The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	122495	133382	5616605		Escherichia_phage(87.5%)	9	NA	NA
WP_023313136.1|122495_125603_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|125657_126923_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|126953_128042_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001620096.1|128128_128389_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620095.1|128686_129547_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|129567_130329_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002210514.1|130589_131492_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210515.1|131503_132769_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
WP_002210516.1|132761_133382_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	336985	435535	5616605	capsid,portal,protease,tail,plate,integrase,transposase,terminase,tRNA,head,holin	Klebsiella_phage(60.0%)	102	410784:410799	441380:441395
WP_002902422.1|336985_337921_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_015958274.1|337966_339340_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	6.6e-53
WP_004148192.1|339865_340849_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004213984.1|341127_341871_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	7.8e-16
WP_020324627.1|341833_342952_+	oxidoreductase	NA	NA	NA	NA	NA
WP_004176404.1|343188_343383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902411.1|343495_344242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023285060.1|344492_345872_-	amino acid permease	NA	NA	NA	NA	NA
WP_002902405.1|346206_346686_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_040236348.1|346937_347552_+	YitT family protein	NA	NA	NA	NA	NA
WP_023313014.1|347590_348790_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002902397.1|348818_349487_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032409405.1|349479_350493_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
WP_023313012.1|350501_351308_-	D-methionine transport system substrate-binding protein	NA	NA	NA	NA	NA
WP_023313011.1|351528_352704_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_023313010.1|352750_353785_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021440018.1|354477_355389_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
WP_023313009.1|355381_356248_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004183818.1|356338_357262_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023313008.1|357281_358187_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023313007.1|358326_359256_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_004176413.1|359281_359488_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004151595.1|359538_360417_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151596.1|360575_361331_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015958263.1|361335_361929_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023302022.1|362002_362716_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023313006.1|362782_363277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004176417.1|363403_363946_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_023313005.1|363923_365009_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_040236347.1|364972_366727_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032409400.1|366803_367274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313003.1|367270_368326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313002.1|368356_369955_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_023313001.1|369954_373410_-	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_023313000.1|373406_374615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032421276.1|374954_375179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087638354.1|376063_377162_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
WP_023312999.1|377354_377876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071835948.1|380865_381228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071556732.1|381622_381898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040236344.1|382031_383243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023312994.1|383235_385755_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.8	1.1e-16
WP_002902160.1|388665_389157_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_023312992.1|389161_390868_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004179546.1|390864_391554_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004190550.1|391550_392891_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190552.1|392903_394448_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004176434.1|394490_394982_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_019705237.1|395827_396076_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_040174799.1|396483_396906_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_074185737.1|396983_397166_-	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	87.0	2.6e-18
WP_040186352.1|397177_397978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040182608.1|400027_403096_-	kinase	NA	A0A286S259	Klebsiella_phage	97.1	0.0e+00
WP_103214973.1|403092_403473_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	98.4	6.7e-72
WP_040182606.1|403482_403965_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
WP_004899614.1|403951_404431_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_040182604.1|404430_406878_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.5	5.9e-278
WP_004143894.1|406922_407390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004143895.1|407455_407719_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_001177591.1|407751_408105_-|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_000115125.1|408148_408640_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_000561415.1|408695_409061_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_004216814.1|409057_409597_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_004184710.1|409589_409922_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_004143899.1|409923_410121_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_017880223.1|410181_410508_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_044067369.1|410455_410698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040182598.1|410734_411898_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.5	2.9e-211
410784:410799	attL	CGATAGTGGGCCAGCG	NA	NA	NA	NA
WP_004216821.1|411909_412590_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_017880221.1|412595_413873_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_004143904.1|413875_415408_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143905.1|415417_415852_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_040182582.1|415973_416183_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
WP_040182580.1|416195_416486_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
WP_071854263.1|416556_416763_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
WP_032408647.1|416843_417080_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
WP_023304730.1|417404_417677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591489.1|417809_418094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182576.1|418329_418605_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
WP_023304728.1|418612_419242_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_019705280.1|419241_419523_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_017145563.1|419509_419905_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_031280381.1|420467_420914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182574.1|421228_422011_-	molecular chaperone	NA	F1C595	Cronobacter_phage	79.1	6.5e-114
WP_071854264.1|422007_422970_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	98.8	3.1e-182
WP_048322137.1|422971_424630_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	97.5	0.0e+00
WP_040182571.1|424671_425040_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
WP_071854265.1|425710_425944_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
WP_023304723.1|426084_426759_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
WP_040182568.1|426922_427336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182566.1|427518_427743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304721.1|427743_428109_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_029602968.1|428101_428356_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
WP_004177208.1|428327_428546_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_032439899.1|428542_428968_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.2	7.8e-53
WP_009309071.1|428964_429159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032439898.1|429155_429983_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.4	3.2e-111
