.1|503627_503882_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020161.1|504082_504817_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|504818_505430_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051580.1|505529_506444_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000197840.1|508655_509726_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|509735_511034_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|511363_512896_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|512947_513667_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|513888_515430_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|515575_516106_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457608.1|516151_517420_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	1.8e-209
WP_000897378.1|517419_517839_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_004152765.1|517917_519402_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_087935122.1|519944_520334_+	hemolysin E	NA	NA	NA	NA	NA
WP_072278662.1|520539_521001_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|521077_521737_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|521808_522102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|522343_522745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056840.1|522864_523233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|523752_524448_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|524471_525284_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|525287_525554_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|526303_526423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325005.1|526383_526569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|526669_526843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000726974.1|526844_527189_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_001295611.1|527198_527528_+	YmgD family protein	NA	NA	NA	NA	NA
WP_000768545.1|527584_530233_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.2	2.5e-85
WP_001065861.1|530632_530851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246498.1|530982_532506_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|532837_533086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888772.1|533198_533465_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858002.1|533493_533766_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554144.1|533808_534045_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001299269.1|534358_535570_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332303.1|535774_536506_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|536726_537131_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|537183_537294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140255.1|537830_538154_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	2.6e-40
WP_000943927.1|538256_538421_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_016239934.1|539594_540149_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.9	3.3e-88
WP_016240349.1|540576_541017_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	7.5e-51
WP_016240350.1|540994_541591_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.4	9.4e-97
WP_061300946.1|541590_542379_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	4.6e-51
WP_000383548.1|542382_542967_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_016239932.1|542957_544016_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.9	1.2e-200
WP_000424732.1|544002_544428_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259084.1|544427_544976_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_016239931.1|546052_547381_-|tail	phage tail/DNA circulation protein	tail	Q8SBG8	Shigella_phage	97.5	1.8e-244
WP_016239930.1|547441_549277_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.5	1.2e-304
WP_000661051.1|549418_549688_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|549687_550044_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_016239929.1|550043_551540_-|tail	phage tail sheath protein	tail	U5P0H3	Shigella_phage	99.0	2.0e-276
WP_000497753.1|551523_551694_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_103215924.1|551702_552263_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	3.0e-105
WP_000224835.1|552259_552766_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_001579916.1|552740_553151_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	6.7e-70
WP_000927711.1|553147_553471_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|553473_553674_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_016239928.1|553723_554929_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.7	3.8e-222
WP_001193631.1|554943_555594_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466255.1|555571_556813_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605606.1|556812_556995_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_122988410.1|557006_558503_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.8e-298
WP_000929173.1|558736_559231_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_024195782.1|559356_559707_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	97.4	4.0e-63
WP_000439452.1|559783_560647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215925.1|560719_561178_-|lysis	lysis protein	lysis	K7P735	Enterobacteria_phage	86.7	6.6e-66
WP_001395480.1|561263_562295_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_016239924.1|562319_562796_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	7.0e-87
WP_001532222.1|562799_563126_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	98.1	3.4e-56
WP_000799659.1|563202_564255_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.1	6.8e-207
WP_000917724.1|564405_564609_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000868396.1|564873_565800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131905.1|565786_566335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|566347_566689_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_016239923.1|566706_567696_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.5e-192
WP_016239922.1|567703_568501_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	3.2e-148
WP_000767096.1|568520_568910_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.7e-68
WP_000210154.1|568906_569233_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001305610.1|569229_569883_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_001305611.1|569882_570377_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_016239921.1|570373_571315_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.4	5.6e-144
WP_001250269.1|571304_571484_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|571659_572211_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|572248_572449_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|572546_573173_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_001083098.1|573357_573561_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	75.5	2.0e-14
WP_001514782.1|573569_573845_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_000939946.1|574470_574716_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_016239916.1|575747_575927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000444487.1|576326_577577_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248691.1|577748_578402_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|578411_578873_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|578926_580033_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	675633	839656	5103533	plate,transposase,holin,tail,lysis,protease,integrase	Salmonella_phage(22.83%)	185	746906:746965	791035:792232
WP_023135683.1|675633_676650_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_158649772.1|676758_676974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|677023_678185_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409885.1|678226_679585_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
WP_000945545.1|682603_684622_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610451.1|684614_685940_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|685941_686355_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_001295604.1|686404_687328_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	4.1e-91
WP_001199472.1|687799_689071_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154398.1|689076_690204_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|690261_691092_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018489.1|691633_693142_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|693300_693510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325508.1|693564_697527_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191701.1|697566_698205_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001352489.1|698492_699584_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307100.1|699583_700276_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126780.1|700287_700674_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001325509.1|700681_701482_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001165.1|701491_702082_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|702092_702587_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001325510.1|702607_703936_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.5	6.7e-236
WP_001273658.1|704193_704367_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_016239912.1|705289_705838_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	35.6	1.0e-20
WP_016239903.1|709292_710828_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	1.6e-260
WP_000609174.1|710877_711225_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_050586387.1|711221_711554_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	45.2	1.1e-06
WP_103215927.1|711491_711938_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.8	1.6e-16
WP_103215928.1|711947_712787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028016388.1|714026_714995_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077255487.1|715004_715181_-|transposase	transposase	transposase	Q76S41	Shigella_phage	63.5	3.9e-11
WP_085947771.1|715467_716630_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000111568.1|716975_717581_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|717601_717829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044365.1|717866_719108_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001549150.1|719390_719639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016239899.1|719762_720647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000420617.1|720906_721827_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|721826_722132_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209893.1|722224_722824_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001549148.1|722820_725367_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.0e-70
WP_001230242.1|725366_726539_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|726668_727361_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264919.1|727333_728362_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_103215929.1|729378_729753_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.6	3.4e-12
WP_103215930.1|729755_730196_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.0	8.3e-50
WP_103215931.1|730167_730770_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	1.9e-97
WP_103215932.1|730769_731696_-|tail	tail fiber protein	tail	A0A0M3ULD8	Salmonella_phage	71.3	6.9e-62
WP_049043303.1|731695_732376_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.4	1.4e-109
WP_103215933.1|732372_733572_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	82.2	4.0e-179
WP_103215934.1|733572_733926_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	76.1	8.4e-45
WP_103215935.1|733925_734666_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	60.8	2.9e-71
WP_001515094.1|734724_735132_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	40.7	1.8e-14
WP_001515093.1|735131_735545_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016239887.1|735627_735978_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	42.7	9.3e-20
WP_103215936.1|735979_737044_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	66.4	4.4e-137
WP_032177179.1|737046_737352_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.6	4.3e-21
WP_060617936.1|737348_737975_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	64.8	7.9e-62
WP_103215937.1|737974_740182_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	64.5	2.8e-263
WP_000393957.1|740359_740785_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	57.5	1.6e-37
WP_016239882.1|740788_741229_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	1.3e-58
WP_103215938.1|741239_742400_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.1	2.4e-157
WP_078341561.1|742403_742967_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.6e-80
WP_016239880.1|742941_743331_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	3.5e-68
WP_103215939.1|743317_743872_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.3	6.1e-82
WP_044702581.1|743868_744276_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.0	4.6e-71
WP_001040703.1|744241_744631_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	57.4	6.5e-30
WP_001515079.1|744672_745614_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	97.1	1.2e-175
WP_088765853.1|745625_746108_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	83.8	1.0e-69
WP_049041022.1|746340_746814_-	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	67.9	1.4e-50
746906:746965	attL	GGAAGGTGCGAATAAGTGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTCAT	NA	NA	NA	NA
WP_023135683.1|747051_748068_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_158649773.1|748072_748366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215940.1|748467_748926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053520709.1|748996_749590_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	69.3	5.5e-65
WP_053520710.1|749746_749941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053520711.1|749947_750511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053520712.1|751112_753794_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	54.4	2.4e-280
WP_053520713.1|753790_754009_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_057057887.1|754011_754308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053520715.1|754304_755180_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_053520733.1|755172_755367_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_100246799.1|755423_755510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100246801.1|755717_756773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702602.1|757295_757577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065404227.1|757581_757941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158649774.1|757920_758076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702604.1|758080_758293_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_049238978.1|758435_759665_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	38.1	2.4e-70
WP_103215941.1|759878_761111_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	92.9	5.0e-217
WP_000224761.1|761125_761863_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	96.0	6.0e-109
WP_103215942.1|761747_763217_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	5.6e-268
WP_001515075.1|763216_764839_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	6.0e-312
WP_001515074.1|764841_765315_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	72.8	4.7e-51
WP_016243560.1|765346_765967_-	hypothetical protein	NA	I6S676	Salmonella_phage	72.7	8.3e-88
WP_001064347.1|766027_766546_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	100.0	2.9e-94
WP_103215943.1|766804_766990_-|lysis	lysis protein	lysis	M9NZE8	Enterobacteria_phage	98.3	1.5e-24
WP_071820177.1|766961_767168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195013.1|767215_767665_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	80.5	3.2e-65
WP_000783764.1|767648_767972_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	82.5	6.8e-41
WP_047645761.1|768417_768906_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	99.4	9.1e-90
WP_103215944.1|768896_769568_-	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	97.8	3.9e-131
WP_096310517.1|769545_769752_-	protein ninH	NA	Q716C0	Shigella_phage	98.5	2.1e-32
WP_103215945.1|769748_770360_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.0	5.1e-98
WP_001543885.1|770352_770562_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_103215946.1|770521_770923_-	hypothetical protein	NA	G9L690	Escherichia_phage	97.0	2.3e-70
WP_001254220.1|770925_771102_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_103215947.1|771098_771626_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	5.2e-99
WP_000736886.1|771622_772063_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	3.5e-80
WP_103215948.1|772139_773576_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	92.1	2.0e-254
WP_103215949.1|773565_774465_-	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	55.3	4.2e-80
WP_000166207.1|774457_774604_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000189606.1|774636_774933_-	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
WP_001549086.1|775071_775305_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	98.7	8.9e-35
WP_000428098.1|775418_776123_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_001549085.1|776192_776633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549084.1|776629_776986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000198444.1|777494_777878_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_103215950.1|778182_778470_+	hypothetical protein	NA	K7PHN6	Enterobacterial_phage	72.6	2.6e-28
WP_000865176.1|778469_778658_+	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	59.3	3.8e-12
WP_072256336.1|778738_779014_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	2.3e-45
WP_000604110.1|779098_779407_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_103215951.1|779403_780315_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.0	1.4e-168
WP_000041326.1|780298_780781_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.9	3.5e-78
WP_000753555.1|780792_781107_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_103215952.1|781287_781932_+	ead/Ea22-like family protein	NA	K7PKY4	Enterobacterial_phage	98.6	1.0e-109
WP_001232433.1|781928_782201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078341493.1|782197_782542_+	ead/Ea22-like family protein	NA	K7PHN2	Enterobacterial_phage	90.7	1.8e-28
WP_103215953.1|782731_783532_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	59.8	2.7e-83
WP_000545722.1|783632_783800_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.4e-26
WP_001303849.1|783839_784058_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_103215954.1|784035_785109_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.2	4.1e-199
WP_071586760.1|785203_787948_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000829666.1|788019_789093_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|789140_789314_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|789303_789534_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|789508_789697_-	cold-shock protein	NA	NA	NA	NA	NA
WP_061301119.1|789707_789914_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.0	1.8e-18
WP_023135683.1|789931_790948_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_103215955.1|791404_791617_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000681082.1|792058_792364_+	hypothetical protein	NA	NA	NA	NA	NA
791035:792232	attR	ATGAAGAAATGAAATGACTGAGTCAGCCGAGAAGAATTTCCCCACTTATTCGCACCTTCCCTAAACCAGTCATTTTATTAGACATATTTTACTTCCTTCATTTTGGGCCTTTCGGCAAACAGGGCTTTAATACAGAAACTACTTAGTGTTCAGGAGAGAGACTCAAAAGAAGGGGATAATGCCTGATAATGAGAACTGCTTTAGTAAACTACTTTGTATGCTGTCTGTCTTTCAAACCGACGCAGCTATTAACGCATGATAATTGAGATTAAGCAAATTTTATTTTAGCCGTCCGGCGGTCTTAAATATCGCTGGCTTTATTTTATTAACCCCGTATAGTGCAGCGCAGTATTTTCAGTAAGGAATTTGTTTGTCCCGTAAAATGACAGGAATTGTCAAAACCTTTGATCGCAAAAGCGGCAAAGGATTCATTATCCCCTCCGACGGTCGTAAAGAAGTCCATGTCCATATTTCCGCATTCACTCCCCGCGACGCAGAAGTGCTTATACCAGGATTACGCGTGGAATTTTGCCGCGTAAATGGCCTGCGAGGACCAACAGCGGCAAATGTTTATCTCTCTTAATATGACGCTGCTTGTTTAAAGCTGACTGGTTTTATTGGAATAGTTCAATAGTCAACACCATAAATTATAATATGAGTTACTTTTTCACCAGGCAACAAATCCATTTAAGCGAATATCTCTGCACCTAATAGTTATAAATGCCACTTAACAGCCAGTTATAGTACCACTTGAAACTATATTACCAACAATAGTTAATAGCTTTCTTAACAATTTTCTTATCTTTAATTTGTATTTTTCTAAGATTTATCTTATGCGCACAAGTCGTATTTCCAGAGGGAAATCGTTAACAATCTTATATTTCCCTCTGCGCGCCTTTCTCACCCGCTGTATATAGTGCAAGTGGTATGAGGAAAGGGAGATTTCACAAGGATGTTATACTCAAAGTAGACAATCCTGATCTCAAGCGTACGTATTGTCCATGCGATGAATAAAGGAAAAGTTATGAAACACAAGCTTTCTGCAATCCTTATGGCCTTCATGTTGACGACGCCAGCTGCGTTTGCTGCCCCTGAAGCAGCAAACGGGACCGAGGCAACGACGGGTACTACTGGCACCACAACAACCACTACAGGTGCAACCACGACTGCTGCTACCACTGGTGGCGTGGCTGCTGGC	NA	NA	NA	NA
WP_001549146.1|792470_793115_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038075.1|793111_793858_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|793857_795954_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001325515.1|795999_797139_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_103215956.1|797126_797573_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208665.1|797592_799773_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|799887_801186_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|801265_801358_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460803.1|801370_802507_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263577.1|802518_804063_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|804196_805054_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063978.1|805050_805449_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|805445_806033_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|806029_806737_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|806755_808549_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|808545_809664_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000375136.1|810384_811044_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_000904442.1|811134_811464_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000048252.1|811460_811739_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000116288.1|811833_813024_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_001295356.1|813081_813399_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000665217.1|813443_813857_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847791.1|814029_814692_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424181.1|814787_815246_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420536.1|815277_817332_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_001261235.1|817454_817901_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000875023.1|817910_820073_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_000839153.1|820035_820665_-	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000288710.1|820883_821393_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001307702.1|821749_822802_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877158.1|822876_823329_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156516.1|823514_825275_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|825343_825862_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|825931_826099_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759095.1|826354_826918_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445533.1|826914_828555_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|828559_829813_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053091.1|829942_831850_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
WP_001086527.1|831861_833970_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000212426.1|834213_835323_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|835319_835862_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001295352.1|836035_837046_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001325523.1|837156_837867_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919489.1|837859_838375_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000019445.1|838675_839656_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 7
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	848535	947320	5103533	plate,portal,transposase,tRNA,tail,terminase,lysis,integrase,protease,holin,head,capsid	Escherichia_phage(36.07%)	93	892109:892124	921281:921296
WP_000117881.1|848535_849936_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_011191341.1|850743_852018_-|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
WP_000462687.1|853207_854398_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109487.1|854619_855267_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|855293_855842_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925997.1|856022_857870_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572641.1|858130_862591_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|862590_863295_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|863275_864598_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|864594_865380_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899586.1|865628_866408_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|866384_867278_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011594.1|867431_868178_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|868174_868357_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056529.1|868408_869641_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570540.1|869677_870664_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|870660_872409_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705714.1|872445_874710_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|874916_875201_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|875360_877034_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|877144_877828_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|878000_878765_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000445231.1|878933_880217_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057149.1|880287_881376_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|881574_882267_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194834.1|882395_884156_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|884561_885419_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|885473_887756_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|888075_888294_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_016240314.1|888375_889539_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
WP_000978889.1|889538_890018_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_103215958.1|890032_892480_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.4	0.0e+00
892109:892124	attL	TTCCCGCTGCTGGCGC	NA	NA	NA	NA
WP_000785970.1|892472_892592_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|892624_892900_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|892955_893474_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_097177834.1|893486_894677_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	1.8e-224
WP_038430674.1|894736_895330_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	4.6e-104
WP_103215959.1|895360_895810_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	61.4	1.5e-51
WP_103215960.1|895809_896412_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	90.8	1.4e-95
WP_103215961.1|896383_896824_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.0	6.4e-50
WP_103215962.1|896826_898011_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	80.1	4.0e-163
WP_001285352.1|898007_898619_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_103215963.1|898611_899520_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	5.4e-160
WP_000127164.1|899524_899872_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001093731.1|899868_900504_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_001001782.1|900570_901023_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_000917182.1|901015_901483_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_001440152.1|901445_901619_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_103215964.1|901590_902016_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	95.7	8.0e-66
WP_103215965.1|902003_902429_-	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	97.2	1.9e-59
WP_001144101.1|902443_902941_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|902940_903222_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|903225_903429_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|903428_903938_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_016236401.1|904037_904781_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.0	1.5e-123