WP_009309074.1|430727_430919_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
WP_040182271.1|430899_432081_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.5	7.4e-202
WP_004152146.1|432313_432826_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_023312991.1|433024_434557_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	29.5	1.5e-21
WP_004176437.1|434773_435535_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
441380:441395	attR	CGCTGGCCCACTATCG	NA	NA	NA	NA
>prophage 3
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	475068	526199	5616605	integrase,holin,terminase,tail	Salmonella_phage(21.15%)	68	468251:468266	523505:523520
468251:468266	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_074185737.1|475068_475251_-	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	87.0	2.6e-18
WP_040186352.1|475262_476063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040186350.1|478112_481181_-	kinase	NA	A0A286S259	Klebsiella_phage	95.8	0.0e+00
WP_016946669.1|481177_481558_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	95.2	3.1e-69
WP_004152650.1|481567_482050_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_064146244.1|482230_482695_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	69.1	3.6e-59
WP_004184437.1|483005_483341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071042777.1|483424_486079_-|tail	phage tail protein	tail	A0A2D1GPC9	Escherichia_phage	34.4	3.0e-86
WP_048978115.1|486152_486521_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	2.5e-15
WP_004217333.1|486631_486988_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_077254031.1|487064_487271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025713980.1|487408_487891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025713979.1|487944_489117_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	5.5e-24
WP_004190640.1|489140_489533_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_008807839.1|489529_490081_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
WP_004217344.1|490082_490466_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|490452_490686_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004190649.1|490695_490950_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_025713977.1|490951_491347_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	39.3	3.3e-13
WP_142689607.1|491387_491660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190653.1|491668_492622_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_025713976.1|492632_493418_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	6.0e-67
WP_042929737.1|493948_495061_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	54.5	2.1e-110
WP_048267898.1|495044_496445_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	2.4e-127
WP_008807833.1|496444_497752_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.1	1.6e-149
WP_031591843.1|497729_498734_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.0	1.3e-37
WP_071993302.1|498780_499116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025713971.1|499165_499582_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_025713970.1|499655_499901_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	92.6	9.7e-32
WP_004190672.1|500859_501135_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|501131_501476_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004184488.1|501472_502012_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_024176410.1|502008_502308_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_048289851.1|503065_503887_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	60.6	5.1e-85
WP_086528373.1|503883_504024_-	YlcG family protein	NA	NA	NA	NA	NA
WP_048289850.1|504020_504602_-	protein ninG	NA	E7C9S3	Salmonella_phage	44.8	2.7e-40
WP_064146235.1|504810_505407_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	3.8e-90
WP_071557491.1|505441_505690_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_004184503.1|505796_506030_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_064146233.1|506178_508173_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	54.0	1.7e-198
WP_057774672.1|508148_508406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064146232.1|508405_508705_-	hypothetical protein	NA	K7PJS3	Enterobacterial_phage	61.2	3.0e-27
WP_032426170.1|509357_509876_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	7.9e-92
WP_064146231.1|509875_510250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023341338.1|510242_510479_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.5e-13
WP_004184518.1|510475_510730_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.7	5.3e-09
WP_016946301.1|510722_510926_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	86.4	1.3e-26
WP_064146230.1|510922_511291_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.9e-11
WP_032417026.1|511298_512048_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_071042718.1|512050_512959_-	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	3.4e-90
WP_071993317.1|512973_513162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023287506.1|513249_513786_-	bacteriophage regulatory protein CII	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
WP_023282398.1|513788_514007_-	hypothetical protein	NA	K7PKS2	Enterobacteria_phage	64.8	8.9e-21
WP_025714325.1|514105_514489_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	82.7	5.9e-52
WP_123677984.1|514610_515021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025714324.1|515049_515253_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	1.1e-20
WP_004179600.1|515738_515930_+	YebW family protein	NA	NA	NA	NA	NA
WP_012967861.1|515938_516094_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_071042719.1|516231_519270_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.1	1.5e-291
WP_048289848.1|519282_520392_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	85.9	9.4e-183
WP_004190719.1|520426_520765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016160779.1|520757_521369_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.3	4.9e-40
WP_048289847.1|521365_521674_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	4.6e-23
WP_004892750.1|521681_521921_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_086528371.1|522141_523329_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
WP_004151901.1|523505_524396_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
523505:523520	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|524395_525388_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|525389_526199_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 4
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	990577	1036932	5616605	integrase,holin,terminase,tail	Salmonella_phage(28.0%)	65	990954:990968	1039263:1039277
WP_158649456.1|990577_990850_-	hypothetical protein	NA	H2DE47	Erwinia_phage	40.4	8.0e-11
990954:990968	attL	CGGCCATCACCCGGG	NA	NA	NA	NA
WP_103214985.1|993188_996257_-	kinase	NA	A0A286S259	Klebsiella_phage	90.7	0.0e+00
WP_103214986.1|996253_996634_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	93.7	7.6e-68
WP_103214987.1|996762_997131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317177.1|997140_997623_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	7.2e-79
WP_103214988.1|997619_998084_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.5	7.9e-51
WP_103214989.1|998141_998369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103214990.1|998398_1002025_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	29.8	1.1e-78
WP_103214991.1|1002120_1002486_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	48.3	1.0e-05
WP_004217333.1|1002533_1002890_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_008807842.1|1002966_1003173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103214992.1|1003310_1003793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103214993.1|1003847_1005020_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.0e-22
WP_103214994.1|1005043_1005436_-	electron transfer flavoprotein subunit beta	NA	A0A059VK45	Pseudomonas_phage	31.5	1.5e-13
WP_103214995.1|1005432_1005984_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	42.8	5.0e-28
WP_103214996.1|1005985_1006369_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	5.4e-21
WP_004190646.1|1006355_1006589_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004190649.1|1006598_1006853_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_038808181.1|1006854_1007250_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	42.5	2.1e-12
WP_134156008.1|1007290_1007563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032410237.1|1007571_1008525_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	1.1e-131
WP_103214997.1|1008535_1009321_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.8	3.8e-69
WP_103214998.1|1009405_1010518_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.7	4.8e-110