WP_001248583.1|904784_905858_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_001085948.1|905916_906771_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156872.1|906944_908717_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001620981.1|908716_909751_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.4	2.4e-201
WP_103215966.1|909963_910233_+	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
WP_000551925.1|910263_910458_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	89.1	8.5e-23
WP_000042038.1|910456_910894_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_000746343.1|911018_911969_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_001310277.1|911946_912255_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_103215967.1|912855_915144_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	97.7	0.0e+00
WP_103215968.1|915133_915409_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.5e-44
WP_001113264.1|915405_915630_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277898.1|915632_915932_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557703.1|915931_916156_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217684.1|916219_916720_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_001389237.1|916897_917254_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001389238.1|917362_917662_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023390.1|917755_918751_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|918782_919580_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_001190359.1|919661_920252_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242678.1|920351_921260_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918502.1|921260_922691_-	amino acid permease	NA	NA	NA	NA	NA
921281:921296	attR	GCGCCAGCAGCGGGAA	NA	NA	NA	NA
WP_000109295.1|922900_924049_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|924362_924989_+	hydrolase	NA	NA	NA	NA	NA
WP_103215969.1|925023_925887_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|925888_926506_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000886683.1|929199_930492_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067748.1|930582_931926_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	3.6e-80
WP_001295343.1|931936_932548_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077024.1|932702_936770_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|936904_937399_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537403.1|937942_938908_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043579.1|939030_940797_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202216.1|940797_942519_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001241678.1|942560_943265_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|943549_943768_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|944692_946969_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|946999_947320_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 8
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	982269	1014924	5103533	plate,portal,tail,terminase,lysis,integrase,head,capsid	Salmonella_phage(79.07%)	44	982179:982192	1014999:1015012
982179:982192	attL	ATGGGTTTTTTGTT	NA	NA	NA	NA
WP_000972391.1|982269_982488_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_059241733.1|982578_983679_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	6.5e-176
WP_000980413.1|983675_984161_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_059241730.1|984157_987235_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000763311.1|987227_987347_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281004.1|987361_987664_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
WP_001207660.1|987718_988234_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046141.1|988243_989416_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_000905031.1|989558_990125_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	2.9e-87
WP_021542077.1|990155_990674_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	4.1e-56
WP_059241727.1|990673_991276_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	2.0e-99
WP_021542075.1|991247_991691_-|tail	phage tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	94.6	1.0e-79
WP_103215972.1|991711_993133_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	66.6	5.8e-169
WP_001086844.1|993129_993735_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	9.8e-110
WP_001608132.1|993727_994636_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	9.2e-144
WP_000177590.1|994622_994982_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993775.1|994978_995557_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000829141.1|995625_996072_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_001608130.1|996064_996496_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	8.4e-71
WP_001337513.1|996591_997020_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_059241725.1|997016_997394_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_001442491.1|997395_997869_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|997888_998104_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868192.1|998107_998311_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_103215973.1|998310_998775_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000059191.1|998870_999521_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742511.1|999524_1000583_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216238.1|1000599_1001433_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_001547632.1|1001575_1003342_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_001547633.1|1003341_1004400_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.1	9.6e-169
WP_001547634.1|1004403_1004766_+	hypothetical protein	NA	B2ZY70	Ralstonia_phage	43.0	8.7e-13
WP_001217575.1|1007125_1007359_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|1007369_1007558_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_059241718.1|1007711_1010126_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.4	0.0e+00
WP_000104157.1|1010122_1010980_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_000752613.1|1010976_1011204_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244216.1|1011203_1011437_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_001352070.1|1011504_1011846_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_000956182.1|1011809_1012010_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460891.1|1012017_1012527_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001247707.1|1012559_1012781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047320.1|1012906_1013476_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001513672.1|1013491_1013683_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290937.1|1013871_1014924_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
1014999:1015012	attR	ATGGGTTTTTTGTT	NA	NA	NA	NA
>prophage 9
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	1545583	1641831	5103533	protease,holin,transposase	Escherichia_phage(22.22%)	92	NA	NA
WP_014386491.1|1545583_1546564_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_001335745.1|1548651_1549239_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|1549252_1550725_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|1550738_1552409_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_024246162.1|1553794_1553980_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000860996.1|1554251_1554878_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|1554968_1555700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192349.1|1557353_1558400_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_001549021.1|1558508_1559441_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|1559427_1560831_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000213416.1|1561105_1562317_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_001013515.1|1562386_1563400_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	1.2e-43
WP_000044263.1|1563396_1564347_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.0	4.0e-33
WP_000184938.1|1564343_1565153_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000222149.1|1565162_1566029_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000543445.1|1566057_1567011_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001189111.1|1569495_1571004_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000227970.1|1571545_1572622_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000342159.1|1572844_1574143_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.6	2.3e-47
WP_001247776.1|1574469_1574733_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001549018.1|1574747_1575011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643628.1|1575239_1575521_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350435.1|1575555_1576125_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_016239833.1|1576230_1579113_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.2e-128
WP_001295707.1|1579112_1579304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061301063.1|1579364_1581092_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	37.5	9.7e-86
WP_001275372.1|1581179_1581638_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_016239830.1|1581660_1582575_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_016239829.1|1582677_1583565_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001090783.1|1583661_1584273_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_001723515.1|1584352_1585498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786816.1|1585487_1585928_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	4.5e-11
WP_061301064.1|1585931_1587647_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000843382.1|1587643_1588141_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_000196689.1|1588118_1589084_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000323729.1|1589108_1590260_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
WP_001065555.1|1592175_1593039_+	GTPase family protein	NA	NA	NA	NA	NA
WP_060616110.1|1594166_1594868_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001144031.1|1594908_1595145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649865.1|1595144_1595588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001385283.1|1595610_1596078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194654.1|1596154_1596394_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000211838.1|1596491_1596950_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_001549015.1|1596965_1597442_+	RadC family protein	NA	NA	NA	NA	NA
WP_000691994.1|1597450_1597672_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000070396.1|1597690_1598008_+	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000854680.1|1598028_1598370_+	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_085947771.1|1598476_1599639_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_023135683.1|1601966_1602983_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001333214.1|1604658_1605078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158649776.1|1605582_1605759_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	60.0	4.8e-09
WP_011787758.1|1605760_1607371_-|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
WP_103215985.1|1607495_1608122_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	36.0	1.2e-20
WP_000905043.1|1608182_1608737_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	86.7	1.4e-86
WP_001067855.1|1608955_1609660_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001572362.1|1610088_1611111_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|1612158_1612488_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	43.1	3.1e-17
WP_000780222.1|1612468_1612750_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_032655735.1|1612875_1613856_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	97.5	5.4e-182
WP_016239722.1|1614049_1614697_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_016239723.1|1614816_1616115_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|1616194_1616287_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_032654819.1|1616299_1617436_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_084832034.1|1618261_1618639_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008325050.1|1618944_1619556_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_032654816.1|1619960_1620167_-	AlpA family phage regulatory protein	NA	A0A1V0E888	Vibrio_phage	40.7	8.5e-05
WP_032654813.1|1620616_1621543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001548935.1|1621649_1622513_+	GTPase family protein	NA	NA	NA	NA	NA
WP_032654809.1|1622604_1623426_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	6.1e-46
WP_032654806.1|1623643_1624345_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001115854.1|1624381_1624618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547764.1|1624617_1625061_+	phage transcriptional regulator	NA	NA	NA	NA	NA
WP_001547765.1|1625083_1625551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194654.1|1625627_1625867_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000211838.1|1625964_1626423_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000811693.1|1626438_1626915_+	RadC family protein	NA	NA	NA	NA	NA
WP_008324517.1|1626923_1627151_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_008324516.1|1627163_1627481_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_008324514.1|1627501_1627843_+	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000893260.1|1628414_1629668_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_001285288.1|1629679_1630783_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|1631070_1632126_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174677.1|1632164_1632566_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|1632623_1633868_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|1633959_1634418_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292997.1|1634678_1636136_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001295202.1|1636492_1636759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059881.1|1637065_1637518_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226182.1|1637514_1638570_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_032140409.1|1638640_1639411_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001325255.1|1639370_1641110_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006260.1|1641333_1641831_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	1660751	1672868	5103533	transposase	Erysipelothrix_phage(50.0%)	7	NA	NA