WP_103214999.1|1010501_1011902_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	6.4e-128
WP_103215000.1|1011901_1013209_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.1	1.5e-150
WP_103215001.1|1013186_1014191_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.1	3.8e-34
WP_064142403.1|1014194_1014383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215002.1|1014440_1014677_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	60.3	6.5e-17
WP_103215003.1|1015065_1015254_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	91.5	4.3e-24
WP_103215004.1|1015204_1015480_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	93.4	7.1e-07
WP_103215005.1|1015482_1016112_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	4.2e-87
WP_000243811.1|1016111_1016393_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_029497337.1|1016379_1016766_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	89.8	1.6e-57
WP_103215006.1|1017010_1017832_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	66.1	2.9e-96
WP_032755220.1|1017947_1018304_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	65.8	1.4e-42
WP_103215124.1|1018300_1018597_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	9.2e-37
WP_016946309.1|1018804_1019401_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
WP_071557491.1|1019435_1019684_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
WP_032423783.1|1019788_1020022_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	70.1	5.8e-26
WP_040241897.1|1020397_1020625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215007.1|1020959_1021244_-	hypothetical protein	NA	A0A0S1S1U7	Klebsiella_phage	94.7	3.8e-48
WP_158649457.1|1021875_1022025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215008.1|1022021_1022651_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_070550162.1|1022647_1023052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215009.1|1023048_1023552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215010.1|1023679_1024465_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	9.6e-65
WP_023286280.1|1024457_1024793_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
WP_032417026.1|1024800_1025550_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_073545905.1|1025552_1026461_-	DNA-binding protein	NA	V5URT9	Shigella_phage	53.9	8.4e-89
WP_071826821.1|1026475_1026664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602859.1|1027008_1027572_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	44.1	3.6e-29
WP_029602858.1|1027574_1027805_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	85.9	3.2e-29
WP_029602857.1|1027908_1028295_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	92.9	1.0e-56
WP_032438209.1|1028421_1028832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029602856.1|1028860_1029064_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	76.1	1.1e-20
WP_101854115.1|1029324_1029423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179600.1|1029529_1029721_+	YebW family protein	NA	NA	NA	NA	NA
WP_016946289.1|1029729_1029885_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_103215011.1|1030022_1033121_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.6	4.3e-294
WP_103215012.1|1033133_1034222_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.5	4.4e-108
WP_103215013.1|1034256_1034859_+	hypothetical protein	NA	R9VWB9	Serratia_phage	51.4	1.7e-53
WP_023301227.1|1034855_1035164_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	3.2e-24
WP_071557557.1|1035171_1035411_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
WP_023301228.1|1035449_1035725_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
WP_023301229.1|1035702_1036932_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	96.3	1.3e-238
1039263:1039277	attR	CGGCCATCACCCGGG	NA	NA	NA	NA
>prophage 5
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	1045767	1140831	5616605	capsid,portal,protease,tail,integrase,transposase,terminase,tRNA,head,holin	Klebsiella_phage(51.67%)	105	1128810:1128832	1142522:1142544
WP_002914089.1|1045767_1046853_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|1047056_1047482_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|1047551_1048250_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023313488.1|1048284_1050936_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|1051056_1052412_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004888435.1|1052453_1052777_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_040236563.1|1052780_1054079_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.9	4.1e-44
WP_004150973.1|1059955_1062529_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_023313489.1|1062658_1063390_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|1063386_1064367_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|1064498_1065236_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|1065506_1065842_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100632159.1|1065948_1065996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|1066096_1067257_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_103215014.1|1067253_1068126_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|1068188_1069310_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_040236944.1|1069319_1070390_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|1070732_1071242_+	YfiR family protein	NA	NA	NA	NA	NA
WP_073547516.1|1071234_1072458_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_023313491.1|1072471_1072954_+	OmpA family protein	NA	NA	NA	NA	NA
WP_023313492.1|1072962_1074333_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|1074389_1074848_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|1074967_1075315_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|1075354_1076122_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|1076153_1076702_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|1076720_1076969_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_023313493.1|1077228_1078593_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|1078756_1079548_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|1079567_1080854_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004174800.1|1080973_1081564_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|1081688_1082567_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_023313494.1|1082653_1084315_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|1084462_1084804_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145682.1|1084870_1085161_-	RnfH family protein	NA	NA	NA	NA	NA
WP_029497287.1|1085150_1085627_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|1085737_1086220_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_023317169.1|1086996_1087245_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	69.5	8.0e-26
WP_023317170.1|1087329_1087878_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	95.0	2.7e-90
WP_040235742.1|1088764_1090057_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	37.0	3.1e-68
WP_040219399.1|1090057_1090807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040235673.1|1090938_1091751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040235674.1|1093830_1096899_-	kinase	NA	A0A286S259	Klebsiella_phage	97.3	0.0e+00
WP_004152651.1|1096895_1097276_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_040236343.1|1097285_1097768_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.1	1.1e-84
WP_102004210.1|1097754_1098234_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	97.5	5.6e-92
WP_023317178.1|1098233_1100534_-	hypothetical protein	NA	A0A286S1S3	Klebsiella_phage	51.1	5.3e-180
WP_023317179.1|1100587_1101199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317180.1|1101278_1101542_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	86.0	8.2e-37
WP_023317181.1|1101574_1101928_-	hypothetical protein	NA	A0A286S1N4	Klebsiella_phage	79.5	1.3e-48
WP_004104226.1|1101971_1102463_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
WP_004104227.1|1102519_1102885_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.9	8.4e-64
WP_040236338.1|1102881_1103421_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	93.3	8.5e-89
WP_004104230.1|1103413_1103746_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	6.5e-55
WP_004899632.1|1103747_1103945_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_004104233.1|1104014_1104332_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	1.2e-21
WP_004104235.1|1104409_1105648_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_000999827.1|1105657_1106257_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_016530190.1|1106249_1107476_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_025108055.1|1107623_1109375_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.5	4.0e-252
WP_016530193.1|1109378_1109876_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