WP_001201739.1|1660751_1661135_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|1661131_1661479_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_021553945.1|1661528_1663064_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.9	2.4e-261
WP_032191941.1|1663695_1666728_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	43.3	6.1e-216
WP_060643360.1|1666735_1668694_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	42.2	1.8e-128
WP_060617909.1|1668754_1669609_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_060617908.1|1669601_1672868_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B253	Erysipelothrix_phage	45.1	4.2e-263
>prophage 11
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	2005115	2047466	5103533	tRNA,integrase,transposase	Escherichia_phage(20.0%)	33	2017790:2017808	2026262:2026280
WP_001118619.1|2005115_2006039_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_001101446.1|2006357_2007383_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103215994.1|2007414_2007969_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.7	2.5e-43
WP_088765672.1|2011986_2013260_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001295734.1|2013505_2014222_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_001548973.1|2014241_2014811_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
2017790:2017808	attL	CGAAGGCCGGACTCGAACC	NA	NA	NA	NA
WP_045353130.1|2018298_2018763_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045353128.1|2019635_2020196_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	37.6	1.8e-20
WP_103215995.1|2020387_2020855_+	DUF1643 domain-containing protein	NA	A0A1V0EBT6	Caulobacter_phage	39.8	2.0e-25
WP_103215996.1|2021010_2022027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146145718.1|2022415_2022913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215998.1|2022991_2023564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215999.1|2024254_2026165_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001300770.1|2026535_2027555_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
2026262:2026280	attR	CGAAGGCCGGACTCGAACC	NA	NA	NA	NA
WP_001324723.1|2027684_2029187_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	6.1e-84
WP_001295681.1|2029347_2030430_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584117.1|2030429_2031530_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|2031796_2033308_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_001188289.1|2033402_2033885_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416390.1|2033884_2036740_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	2.1e-141
WP_000079656.1|2036795_2037992_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059394.1|2038184_2038688_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|2038733_2039150_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012919.1|2039311_2040316_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000583470.1|2042157_2042610_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000256656.1|2042754_2043348_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500734.1|2043418_2044132_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|2044262_2044658_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|2044938_2045073_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|2045076_2046012_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2046024_2046486_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047543.1|2046558_2046945_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_001118333.1|2047010_2047466_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	2110962	2174152	5103533	tRNA,protease,integrase,transposase	Vibrio_phage(14.29%)	57	2172675:2172692	2179947:2179964
WP_000811566.1|2110962_2111238_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001548965.1|2111354_2112980_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943962.1|2113063_2114227_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.8e-80
WP_000101671.1|2114229_2114868_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|2114877_2115276_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012947.1|2115293_2115953_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511959.1|2116003_2116705_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_001412128.1|2118091_2119687_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_023135683.1|2120811_2121828_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000842398.1|2122271_2123165_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_088765672.1|2123522_2124795_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000400401.1|2124829_2125609_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001293282.1|2125685_2126417_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076313.1|2126596_2129038_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
WP_001177643.1|2129076_2129502_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2129706_2131005_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|2131108_2131306_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2131387_2132392_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2132394_2133654_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2133739_2135020_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2135096_2135405_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|2135490_2136441_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122503.1|2136433_2138281_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990333.1|2138290_2139628_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|2139646_2140108_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001325483.1|2140079_2141627_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001325482.1|2141625_2142765_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|2142747_2142801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|2143664_2144210_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|2144304_2145357_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|2145453_2146422_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236847.1|2146443_2149767_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001339478.1|2149917_2151420_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004770.1|2151638_2152616_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
WP_001192973.1|2152940_2154749_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|2154741_2155476_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|2155486_2155882_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|2155892_2156252_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001295185.1|2156314_2157448_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238371.1|2157536_2158070_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.1e-47
WP_000118482.1|2158066_2158384_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|2158559_2158706_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|2158816_2158942_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|2158993_2159560_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940548.1|2159601_2160630_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008046.1|2161024_2161894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|2162086_2162440_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|2162577_2164224_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2164267_2164561_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015852.1|2164836_2166093_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_103216002.1|2166108_2166585_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_001385092.1|2166921_2168358_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|2168475_2169777_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|2169892_2170231_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068974.1|2170206_2171904_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|2171940_2172516_+	transcriptional regulator	NA	NA	NA	NA	NA
2172675:2172692	attL	GTTCGATTCCGAGTCCGG	NA	NA	NA	NA
WP_016240326.1|2172880_2174152_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	36.3	5.3e-73
WP_016240326.1|2172880_2174152_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	36.3	5.3e-73
2179947:2179964	attR	GTTCGATTCCGAGTCCGG	NA	NA	NA	NA
>prophage 13
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	2419099	2496580	5103533	plate,portal,tRNA,tail,terminase,integrase,protease,holin,head,capsid	Salmonella_phage(74.36%)	86	2434996:2435040	2467414:2467458
WP_000208242.1|2419099_2419630_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|2419639_2420971_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2421037_2421964_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2422056_2422542_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2422626_2422872_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2423296_2424142_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|2424164_2425673_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|2425807_2426818_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|2426914_2427661_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|2427665_2428094_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|2428120_2428420_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|2428631_2429072_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|2429172_2429772_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|2429879_2430647_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|2430701_2431457_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045689.1|2431562_2432552_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|2432871_2433834_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|2434014_2434917_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2434996:2435040	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_044597462.1|2435153_2435801_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_001229865.1|2435797_2436130_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001251454.1|2436231_2436474_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_103216005.1|2436522_2437641_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	98.9	1.2e-190
WP_103216006.1|2437798_2438992_+|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	94.0	1.7e-214
WP_001207579.1|2439004_2439520_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	95.9	3.9e-91
WP_000047593.1|2439534_2439870_+	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
WP_000763324.1|2439878_2439995_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_044597459.1|2439995_2443166_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	74.2	0.0e+00
WP_023276958.1|2443176_2443626_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	92.6	2.2e-74
WP_103216007.1|2444029_2444380_+|tail	phage tail protein	tail	E5G6P1	Salmonella_phage	43.9	6.7e-10
WP_103216008.1|2444351_2444786_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	59.9	8.8e-44
WP_103216009.1|2446191_2446800_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	82.5	2.1e-96
WP_029404344.1|2446792_2447704_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	98.7	2.2e-161
WP_103216010.1|2447700_2448063_-|plate	baseplate assembly protein	plate	A0A0M4S6L5	Salmonella_phage	99.2	9.5e-60
WP_103216011.1|2448059_2448689_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	96.7	1.0e-109
WP_087855248.1|2448846_2449491_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	97.7	4.4e-116
WP_000917105.1|2449451_2449946_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
WP_084832537.1|2449945_2450479_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	94.3	1.8e-43
WP_103216012.1|2450580_2451021_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	95.9	3.4e-75
WP_000543937.1|2451004_2451340_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	98.2	2.1e-53
WP_001102549.1|2451350_2451551_-|tail	tail protein	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_016246752.1|2451550_2452039_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	97.5	5.2e-85
WP_044597455.1|2452141_2452990_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	97.5	1.4e-133
WP_001246221.1|2453032_2454079_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	98.8	9.1e-196
WP_103216099.1|2454119_2454965_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	97.5	1.2e-153
WP_001090183.1|2455118_2456831_+|terminase	terminase	terminase	A0A0M4S6K7	Salmonella_phage	98.4	0.0e+00
WP_000014576.1|2456831_2457881_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_001514720.1|2458290_2458596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514719.1|2458802_2459312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216013.1|2459278_2461888_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	41.9	8.0e-140
WP_103216014.1|2461884_2462193_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	67.1	4.8e-28
WP_103216015.1|2463103_2463676_-	3'-5' exoribonuclease	NA	NA	NA	NA	NA
WP_063922348.1|2463745_2464138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063922349.1|2464223_2464406_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_063922350.1|2464405_2464837_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	90.3	3.1e-65
WP_058651666.1|2464923_2465151_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	68.0	9.6e-26
WP_001514707.1|2465326_2465530_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	66.2	1.9e-17
WP_000136421.1|2465542_2465824_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	96.8	3.4e-49
WP_016246740.1|2465935_2466256_+	transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	84.9	2.9e-44
WP_016246739.1|2466325_2467306_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	98.8	2.1e-186
WP_001223800.1|2467483_2467984_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2467414:2467458	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_001033722.1|2468133_2468832_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580429.1|2468828_2470202_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	2.9e-16
WP_001270260.1|2470307_2470982_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166064.1|2471130_2472114_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2472373_2472994_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_000063517.1|2473278_2474313_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001325198.1|2474309_2475248_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217152.1|2475231_2476068_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144032.1|2476355_2477825_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_000211496.1|2477821_2479081_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179746.1|2479322_2480147_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619493.1|2480156_2480471_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000729597.1|2480771_2481218_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000446022.1|2481228_2482680_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001019469.1|2482669_2483740_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000931300.1|2483739_2485488_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001325193.1|2485537_2486593_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000753617.1|2486745_2487579_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077628414.1|2487772_2490823_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|2490835_2491738_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|2491734_2492370_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027705.1|2492366_2493296_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001086388.1|2493625_2493868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|2494085_2494304_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297068.1|2495156_2496098_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|2496142_2496580_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	2763036	2777509	5103533	transposase	Morganella_phage(25.0%)	12	NA	NA
WP_001411731.1|2763036_2763861_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	2.8e-91
WP_000214207.1|2764397_2765162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240294.1|2765331_2765619_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188904.1|2765850_2766042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016239903.1|2766138_2767674_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	1.6e-260
WP_000609174.1|2767723_2768071_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|2768067_2768451_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_001236873.1|2768739_2768925_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_016231257.1|2769919_2770357_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_001029843.1|2770418_2772524_-	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	3.6e-90
WP_016240293.1|2772523_2773990_-	hypothetical protein	NA	B6SCW4	Bacteriophage	51.5	3.7e-110
WP_001244106.1|2774752_2777509_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
>prophage 15
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	3371473	3422798	5103533	tRNA,integrase,transposase	Escherichia_phage(25.0%)	40	3389593:3389607	3417646:3417660
WP_000156884.1|3371473_3372496_-|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_000187442.1|3373481_3374894_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_001199352.1|3374908_3376396_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_000128137.1|3376478_3377030_+	YgjV family protein	NA	NA	NA	NA	NA
WP_000211655.1|3377034_3378279_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098805.1|3378894_3379860_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
WP_001301393.1|3380142_3381129_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001183040.1|3381207_3381891_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_001295542.1|3381967_3382471_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000018697.1|3382556_3383693_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000550189.1|3383977_3384292_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_000560266.1|3384288_3384705_+	type II toxin-antitoxin system antitoxin HigA	NA	NA	NA	NA	NA
WP_000121421.1|3384749_3386768_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000695498.1|3387293_3389645_-	alpha-glucosidase	NA	NA	NA	NA	NA
3389593:3389607	attL	AAACTTATCAGCAGA	NA	NA	NA	NA
WP_000767654.1|3389661_3390732_-	protein YgjJ	NA	NA	NA	NA	NA
WP_001285463.1|3390865_3392299_-	amino acid permease	NA	NA	NA	NA	NA
WP_001219954.1|3392361_3392811_-	beta-galactosidase subunit beta	NA	NA	NA	NA	NA
WP_001082931.1|3392807_3395900_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	3.4e-158
WP_000212445.1|3396083_3397067_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|3397285_3397618_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627220.1|3397659_3399150_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000094682.1|3399456_3400977_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018003.1|3401130_3401754_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001066492.1|3402041_3402806_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_103216024.1|3403103_3404420_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.5	1.2e-35
WP_094935882.1|3404705_3404852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089561931.1|3405032_3406043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016243847.1|3406162_3406399_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_097724947.1|3406533_3407955_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_089561933.1|3408080_3408707_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001395480.1|3409050_3410082_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_097724984.1|3411046_3411823_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_097724985.1|3411819_3412488_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	1.7e-09
WP_103216025.1|3412642_3413623_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	4.9e-183
WP_103216026.1|3413715_3417192_+	HAD-IA family hydrolase	NA	A0A1P8DJK6	Virus_Rctr41k	26.7	7.1e-11
WP_103216027.1|3417255_3418338_+	hypothetical protein	NA	NA	NA	NA	NA
3417646:3417660	attR	TCTGCTGATAAGTTT	NA	NA	NA	NA
WP_001395480.1|3418421_3419453_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_103216028.1|3419433_3419949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103216029.1|3419965_3421063_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_011787758.1|3421187_3422798_+|transposase	IS1634-like element ISSpu7 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	3523810	3564626	5103533	tRNA,protease,integrase,transposase	Escherichia_phage(42.86%)	41	3518469:3518492	3566441:3566464
3518469:3518492	attL	TTGCCGGATGCGGCGTGAATGCCT	NA	NA	NA	NA
WP_103216034.1|3523810_3524749_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	4.5e-170
WP_001067855.1|3524754_3525459_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_103216035.1|3525483_3526701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|3528041_3529550_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_077896851.1|3529858_3530230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103216036.1|3531225_3531774_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_023135683.1|3531882_3532899_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_103216037.1|3532952_3534122_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_103216038.1|3535232_3536486_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.6	2.4e-78
WP_016240318.1|3537047_3537251_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.6	8.0e-08
WP_016240319.1|3537276_3537534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240320.1|3537530_3538388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240321.1|3538701_3539406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240322.1|3539983_3540274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240323.1|3540277_3540667_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_061300985.1|3540647_3542126_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_016240325.1|3542166_3542490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240326.1|3542498_3543770_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	36.3	5.3e-73
WP_000234514.1|3544133_3544841_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001049791.1|3547410_3548667_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000760323.1|3548868_3549948_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|3550012_3550288_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001325558.1|3550315_3551368_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|3551528_3552248_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|3552247_3552574_+	YggL family protein	NA	NA	NA	NA	NA
WP_001178593.1|3552596_3552737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000984796.1|3552757_3553477_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394125.1|3553652_3554699_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745244.1|3554815_3555823_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239924.1|3555977_3557114_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174743.1|3557106_3557700_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|3557707_3557998_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|3557994_3558561_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|3558578_3559283_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001295381.1|3559300_3560281_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017106.1|3560464_3560881_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|3560880_3561444_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|3561552_3562503_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001488326.1|3562515_3563247_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286510.1|3563326_3564034_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|3564128_3564626_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
3566441:3566464	attR	TTGCCGGATGCGGCGTGAATGCCT	NA	NA	NA	NA
>prophage 17
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	3789178	3802361	5103533		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|3789178_3789940_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3789933_3790560_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|3790699_3791839_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3791901_3792894_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104466.1|3792987_3794352_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136936.1|3794440_3795217_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|3795221_3795860_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590398.1|3795856_3797119_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3797115_3798024_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|3798219_3798987_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141341.1|3799037_3799694_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	45.3	5.2e-48
WP_001272924.1|3799799_3802361_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 18
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	3839261	3896265	5103533	tRNA,integrase,transposase	Escherichia_phage(23.08%)	47	3884506:3884565	3898458:3899506
WP_000047170.1|3839261_3841892_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|3842126_3842312_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273290.1|3843769_3844336_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287454.1|3844332_3844761_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|3844833_3846390_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130211.1|3846539_3847055_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|3847118_3848657_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|3848673_3849846_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|3849972_3850503_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119750.1|3850593_3850929_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|3850918_3851656_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000165699.1|3851779_3852964_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216527.1|3853255_3854248_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774996.1|3854305_3855370_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985499.1|3855362_3856565_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	3.8e-28
WP_000777969.1|3856919_3857879_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246516.1|3857888_3860033_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.2e-196
WP_000080947.1|3860005_3860416_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|3860412_3860658_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|3860905_3861235_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|3861386_3861731_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|3861767_3862217_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|3862885_3863290_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229442.1|3863336_3863861_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|3863870_3864170_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|3864352_3864511_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522415.1|3864594_3865044_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|3865044_3865707_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|3865727_3867128_-	GABA permease	NA	NA	NA	NA	NA
WP_000097662.1|3867365_3868646_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_000772876.1|3868659_3870108_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271943.1|3870130_3871399_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001295172.1|3871418_3872396_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000156884.1|3872631_3873654_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_023135683.1|3874836_3875853_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_158649778.1|3879707_3879857_+	DUF5507 domain-containing protein	NA	NA	NA	NA	NA
WP_072097107.1|3881557_3881767_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	68.1	1.3e-08
WP_001120794.1|3881921_3882041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|3883209_3884235_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
3884506:3884565	attL	TGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGTATCTTCCCGACAACGCA	NA	NA	NA	NA