WP_040236333.1|1110031_1110382_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.1	1.0e-50
WP_023316717.1|1110369_1110603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023316716.1|1110659_1110956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304956.1|1111374_1111620_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	4.7e-18
WP_023316714.1|1112016_1112217_-	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	1.3e-18
WP_023316713.1|1112353_1112638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040236329.1|1112873_1113149_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	73.0	8.9e-26
WP_023316711.1|1113156_1113786_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.4	1.5e-105
WP_023317187.1|1113785_1114064_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	75.0	5.3e-34
WP_023317188.1|1114053_1114446_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	72.2	4.6e-44
WP_023317190.1|1114697_1115246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317191.1|1115465_1116248_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	100.0	9.0e-148
WP_004198239.1|1116244_1116721_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|1116717_1117680_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|1117681_1119340_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|1119916_1120138_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|1120235_1120904_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|1121074_1121389_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|1121381_1121570_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|1121739_1122105_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|1122097_1122352_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|1122323_1122542_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152156.1|1122538_1122964_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_009309071.1|1122960_1123155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|1123151_1123979_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|1124083_1124602_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_032441077.1|1124607_1125333_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	98.3	2.7e-130
WP_023317194.1|1125322_1125547_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	2.4e-29
WP_004152150.1|1125543_1125756_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_023317195.1|1125813_1126026_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	74.2	8.4e-24
WP_023317196.1|1125980_1127156_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	93.8	7.3e-210
WP_023317197.1|1127643_1128552_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	97.0	2.4e-168
1128810:1128832	attL	AATTGGTACACGTTTAGGTACAC	NA	NA	NA	NA
WP_032415394.1|1128882_1130073_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.0	3.4e-106
WP_023313538.1|1130227_1131145_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_103215015.1|1131146_1132532_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_014386491.1|1132577_1133558_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_158649458.1|1133615_1134506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313540.1|1135027_1135594_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.1e-59
WP_023313541.1|1135611_1135857_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	5.0e-20
WP_023313542.1|1135853_1136591_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.7	7.1e-70
WP_072041630.1|1137395_1137662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158236957.1|1137573_1137945_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	68.5	8.0e-30
WP_004185275.1|1137941_1138169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185276.1|1138165_1138486_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_023313543.1|1138497_1140831_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	81.7	0.0e+00
1142522:1142544	attR	AATTGGTACACGTTTAGGTACAC	NA	NA	NA	NA
>prophage 6
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	3680801	3748178	5616605	protease,integrase,transposase,terminase,tRNA,head,holin	Enterobacteria_phage(21.05%)	86	3705353:3705399	3754503:3754549
WP_002892205.1|3680801_3681281_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_004151327.1|3681483_3682278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178775.1|3682409_3684911_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	3.6e-113
WP_002892208.1|3685017_3685428_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004142979.1|3685424_3685883_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002892258.1|3685879_3686797_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004177224.1|3686937_3687615_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-22
WP_004177223.1|3687601_3688384_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_002892263.1|3688491_3689346_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004183221.1|3689404_3690175_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002892267.1|3690203_3690830_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004146399.1|3690797_3691484_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
WP_023283312.1|3691480_3693895_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004142997.1|3694076_3695222_+	porin	NA	NA	NA	NA	NA
WP_023283313.1|3695329_3696406_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004143002.1|3696517_3697585_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004151322.1|3697581_3698091_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_032425493.1|3698410_3699334_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	95.4	2.0e-170
WP_064782720.1|3699652_3700678_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004151320.1|3701073_3701796_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004151319.1|3701799_3702294_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004143010.1|3702469_3703855_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|3703900_3704113_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|3704114_3704981_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3705353:3705399	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_021441323.1|3705412_3706576_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_103215041.1|3706452_3706788_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_009483816.1|3706789_3707008_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
WP_048269240.1|3707004_3707490_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	61.9	1.2e-30
WP_009483862.1|3707486_3707711_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	9.2e-21
WP_009483861.1|3707707_3707926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065800368.1|3707922_3708579_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_103215042.1|3708575_3709004_-	regulator	NA	M9NYX4	Enterobacteria_phage	81.0	7.5e-64
WP_080850838.1|3709000_3709681_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.0	1.1e-122
WP_103215043.1|3709677_3710523_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	2.0e-68
WP_080901445.1|3710538_3710823_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	3.3e-39
WP_032717012.1|3710911_3711106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215044.1|3711567_3712002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029363661.1|3712021_3712717_-	helix-turn-helix transcriptional regulator	NA	K7P7I4	Enterobacteria_phage	62.4	8.2e-76
WP_040182097.1|3712819_3713041_+	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	55.1	1.8e-13
WP_001548453.1|3713080_3713302_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_103215045.1|3713388_3714249_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.6	3.5e-60
WP_040182092.1|3714245_3715094_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_040182091.1|3715090_3715384_+	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.1e-25
WP_103215129.1|3715620_3716184_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	42.9	8.2e-10
WP_004191576.1|3716180_3716450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191575.1|3716446_3717121_+	hypothetical protein	NA	A0A2H4FRZ0	Salmonella_phage	49.7	1.6e-28
WP_004191573.1|3717120_3717633_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.6	4.8e-73
WP_116287994.1|3717629_3718601_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	93.0	1.2e-64
WP_103215046.1|3718593_3718791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215048.1|3718971_3719211_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.3e-09
WP_103215049.1|3719374_3719971_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	4.3e-57
WP_032413853.1|3719976_3720147_+	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_103215050.1|3720139_3720748_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.7	2.3e-50
WP_103215051.1|3720744_3720975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215052.1|3720971_3721112_+	YlcG family protein	NA	NA	NA	NA	NA