WP_001118619.1|3884574_3885498_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_023135683.1|3885626_3886643_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001549564.1|3890938_3891469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549563.1|3891479_3892820_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_023063216.1|3893115_3893961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549561.1|3894237_3894444_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001549560.1|3894465_3894780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549559.1|3895062_3896265_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3898458:3899506	attR	TGCGTTGTCGGGAAGATACGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCATTTTTTTCTTCAAGTAGATGCCAGAGTCAGAATTCAGGATTCCCTTGCAATCAATGTATATTTTTTATTCCGATTGATCGCAGTGAGGTGAATCAACTATGAATAATATTATTTTGTTCAAATCAAAAAAACATATTCTTGTAGAAGAAAATTATAATGAGTTCATAAAATTTTGTCGCTATCAACTGTCCGGACTAACCCAAACTCAGGATTGGGAGCAGTATGCCTGGAAAGGATATGTCACATTTAGAAAAATAGGGATTGGAAATAAAATCTTTGATTCCATTGATGCAATGCACGAAGATTATATCAATTTTGCGAAAGCATATATCAGATATCAACACACATTGAAACCATTAAAAAATTATGGGGTTATTATGATGGCCTTGCGATGTCTCGAACAGGCCCTTTTGCAGGTTCAGAACACTGGTCTCATTTATAATGTTACAGCCGTTGTTTTCGATGAGGCAATGCAGATCGGGAGTAAATATTTTGAAGGTAACGTTTTGGCTAAATGTGGAATACAGCTTGAAAAAATATCAAAGTTTCTGTGTGAACATAATCTTGTGAAGTCAGGATATATCTCATGGAAAAACCATGTAAAACAGAAAGTCAAAAACAATTATCTTCCTGAGATTGAGGATTATCACCGAAGCGATAAGTTACCAGATGAAGAAGCATTGCTCGCTATTGCTGATATTTTTTCTCAAAATGATGAGTTACTGAGTCCAAGGGATAAGTTCACCAGTTCAGTATTTGCACTTCTACTTTGTTGTCCGAGCAGAATTTCTGAAATTTTAGCCTTACCTGCTGATTGTGAGATTACACAAATAGATGGCAAGGGTATCGAAAGATATGGTTTGAGATTTTATTCGGTAAAAGGGTATGGCCCTAATATCAAATGGATTCCACGGGTTATGATACCAGTTGCAAAGAAAGCGATTAGAAGATTACTTTCCTTATCACAAAATGCAAGAGCA	NA	NA	NA	NA
>prophage 19
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	4009880	4087108	5103533	portal,tRNA,tail,terminase,protease,integrase,head,capsid	Escherichia_phage(20.75%)	84	4021863:4021878	4093418:4093433
WP_000940019.1|4009880_4010621_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_001241357.1|4010890_4011379_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_001295373.1|4011490_4012705_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4012732_4013119_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4013135_4013459_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|4013554_4014070_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|4014086_4015937_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|4015938_4016274_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4016285_4016486_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_016240191.1|4016663_4017947_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
WP_016240190.1|4018088_4018865_+	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_000108637.1|4019358_4020204_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_016240189.1|4020410_4025372_+	alpha2-macroglobulin	NA	NA	NA	NA	NA
4021863:4021878	attL	GAGCGTATGGCGCTGA	NA	NA	NA	NA
WP_016240188.1|4025372_4027685_+	peptidoglycan glycosyltransferase PbpC	NA	NA	NA	NA	NA
WP_000963837.1|4027833_4028265_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
WP_000003317.1|4028414_4029569_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_001090850.1|4029853_4030867_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_016240187.1|4030893_4032012_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001107167.1|4032122_4033397_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001400819.1|4033414_4034035_+	YfgM family protein	NA	NA	NA	NA	NA
WP_001177048.1|4034045_4035224_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_000249410.1|4035341_4036814_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_001295478.1|4036883_4037099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240186.1|4037095_4038466_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.8	4.0e-42
WP_001299507.1|4038627_4040094_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|4040162_4041740_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755178.1|4041832_4042372_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000669412.1|4042387_4042903_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001344399.1|4043216_4043390_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000772728.1|4043759_4046003_+	cyclic-guanylate-specific phosphodiesterase PdeF	NA	NA	NA	NA	NA
WP_001515577.1|4046168_4046489_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	74.5	4.6e-42
WP_158649780.1|4046858_4047470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103216046.1|4047540_4047801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216047.1|4047793_4050352_-	hypothetical protein	NA	U5PSK6	Bacillus_phage	47.2	2.0e-34
WP_103216048.1|4050405_4053495_-	kinase	NA	A0A286S259	Klebsiella_phage	52.6	1.4e-305
WP_103216049.1|4053491_4053872_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	74.6	9.1e-53
WP_158649781.1|4053905_4054076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216050.1|4054079_4054634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216051.1|4054689_4055178_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	68.2	1.0e-56
WP_103216052.1|4055174_4055642_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	58.3	9.8e-49
WP_103216053.1|4055646_4059114_-	tape measure protein	NA	A0A2H4JHR1	uncultured_Caudovirales_phage	82.7	3.1e-248
WP_097476808.1|4059203_4059623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097476807.1|4059643_4059922_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	2.4e-42
WP_097476806.1|4059930_4060314_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	92.9	2.2e-62
WP_016240213.1|4060322_4060766_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	92.4	3.9e-71
WP_032665935.1|4060825_4061173_-	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	96.5	5.5e-57
WP_094158644.1|4061169_4061619_-	HK97 gp10 family phage protein	NA	K7PH04	Enterobacteria_phage	94.6	1.8e-71
WP_016240216.1|4061615_4061954_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	2.7e-40
WP_094158645.1|4061962_4062283_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	44.1	6.3e-15
WP_101361124.1|4062279_4062510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216054.1|4062548_4063757_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	82.2	5.8e-186
WP_016240219.1|4063770_4064424_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.0	3.5e-105
WP_016240220.1|4064410_4065640_-|portal	phage portal protein	portal	U5P411	Shigella_phage	82.9	3.3e-205
WP_008323320.1|4065639_4065825_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.6	2.9e-12
WP_094158650.1|4065835_4067593_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	89.6	0.0e+00
WP_094158651.1|4067592_4068090_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	73.3	6.3e-62
WP_103216055.1|4068479_4068830_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	81.6	1.2e-51
WP_052948722.1|4068986_4069880_-	trypsin-like peptidase domain-containing protein	NA	S5FV10	Shigella_phage	70.7	8.3e-73
WP_047742162.1|4069946_4070174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216056.1|4070261_4070777_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	89.5	1.7e-78
WP_103216057.1|4070773_4071310_-	lysozyme	NA	K7PM52	Enterobacteria_phage	90.8	4.1e-91
WP_052119548.1|4071309_4071612_-	hypothetical protein	NA	O64361	Escherichia_phage	67.3	1.8e-32
WP_103216058.1|4071680_4072733_-	DNA adenine methylase	NA	A5LH81	Enterobacteria_phage	81.7	1.5e-174
WP_103216059.1|4073059_4073539_+	hypothetical protein	NA	F1C594	Cronobacter_phage	55.7	5.9e-41
WP_103216060.1|4073660_4074353_-	antitermination protein	NA	NA	NA	NA	NA
WP_103216061.1|4074374_4075436_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.7	1.7e-112
WP_103216062.1|4075480_4076125_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	56.4	1.5e-55
WP_103216063.1|4076215_4077550_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	51.0	7.5e-118
WP_016240139.1|4077546_4078401_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	82.2	1.5e-55
WP_071840634.1|4078390_4078570_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	7.3e-13
WP_016240141.1|4078745_4079309_-	hypothetical protein	NA	S5FXP0	Shigella_phage	27.1	6.5e-07
WP_024195799.1|4079340_4079598_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	41.1	3.5e-08
WP_032140310.1|4079667_4080387_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	34.7	1.8e-25
WP_016240143.1|4080631_4080997_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	51.6	9.7e-12
WP_001704144.1|4081339_4082257_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.0	1.7e-105
WP_001515610.1|4082365_4082905_+	phage protein	NA	A0A192Y8M4	Salmonella_phage	69.3	5.9e-66
WP_001515612.1|4083065_4083320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515613.1|4083316_4083634_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	61.2	2.1e-34
WP_016240144.1|4083630_4083987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240145.1|4083979_4084249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240147.1|4084673_4084913_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	59.4	3.0e-14
WP_016240149.1|4085091_4085664_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	83.0	2.1e-93
WP_001515618.1|4085708_4085918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048993903.1|4085920_4087108_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.0	1.9e-32
4093418:4093433	attR	GAGCGTATGGCGCTGA	NA	NA	NA	NA
>prophage 20
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	4478672	4488113	5103533		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569358.1|4478672_4479599_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783117.1|4479603_4480335_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4480315_4480423_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4480482_4481214_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001445970.1|4481435_4483121_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|4483117_4483837_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|4483883_4484354_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001445971.1|4484393_4484855_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	4.1e-76
WP_103216071.1|4484979_4486980_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001292766.1|4486976_4488113_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 21
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	4624647	4681891	5103533	integrase,transposase	Shigella_phage(18.18%)	34	4639683:4639742	4682081:4682169
WP_103216080.1|4624647_4625920_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	5.7e-176
WP_077769291.1|4625891_4626350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|4626400_4627552_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_077255487.1|4627960_4628137_+|transposase	transposase	transposase	Q76S41	Shigella_phage	63.5	3.9e-11
WP_028016388.1|4628146_4629115_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000973176.1|4632033_4632579_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|4632575_4633319_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193786.1|4633330_4634410_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986331.1|4634471_4635407_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011466.1|4635863_4636781_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011013.1|4636882_4637833_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000943916.1|4637950_4639594_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
4639683:4639742	attL	CGTTCTCACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTC	NA	NA	NA	NA
WP_016240038.1|4640226_4640943_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|4641285_4642740_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378584.1|4642841_4644158_-	shikimate transporter	NA	NA	NA	NA	NA
WP_016240037.1|4644472_4645543_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001295635.1|4645670_4646318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000646558.1|4646366_4647629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000039778.1|4647761_4648511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000784549.1|4649160_4651182_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_016240036.1|4651312_4652890_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_000194283.1|4652893_4653697_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_000982873.1|4653693_4654794_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_000369524.1|4654790_4664282_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
WP_103216081.1|4664369_4670477_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_000140405.1|4670667_4671627_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000098396.1|4671793_4673596_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	8.5e-32
WP_016240034.1|4673582_4675385_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001764637.1|4675377_4676658_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703040.1|4676685_4677990_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001201739.1|4678191_4678575_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|4678571_4678919_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_016239903.1|4678968_4680504_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	1.6e-260
WP_024165620.1|4680628_4681891_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	3.1e-73
4682081:4682169	attR	GACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAATCGTGAGAACGGGGTGCATATTACTTAGCGGTACCTTGTC	NA	NA	NA	NA
>prophage 22
NZ_CP026202	Escherichia coli strain ECONIH5 chromosome, complete genome	5103533	4746275	4805799	5103533	tRNA,transposase	Escherichia_phage(23.53%)	55	NA	NA
WP_001118619.1|4746275_4747199_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_001295647.1|4747549_4747900_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|4747902_4748481_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906340.1|4748607_4749495_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795630.1|4749491_4750418_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001300654.1|4750422_4752387_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|4752407_4752911_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016243616.1|4753055_4754717_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
WP_000483221.1|4754762_4756364_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_000204335.1|4756382_4757243_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|4757245_4758295_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|4758309_4758699_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983609.1|4758709_4759354_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278936.1|4759555_4760704_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066983.1|4760696_4762775_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001259584.1|4762774_4763167_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001299676.1|4763287_4763776_-	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001025326.1|4763952_4765686_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001295504.1|4765901_4766468_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185727.1|4766481_4767228_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_016240013.1|4767615_4768716_+	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