WP_065520806.1|3721108_3721918_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	77.0	4.8e-120
WP_064782731.1|3722633_3722903_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
WP_064782756.1|3722880_3723378_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	9.6e-79
WP_064782732.1|3723374_3723764_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	45.2	1.1e-21
WP_103215053.1|3724222_3724855_+|terminase	terminase small subunit	terminase	A0A2I7RHH8	Vibrio_phage	48.0	1.6e-41
WP_103215054.1|3724856_3726533_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.3	3.9e-249
WP_103215055.1|3726533_3728054_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.2	5.7e-106
WP_064782735.1|3728106_3728796_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	54.9	2.9e-65
WP_103215056.1|3728858_3730646_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	38.1	3.7e-56
WP_000608644.1|3730793_3732056_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_014342913.1|3732338_3732821_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.2e-33
WP_064782736.1|3732820_3733858_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.0	4.2e-84
WP_047671892.1|3733859_3734186_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	42.6	2.1e-10
WP_041937856.1|3734185_3734629_+	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	38.2	1.1e-12
WP_103215057.1|3734631_3735195_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.9	4.8e-18
WP_064782758.1|3735191_3735560_+	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	30.6	1.5e-07
WP_064782738.1|3735541_3736093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215058.1|3736096_3737578_+	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.4	6.7e-59
WP_004196864.1|3737577_3738021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043875683.1|3738201_3738957_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.8	2.8e-61
WP_088607471.1|3738959_3739214_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	76.2	1.4e-20
WP_103215059.1|3739266_3739743_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	3.2e-07
WP_103215060.1|3739947_3741906_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	37.2	9.8e-42
WP_087775383.1|3741909_3742749_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	31.7	3.8e-27
WP_019725008.1|3742750_3743056_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_087775386.1|3743052_3743922_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.5	2.0e-26
WP_087775389.1|3743911_3744502_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	23.4	7.6e-06
WP_001518114.1|3744956_3745313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215061.1|3745320_3746553_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.5	1.1e-104
WP_103215062.1|3746545_3747133_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	42.9	3.2e-33
WP_088296096.1|3747134_3748178_+	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	41.5	4.4e-17
3754503:3754549	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 7
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4234265	4243728	5616605	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|4234265_4235381_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|4235377_4237318_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|4237394_4237616_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|4237941_4238259_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_040236670.1|4238289_4240569_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	5.6e-166
WP_001040187.1|4240688_4240907_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|4241260_4241962_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004209699.1|4242006_4243728_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
>prophage 8
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4360748	4384567	5616605	integrase,head,protease,tail	Pectobacterium_phage(42.11%)	32	4362674:4362687	4370155:4370168
WP_002898458.1|4360748_4361408_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
WP_040236540.1|4361677_4363330_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
4362674:4362687	attL	CTTGGCCAGGGCCA	NA	NA	NA	NA
WP_100729778.1|4363596_4364634_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.4	4.0e-95
WP_004199480.1|4364637_4364862_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_004141609.1|4365071_4365257_-	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
WP_069135042.1|4365258_4365825_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_100729777.1|4365824_4367954_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.6	8.0e-98
WP_100729820.1|4367998_4368232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100729776.1|4369162_4369570_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	50.8	3.7e-28
WP_100729775.1|4369652_4369853_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	48.3	1.4e-09
WP_100729774.1|4369913_4370360_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	53.2	1.2e-27
4370155:4370168	attR	TGGCCCTGGCCAAG	NA	NA	NA	NA
WP_016197573.1|4370443_4370602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024623102.1|4370619_4371588_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.5	5.5e-38
WP_100729773.1|4371584_4372973_+	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.3	2.0e-105
WP_009308333.1|4373011_4373662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080922675.1|4373665_4373899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103215074.1|4374139_4374832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133123792.1|4374844_4375525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100729771.1|4375521_4376049_+	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	28.7	9.1e-11
WP_100729770.1|4376424_4376616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100729769.1|4376684_4377278_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.6	4.7e-80
WP_071838911.1|4377267_4377591_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	1.8e-25
WP_064145708.1|4377578_4377935_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023279624.1|4377931_4378165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009308351.1|4378148_4378409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020947865.1|4378415_4378868_+	hypothetical protein	NA	A3EYX3	Salmonella_phage	66.4	1.5e-49
WP_100729768.1|4378952_4380347_+	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	2.4e-58
WP_100729767.1|4380346_4382011_+|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.2	4.5e-104
WP_100729766.1|4382013_4382337_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_100729765.1|4382323_4383049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191051.1|4383059_4384055_+	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.2	2.7e-104
WP_100729764.1|4384093_4384567_+	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	3.1e-26
>prophage 9
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4539263	4624794	5616605	portal,capsid,protease,tail,integrase,transposase,terminase,tRNA,head,holin	Salmonella_phage(16.39%)	97	4605502:4605518	4624987:4625003
WP_023312942.1|4539263_4539755_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085955203.1|4540256_4541620_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
WP_004176560.1|4541695_4542817_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004147969.1|4542902_4544369_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_004150807.1|4544368_4545040_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_004179353.1|4545322_4546129_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004179354.1|4546212_4546575_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_040235761.1|4546629_4548000_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	1.4e-108
WP_004140557.1|4548003_4548645_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_050583690.1|4548699_4549806_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_103215081.1|4549862_4550321_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|4550338_4550989_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|4551229_4552480_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_008806033.1|4552592_4553735_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	81.9	1.2e-172
WP_008806034.1|4553724_4553961_-	excisionase	NA	NA	NA	NA	NA
WP_040235764.1|4554261_4554498_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.9e-09
WP_014838111.1|4554490_4555042_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	46.0	7.0e-30
WP_040235766.1|4555038_4555266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040235770.1|4555693_4556038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040235771.1|4556165_4556951_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	6.9e-63
WP_023343167.1|4556943_4557144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040235856.1|4557143_4557671_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.3	6.0e-63