WP_016240012.1|4768740_4771170_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564750.1|4771334_4772306_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019585.1|4772302_4773046_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252980.1|4773086_4773482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639285.1|4773534_4774353_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.5e-71
WP_000891620.1|4774349_4774916_-	hydrolase	NA	NA	NA	NA	NA
WP_001258677.1|4775225_4776998_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|4777115_4777568_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907248.1|4777596_4778337_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|4778371_4778893_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_016240011.1|4778894_4779497_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072094247.1|4779567_4779633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|4779771_4780383_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|4780391_4781402_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|4781548_4782334_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|4782330_4783086_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|4783164_4784097_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|4784112_4785435_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|4785554_4786526_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_103216084.1|4786614_4787388_-	glycosyl hydrolase family 38	NA	NA	NA	NA	NA
WP_001118619.1|4787431_4788355_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_001548650.1|4788948_4790817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103216085.1|4790904_4791420_-	cymJ protein	NA	NA	NA	NA	NA
WP_001118619.1|4791589_4792513_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_103216086.1|4792579_4792780_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000741720.1|4793187_4794315_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
WP_001307257.1|4794397_4794886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240008.1|4794970_4795927_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016240007.1|4795945_4796983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240006.1|4797255_4798488_+	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077268341.1|4798732_4798909_+|transposase	transposase	transposase	Q76S41	Shigella_phage	63.5	5.2e-11
WP_028016388.1|4798918_4799887_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016240004.1|4802395_4803133_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001118619.1|4804875_4805799_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
>prophage 1
NZ_CP026208	Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence	298633	206933	243715	298633	integrase,transposase	Escherichia_phage(40.0%)	26	196015:196029	209236:209250
196015:196029	attL	AGGCCTGCGCCGCAT	NA	NA	NA	NA
WP_001062689.1|206933_208133_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_022652191.1|208446_208659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103216139.1|208835_209477_+	hypothetical protein	NA	NA	NA	NA	NA
209236:209250	attR	ATGCGGCGCAGGCCT	NA	NA	NA	NA
WP_022652192.1|209768_210842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652193.1|211369_211762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652194.1|212171_212402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063155.1|212554_213760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079911693.1|214766_215186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652195.1|215218_215422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652197.1|216648_216903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610398.1|216987_217299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227970.1|218169_219246_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_040115271.1|219778_221818_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	26.4	4.6e-26
WP_001067855.1|222958_223663_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_022631502.1|227603_227804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118616.1|228104_229028_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_004099052.1|229444_231637_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_004099051.1|231766_233050_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_009653212.1|233138_234572_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_023157975.1|234590_237038_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
WP_004197675.1|237151_238795_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
WP_004197678.1|238919_239486_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197671.1|239820_240099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009653207.1|240338_241736_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004143398.1|241924_242320_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_077253535.1|242368_243715_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP026203	Escherichia coli strain ECONIH5 plasmid pECO-a7e8, complete sequence	35036	1623	11960	35036	transposase	uncultured_Caudovirales_phage(33.33%)	9	NA	NA
WP_001445939.1|1623_2481_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.9	1.9e-45
WP_001118645.1|2623_3547_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_011787801.1|4571_6062_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_055329964.1|6096_6954_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.4	6.6e-67
WP_011787803.1|7044_7377_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_011787804.1|7494_8115_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787805.1|8284_8545_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011918375.1|8544_8856_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787830.1|8879_11960_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
>prophage 2
NZ_CP026203	Escherichia coli strain ECONIH5 plasmid pECO-a7e8, complete sequence	35036	26494	34604	35036	transposase,integrase	Escherichia_phage(66.67%)	8	18482:18494	27716:27728
18482:18494	attL	TATCGCTTTTGCC	NA	NA	NA	NA
WP_000015958.1|26494_27271_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|27328_27586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|28353_29220_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
27716:27728	attR	TATCGCTTTTGCC	NA	NA	NA	NA
WP_000339857.1|29540_29810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|30224_31430_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_012600007.1|31426_32404_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_094336931.1|32485_33187_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.5	2.2e-81
WP_001118615.1|33680_34604_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
>prophage 1
NZ_CP026206	Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence	191344	4348	56232	191344	protease,integrase,transposase	Escherichia_phage(28.57%)	55	46181:46196	57412:57427
WP_001067855.1|4348_5053_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001325018.1|5317_6463_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001446567.1|6459_7260_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
WP_000449980.1|7261_8200_+	MCE family protein	NA	NA	NA	NA	NA
WP_000948259.1|8199_8841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515737.1|9188_10466_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_032140505.1|11829_12912_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_001288432.1|13492_14926_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_005012528.1|14959_16174_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_061872725.1|16792_17497_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
WP_001087807.1|17597_17834_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277463.1|17830_18196_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000281123.1|18213_19896_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
WP_000522993.1|19934_20342_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732276.1|20369_20645_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294660.1|20660_21011_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_001166628.1|21082_21538_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001247892.1|21902_22193_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|22189_22591_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|22580_22937_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|23191_23506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000792636.1|23678_24212_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_023312637.1|24529_25234_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
WP_004178170.1|25490_25706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032722781.1|25710_25929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049004918.1|26046_26757_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_012457109.1|26753_27059_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_103216113.1|27071_29810_+	ATPase	NA	NA	NA	NA	NA
WP_049004920.1|29827_30535_+	Minor pilin of type IV secretion complex (VirB5)	NA	NA	NA	NA	NA
WP_061301039.1|30542_30785_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_061301038.1|30788_31862_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_049004922.1|32082_32766_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_141037838.1|32765_33671_+	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_061301116.1|33706_34957_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_061301117.1|34946_35972_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_061301118.1|35968_36376_+	Cag pathogenicity island protein Cag12	NA	NA	NA	NA	NA
WP_049004924.1|36402_36708_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_049004925.1|36741_37047_+	dpoa decarboxylase	NA	A0A248SL90	Klebsiella_phage	38.4	7.1e-08
WP_103216114.1|37824_39561_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061301051.1|39569_40319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998898.1|40356_40830_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	40.3	1.3e-19
WP_041460758.1|40886_41231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011998900.1|41269_41503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012815856.1|41543_42191_-	ParA family protein	NA	A0A219YB79	Aeromonas_phage	29.8	4.5e-20
WP_061301053.1|42309_43092_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_061301054.1|43491_43710_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_061301055.1|43711_44017_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_061301056.1|44034_44589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103216115.1|44867_46550_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.4	3.8e-10
46181:46196	attL	CCTGACGCTTTTCACC	NA	NA	NA	NA
WP_001067855.1|47105_47810_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001324683.1|48593_50654_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000133967.1|50646_52257_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000273850.1|52258_53761_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001324682.1|53753_55376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446199.1|55968_56232_-|transposase	transposase	transposase	A0A218MNG9	uncultured_virus	41.7	6.3e-05
57412:57427	attR	GGTGAAAAGCGTCAGG	NA	NA	NA	NA
>prophage 2
NZ_CP026206	Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence	191344	68856	176614	191344	integrase,lysis,transposase,tail	Escherichia_phage(34.09%)	106	154672:154731	184477:184589
WP_001067855.1|68856_69561_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000085084.1|69963_71355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103216116.1|71351_73430_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|73441_74146_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001198018.1|74731_75685_+	cation transporter	NA	NA	NA	NA	NA
WP_011977761.1|75796_76171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977760.1|76608_77190_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_016240364.1|77325_78015_+	VIT family protein	NA	NA	NA	NA	NA
WP_011977758.1|78157_78469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255487.1|78641_78818_+|transposase	transposase	transposase	Q76S41	Shigella_phage	63.5	3.9e-11
WP_028016388.1|78827_79796_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.1	3.6e-13
WP_050595088.1|82913_83225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001148851.1|83314_84400_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000217345.1|84433_85591_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_000135555.1|85587_86754_-	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	27.4	1.5e-18
WP_016240369.1|86812_88495_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_000741484.1|88538_90089_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.9e-80
WP_016240370.1|90203_90989_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	3.2e-36
WP_001087990.1|90988_91870_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	29.7	6.4e-25
WP_000069054.1|91881_92868_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000148344.1|93106_93703_-	HutD family protein	NA	NA	NA	NA	NA
WP_016240371.1|93699_95073_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_001294851.1|95313_96114_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_001515701.1|96267_97530_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_000058769.1|97526_98351_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_016240372.1|98582_99260_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_032624838.1|99305_100229_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	9.2e-176
WP_006796897.1|100854_101241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|101249_101441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240374.1|102187_103672_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	4.5e-31
WP_009309980.1|104077_104503_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004206782.1|104502_105774_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