WP_014838117.1|4557806_4558637_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	82.4	9.3e-127
WP_014838118.1|4558689_4559061_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.5	4.8e-51
WP_087855718.1|4559877_4560393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038808210.1|4560665_4561298_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	6.0e-33
WP_025714631.1|4561395_4561626_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	2.7e-12
WP_014838120.1|4561859_4562327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014838121.1|4562407_4562956_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	66.9	3.0e-65
WP_023322342.1|4563128_4563308_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_040235782.1|4563297_4564209_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	73.8	4.4e-53
WP_038808205.1|4564205_4564664_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_040235785.1|4566026_4567877_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	52.2	1.5e-196
WP_023343178.1|4567873_4568350_+	hypothetical protein	NA	U5P451	Shigella_phage	61.8	1.4e-15
WP_040235787.1|4568346_4568745_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	69.7	6.2e-44
WP_020804343.1|4568834_4569656_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	4.0e-90
WP_077255574.1|4569737_4570724_+	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	48.6	1.1e-89
WP_040235788.1|4570742_4571573_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	2.9e-59
WP_020805698.1|4571782_4571974_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	81.0	1.6e-21
WP_040235790.1|4572123_4573173_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.4	8.9e-167
WP_025713398.1|4573867_4574257_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	79.1	2.6e-47
WP_025713397.1|4574246_4574525_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.9	1.7e-32
WP_040235795.1|4574524_4575151_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.8	1.5e-89
WP_023304957.1|4575356_4575539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025713395.1|4575624_4575909_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	75.5	1.1e-31
WP_025713394.1|4576477_4576810_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	62.7	4.4e-35
WP_040235796.1|4576938_4577184_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	61.7	3.0e-17
WP_025713392.1|4577258_4577720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040235798.1|4577918_4578272_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	72.7	9.0e-47
WP_038808146.1|4578455_4578920_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	4.8e-48
WP_025713389.1|4578873_4580610_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
WP_032423087.1|4580616_4581936_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	1.7e-138
WP_025713387.1|4581911_4582619_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
WP_032423088.1|4582628_4583849_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	8.3e-140
WP_040235802.1|4583894_4584149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032734570.1|4584154_4584487_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_040235805.1|4584499_4584838_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	8.1e-37
WP_040235808.1|4584834_4585284_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	83.9	1.3e-63
WP_040235809.1|4585280_4585628_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	1.8e-31
WP_025713380.1|4585684_4586389_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	1.6e-79
WP_025713379.1|4586419_4586824_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	8.5e-33
WP_025713378.1|4586826_4587132_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.0	3.6e-28
WP_040235812.1|4587324_4587855_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	2.1e-63
WP_040235814.1|4588051_4588435_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.9	3.1e-32
WP_040235816.1|4588502_4591910_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	43.1	5.6e-194
WP_004884312.1|4591931_4592405_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_040235817.1|4592391_4592868_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.2	2.4e-50
WP_040235819.1|4592880_4593261_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_040235820.1|4593257_4596335_+	kinase	NA	A0A286S259	Klebsiella_phage	61.9	0.0e+00
WP_040235822.1|4598383_4599184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052450217.1|4599194_4599377_+	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	85.2	1.5e-18
WP_004152765.1|4599985_4601470_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_040235864.1|4601549_4601969_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	9.4e-35
WP_040235824.1|4601970_4603236_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.6	2.3e-209
WP_040235826.1|4603361_4604351_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_040235828.1|4604640_4605318_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	4.7e-76
4605502:4605518	attL	TTTGGTCGGCACGAGAG	NA	NA	NA	NA
WP_064163533.1|4605973_4606687_+	DUF1353 domain-containing protein	NA	A0A088C4U2	Shewanella_sp._phage	40.5	5.7e-08
WP_064163532.1|4606777_4608526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064163531.1|4608518_4609154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064163530.1|4609156_4611076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103278706.1|4611297_4611615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071047044.1|4611559_4612030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158649453.1|4612074_4612248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064163527.1|4612838_4613177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215122.1|4613548_4613767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064163526.1|4614045_4614402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142294709.1|4614506_4615376_-	hypothetical protein	NA	H2DE57	Erwinia_phage	49.5	5.3e-72
WP_064163525.1|4615418_4616423_-	hypothetical protein	NA	A0A1P8DIG7	Virus_Rctr197k	37.7	2.8e-08
WP_032455384.1|4616435_4616786_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071527897.1|4617079_4617334_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064163524.1|4617531_4617852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077267588.1|4617844_4618114_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	43.5	3.1e-07
WP_103214975.1|4618812_4620660_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_103214974.1|4620643_4621687_-	topoisomerase	NA	A0A1B0VML8	Pseudomonas_phage	50.8	2.4e-39
WP_064163520.1|4622012_4622210_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_064163519.1|4622340_4623408_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	32.3	6.8e-05
WP_064163518.1|4623534_4624794_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	45.2	2.6e-96
4624987:4625003	attR	TTTGGTCGGCACGAGAG	NA	NA	NA	NA
>prophage 10
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4729771	4736676	5616605	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_064162399.1|4729771_4730635_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|4730645_4731419_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_064162400.1|4731659_4732553_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	30.2	2.1e-15
WP_004144192.1|4732798_4734160_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_103215083.1|4734478_4735201_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004214740.1|4735197_4736676_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 11
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4778053	4786431	5616605		Enterobacteria_phage(28.57%)	8	NA	NA
WP_064782645.1|4778053_4779460_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SPS4	Prochlorococcus_phage	28.8	2.9e-27
WP_064782646.1|4779683_4780748_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	1.9e-103
WP_064782647.1|4780774_4781644_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	1.5e-111
WP_004175259.1|4781675_4782566_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175260.1|4782580_4783135_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004175261.1|4783314_4784481_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_032409012.1|4784904_4785027_-	small membrane protein	NA	NA	NA	NA	NA
WP_040215970.1|4785426_4786431_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 12
NZ_CP026177	Klebsiella pneumoniae strain KPNIH50 chromosome, complete genome	5616605	4895639	4950763	5616605	integrase,coat,terminase,tRNA,head,holin	Escherichia_phage(22.03%)	72	4902035:4902057	4948050:4948072
WP_004151452.1|4895639_4897373_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|4897608_4898178_+	VOC family protein	NA	NA	NA	NA	NA
WP_004180440.1|4898254_4898998_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_004151451.1|4899079_4900084_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|4900080_4900824_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|4900863_4901259_-	membrane protein	NA	NA	NA	NA	NA
WP_100097892.1|4901311_4902085_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
4902035:4902057	attL	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_103215090.1|4902087_4903347_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	90.2	8.1e-223
WP_016244760.1|4903389_4903635_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_103215091.1|4903638_4903857_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	50.0	3.3e-07
WP_032442372.1|4903853_4904045_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_032442371.1|4904041_4904266_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	1.6e-20
WP_103215092.1|4904588_4905062_-	hypothetical protein	NA	A0A2P0PAG0	Pectobacterium_phage	47.5	5.1e-21
WP_023283323.1|4905058_4905217_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_065953852.1|4905213_4905837_-	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	49.0	4.6e-46
WP_032438130.1|4905833_4906337_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	30.1	9.3e-13
WP_094819271.1|4906348_4906633_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	80.9	5.0e-40
WP_103215093.1|4906640_4907612_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	89.3	7.4e-67
WP_019704100.1|4907699_4907894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103215094.1|4907993_4908263_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	42.9	6.9e-07
WP_032453660.1|4908622_4909312_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.7	5.1e-62
WP_004151299.1|4909439_4909673_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004139615.1|4909713_4909935_+	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_024622726.1|4910020_4910818_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.8	3.5e-91
WP_103215132.1|4910877_4911843_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	79.3	3.1e-65
WP_019704107.1|4911839_4912577_+	Replication protein 14	NA	A0A0K2FIT1	Enterobacteria_phage	55.6	3.1e-65
WP_103215095.1|4912573_4912876_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048987997.1|4913309_4913705_+	hypothetical protein	NA	G8C7U4	Escherichia_phage	80.6	8.8e-59
WP_085921672.1|4914511_4915072_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	30.3	2.7e-05
WP_039108779.1|4915485_4915806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805077.1|4916160_4916628_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	5.7e-33
WP_004196828.1|4916608_4916779_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	3.3e-15
WP_103215050.1|4916771_4917380_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	62.7	2.3e-50
WP_004196866.1|4917376_4917760_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	43.8	1.0e-19
WP_074399076.1|4917756_4917897_+	YlcG family protein	NA	NA	NA	NA	NA
WP_065520806.1|4917893_4918703_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	77.0	4.8e-120
WP_064782731.1|4919739_4920009_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
WP_064782756.1|4919986_4920484_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.2	9.6e-79
WP_064782732.1|4920480_4920870_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	45.2	1.1e-21
WP_103215096.1|4921328_4921976_+	hypothetical protein	NA	I6S676	Salmonella_phage	79.6	2.0e-100
WP_103215097.1|4922006_4922495_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.5e-47
WP_103215098.1|4922491_4924060_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	86.8	6.2e-289
WP_103215099.1|4924071_4925523_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	52.1	5.4e-122
WP_103215133.1|4925458_4926451_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.8	5.5e-118
WP_074167271.1|4926590_4927109_+	hypothetical protein	NA	Q4TZV0	Escherichia_virus	39.9	9.2e-24
WP_103215100.1|4927182_4928538_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.1	8.6e-130
WP_016529582.1|4928537_4928999_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_103215101.1|4928995_4930051_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	3.8e-101
WP_029884066.1|4930083_4930323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178849.1|4930325_4930706_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
WP_071599334.1|4930705_4930879_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	2.4e-13
WP_046654827.1|4930878_4931241_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	1.6e-19
WP_004151265.1|4931243_4931669_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_032442345.1|4931665_4932058_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.2	9.7e-34
WP_102083127.1|4932126_4932879_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	4.4e-43
WP_032442344.1|4932931_4933609_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.5	1.8e-72
WP_065890240.1|4933784_4934540_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	1.8e-60
WP_064147641.1|4934542_4934797_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	71.4	4.4e-19
WP_063443022.1|4934871_4935306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254637.1|4935346_4935700_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_064484068.1|4935825_4935993_+	Arc family DNA-binding protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
WP_050597782.1|4935979_4936684_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	43.9	9.0e-38
WP_103215103.1|4936749_4937535_+	Bro-N domain-containing protein	NA	A0A2L1IV39	Escherichia_phage	59.3	3.2e-84
WP_103215104.1|4937625_4941066_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	47.3	1.7e-153
WP_075208395.1|4941165_4941585_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004199076.1|4941584_4942055_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_065242176.1|4942051_4942447_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	2.3e-35
WP_103215105.1|4942433_4944911_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.2	1.1e-196
WP_103215106.1|4944999_4947279_+	hypothetical protein	NA	A0A0H5ARL8	Pseudomonas_phage	38.7	4.2e-12
WP_158649464.1|4947285_4947558_+	hypothetical protein	NA	H2DE47	Erwinia_phage	42.0	2.1e-11
WP_004145564.1|4948141_4948708_-	hydrolase	NA	NA	NA	NA	NA
4948050:4948072	attR	CACGCAGTTAAAGTGGCGGGCGT	NA	NA	NA	NA
WP_049000419.1|4948975_4950763_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
>prophage 1
NZ_CP026175	Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence	172259	3592	12508	172259		Macacine_betaherpesvirus(33.33%)	8	NA	NA
WP_000523812.1|3592_4759_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_009309982.1|4758_5730_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_009309981.1|7012_7318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206783.1|7371_7623_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_004206782.1|7701_8973_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
WP_009309980.1|8972_9398_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004152765.1|9803_11288_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568038.1|11536_12508_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
>prophage 2
NZ_CP026175	Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence	172259	82213	156752	172259	transposase,protease	Salmonella_phage(18.18%)	76	NA	NA
WP_032426541.1|82213_83137_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
WP_023287125.1|83259_83631_+	TraT complement resistance protein	NA	NA	NA	NA	NA
WP_017900859.1|84129_84513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427619.1|90128_91133_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|91211_94184_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|94186_94744_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000993245.1|94873_95086_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|95048_95168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|95151_95388_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277463.1|95384_95750_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000281123.1|95767_97450_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