WP_004206783.1|105852_106104_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_009309981.1|106157_106463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309982.1|107745_108717_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_000523812.1|108716_109883_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000200070.1|110633_111644_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_014386491.1|112666_113647_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_016240377.1|114635_115400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009483868.1|115412_115913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200907.1|116187_116436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240378.1|116432_117005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240379.1|117035_117530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009484305.1|117590_117794_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_009484306.1|117807_118038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|118231_118498_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_016240380.1|118485_118968_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004883460.1|119168_120572_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_004883463.1|120600_121233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000996655.1|121468_122869_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000974763.1|123103_124045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061872725.1|125380_126085_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
WP_001393986.1|126381_127839_-	trk system potassium uptake protein trkG	NA	NA	NA	NA	NA
WP_001228696.1|128035_128221_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000484485.1|128643_128808_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	7.9e-22
WP_000548514.1|128780_128972_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001395510.1|128982_129264_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763369.1|129362_129584_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	5.5e-34
WP_000111054.1|129580_129832_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	5.8e-32
WP_000748281.1|130130_130745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129736.1|131038_131377_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	6.4e-50
WP_000762732.1|131405_131834_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_000545741.1|131917_132085_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_073528074.1|132207_133131_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_001101446.1|133470_134496_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_103216117.1|134552_134783_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	9.1e-32
WP_103216118.1|134760_135831_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	7.4e-201
WP_000043177.1|135993_136470_+	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
WP_000928911.1|136774_137125_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000706606.1|137286_138945_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001243598.1|139190_139655_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_000156884.1|141190_142213_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_001084040.1|142592_144656_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000085085.1|144652_146044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|146703_147408_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_097455219.1|147432_147834_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	94.4	9.9e-58
WP_103216119.1|147837_148209_-	ParB N-terminal domain-containing protein	NA	A0A2I7RQE2	Vibrio_phage	54.1	7.5e-28
WP_061872725.1|148233_148938_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
WP_020806042.1|149422_149632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990392.1|149668_150088_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	31.4	1.8e-06
WP_000558568.1|150084_150396_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_000718520.1|150625_153634_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.6	0.0e+00
WP_001067855.1|153914_154619_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
154672:154731	attL	TTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAA	NA	NA	NA	NA
WP_000992320.1|155385_156309_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000488917.1|156474_157992_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000345204.1|158129_159500_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001515710.1|159499_160900_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	23.7	7.5e-12
WP_000851062.1|160929_161934_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001124949.1|163118_163340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949433.1|163914_164715_-	DsbA family protein	NA	NA	NA	NA	NA
WP_157921962.1|164828_164966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949432.1|165341_166035_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.8	3.7e-129
WP_000361404.1|166216_167239_-	helicase UvrD	NA	NA	NA	NA	NA
WP_001128475.1|167223_168786_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044765.1|168851_169268_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|169264_169495_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000493378.1|170056_170407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001375052.1|170549_171158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251351.1|171225_172008_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	7.1e-52
WP_000239529.1|172145_172421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|172414_173059_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_011251350.1|173287_174259_+	stable plasmid inheritance protein A	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000340829.1|174263_174656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251349.1|174660_175932_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000109071.1|175931_176369_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|176365_176614_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
184477:184589	attR	TTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGG	NA	NA	NA	NA
>prophage 1
NZ_CP026207	Escherichia coli strain ECONIH5 plasmid pECO-dc1b, complete sequence	202687	27781	60440	202687	transposase	Acidithiobacillus_phage(28.57%)	39	NA	NA
WP_103216132.1|27781_29347_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	36.6	1.1e-83
WP_103216133.1|29336_30077_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.8	1.4e-52
WP_000286591.1|30573_31035_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
WP_000062185.1|31037_31535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434071.1|32096_33029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280522.1|33102_34566_+	AAA family ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
WP_000277953.1|34721_35051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018404.1|35055_35448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000757530.1|35496_35691_+	DUF2997 domain-containing protein	NA	NA	NA	NA	NA
WP_000245299.1|35684_36683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706040.1|36690_37527_-|transposase	IS5-like element ISEc61 family transposase	transposase	NA	NA	NA	NA
WP_000262467.1|38092_38887_+	APH(3')-II family aminoglycoside O-phosphotransferase	NA	Q75ZG1	Hepacivirus	74.3	6.4e-109
WP_000349358.1|38913_39273_+	BLMT family bleomycin binding protein	NA	NA	NA	NA	NA
WP_019706001.1|39435_40383_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_016809943.1|40465_41614_+	cephalosporin-hydrolyzing class C beta-lactamase FOX-5	NA	NA	NA	NA	NA
WP_016809944.1|41938_43111_+	MFS transporter	NA	NA	NA	NA	NA
WP_016809945.1|43129_44092_+	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_019706001.1|44703_45651_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_012585400.1|46372_46621_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_001173919.1|46747_47323_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
WP_016808107.1|47815_47968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706040.1|48069_48906_+|transposase	IS5-like element ISEc61 family transposase	transposase	NA	NA	NA	NA
WP_000039129.1|49129_49477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988987.1|49473_49902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056203.1|50240_50459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001256128.1|50470_51040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435224.1|51042_51588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268395.1|51704_52643_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_000532167.1|52642_52840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096362.1|53077_53320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258027.1|53322_53685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000098292.1|53677_53890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194038.1|53949_54705_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.0	5.8e-59
WP_001274811.1|54719_56261_-|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	4.4e-130
WP_001050849.1|56505_57540_+	site-specific DNA-methyltransferase	NA	H8ZMF1	Synechococcus_phage	20.9	1.0e-05
WP_000058870.1|57553_58003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|57984_58296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151304.1|58469_59255_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_001207227.1|59258_60440_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
>prophage 2
NZ_CP026207	Escherichia coli strain ECONIH5 plasmid pECO-dc1b, complete sequence	202687	134355	161449	202687	integrase,transposase	Pandoravirus(25.0%)	26	145708:145767	160612:161473
WP_000427623.1|134355_135360_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|135438_138411_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|138413_138971_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|139276_140290_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001206356.1|140435_141227_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|141390_141738_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259032.1|141731_142571_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|142975_144517_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|144849_145506_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_000259031.1|145705_146545_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
145708:145767	attL	GGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCG	NA	NA	NA	NA
WP_000050481.1|146949_148491_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002008781.1|148756_149257_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000019304.1|149256_149826_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_048228299.1|149836_150442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|150428_151442_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|151587_152121_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000186237.1|152203_152836_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|152992_153340_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259032.1|153333_154173_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001389365.1|154347_155112_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|155288_155993_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|156442_157918_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|157973_158858_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|158941_159646_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004163135.1|159536_160496_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_000946487.1|160597_161449_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
160612:161473	attR	GGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACTCCTTCTTCGATGAGAGCCGGCGGCTAGACCCCGCCGGCGCTGTCACCGCGGCGATCGAAATGCTGCGAGTCGGATCAGACGTCGTGGATGTCGGACCGGCCGCCAGCCATCCGGACGCGAGGCCTGTATCGCCGGCCGATGAGATCAGACGTATTGCGCCGCTCTTAGACGCCCTGTCCGATCAGATGCACCGTGTTTCAATCGACAGCTTCCAACCGGAAACCCAGCGCTATGCGCTCAAGCGCGGCGTGGGCTACCTGAACGATATCCAAGGATTTCCTGACCCTGCGCTCTATCCCGATATTGCTGAGGCGGACTGCAGGCTGGTGGTTATGCACTCAGCGCAGCGGGATGGCATCGCCACCCGCACCGGTCACCTTCGACCCGAAGACGCGCTCGACGAGATTGTGCGGTTCTTCGAGGCGCGGGTTTCCGCCTTGCGACGGAGCGGGGTCGCTGCCGACCGGCTCATCCTCGATCCGGGGATGGGATTTTTCTTGAGCCCCGCACCGGAAACATCGCTGCACGTGCTGTCGAACCTTCAAAAGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCTTCTTGGGCGCCACCGTTGGCCTTCCTGTAAAGGATCTGGGTCCAGCGAGCCTTGCGGCGGAACTTCACGCGATCGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCGCAATCACCTTCTCGGAAACCCTCGCGAAATTTCGCAGTCGCGACGCCAGAGACCGAGGGTTAGATCATGCCTAGCATTCACCTTCCGGCCGCCCGCTA	NA	NA	NA	NA
>prophage 1
NZ_CP026204	Escherichia coli strain ECONIH5 plasmid pKPC-bca9, complete sequence	76500	25325	57278	76500	transposase	Escherichia_phage(21.43%)	26	NA	NA
WP_047389788.1|25325_26030_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_080753847.1|26006_26234_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003464991.1|26263_26782_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_103216110.1|27512_27887_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000019450.1|27987_28968_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_003464988.1|29947_30214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003464986.1|30383_30665_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_005005995.1|30732_31005_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	41.9	7.5e-09
WP_002118292.1|31458_32205_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003464980.1|32197_32800_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_003464979.1|33267_33738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011787801.1|34308_35799_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_055329964.1|35833_36691_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.4	6.6e-67
WP_011787803.1|36781_37114_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_011787804.1|37231_37852_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787805.1|38021_38282_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011918375.1|38281_38593_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787830.1|38616_41697_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
WP_038421110.1|43257_46266_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.3	0.0e+00
WP_004098835.1|46429_46996_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	82.6	3.5e-77
WP_001258875.1|47023_47731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001159650.1|48554_49322_+	DUF1883 domain-containing protein	NA	S6BFN8	Thermus_phage	46.4	9.8e-30
WP_004152397.1|50304_51624_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|51873_52755_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_001067855.1|53279_53984_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011787830.1|54197_57278_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