WP_000522993.1|97488_97896_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732276.1|97923_98199_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294660.1|98214_98565_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_001166628.1|98636_99092_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_049106033.1|100398_100590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302508.1|102828_103020_+	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_001553819.1|103325_106223_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509966.1|106317_106923_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_103214959.1|106965_107805_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004199234.1|108054_108936_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_001067855.1|109460_110165_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|110286_110991_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001247892.1|111290_111581_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|111577_111979_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|111968_112325_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|112579_112906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103214961.1|112902_113403_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003100853.1|113399_113771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|113764_114322_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_049247875.1|114400_115405_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|115928_116561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|116589_117993_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|118193_118676_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|118663_118930_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004118702.1|119105_119360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098928.1|119435_119693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098931.1|119741_119945_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_103214962.1|119975_120344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009310053.1|120387_120882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009310052.1|120912_121479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009310051.1|121475_121739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196907.1|122028_123567_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	7.4e-295
WP_004196919.1|123615_123963_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
WP_003031976.1|123959_124364_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_009654306.1|124601_124721_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_009309894.1|125099_125534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309895.1|125749_127150_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_009309896.1|127146_127827_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.8	3.0e-30
WP_004118344.1|127881_128811_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|128815_129196_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001378118.1|129235_130126_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|130131_131949_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|132182_132632_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|132920_133658_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|133691_133889_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|133929_136377_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|136503_136944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309899.1|137030_140177_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.3	1.8e-61
WP_009309900.1|140187_141480_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004213578.1|141593_141956_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|141984_143370_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697969.1|143559_144240_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_009309901.1|144232_145708_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	7.9e-28
WP_009309902.1|145953_146385_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_048295888.1|146549_147473_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	2.1e-172
WP_004187110.1|147598_147949_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
WP_032451458.1|148134_149043_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000361404.1|149587_150610_-	helicase UvrD	NA	NA	NA	NA	NA
WP_009309907.1|150594_152157_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|152230_152647_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|152643_152874_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009309909.1|153165_153759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047057603.1|153777_154218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071844672.1|155667_156009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309912.1|156116_156752_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP026174	Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence	93680	17759	61602	93680	transposase	Enterobacteria_phage(11.76%)	53	NA	NA
WP_023280828.1|17759_18683_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	3.6e-172
WP_103214945.1|18851_19448_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_023316397.1|19440_20865_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_015632497.1|20864_21605_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_004144423.1|21591_22158_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_004178059.1|22177_22483_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_004194426.1|22496_22865_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_060415469.1|22933_23134_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_022644938.1|23218_23920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644939.1|24154_24547_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_020314755.1|24980_25475_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_020804853.1|25497_26040_-	antirestriction protein	NA	NA	NA	NA	NA
WP_032744240.1|26665_27499_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	34.8	3.7e-22
WP_032744242.1|27545_27776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804856.1|27866_28214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804855.1|28269_28608_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	54.1	1.6e-21
WP_155088899.1|28906_29056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103214946.1|29429_30104_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_020804025.1|30353_30584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644716.1|30676_30904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020314937.1|31719_32043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103214947.1|32039_32768_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_086619021.1|32764_33199_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_103214948.1|33239_35240_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.4	3.3e-21
WP_020314938.1|35308_35557_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_103214949.1|35606_36164_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.0	1.1e-49
WP_103214951.1|36972_37293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425679.1|37317_37581_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	53.8	3.4e-14
WP_020803881.1|37781_37973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020803879.1|38013_38520_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_032744250.1|38564_38993_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.2e-10
WP_020804421.1|39425_40190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804419.1|40236_40647_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_020804418.1|40692_40914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032744253.1|40913_41615_-	methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.3	2.6e-21
WP_020804878.1|42051_42282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194725.1|42496_43717_-|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
WP_032743916.1|43813_44239_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.7	4.9e-31
WP_020804877.1|44238_45510_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	1.6e-157
WP_032426086.1|45728_46052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804882.1|46147_46789_-	ParA family protein	NA	A4JWV7	Burkholderia_virus	25.5	1.1e-05
WP_020314642.1|47826_48447_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
WP_022644719.1|48466_48733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314639.1|48853_49807_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	9.5e-75
WP_020804876.1|49803_50415_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_020314648.1|50732_51011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804880.1|51048_51780_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_020804881.1|52074_52773_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_020326536.1|53501_54497_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	4.1e-20
WP_023317852.1|54632_55268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103214952.1|55485_56091_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	7.2e-20
WP_001067855.1|57996_58701_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|60597_61602_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP026172	Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence	243967	17112	63087	243967	protease,integrase,transposase	Escherichia_phage(33.33%)	44	33898:33916	41894:41912
WP_014386491.1|17112_18093_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_103214934.1|18387_19305_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_048996106.1|19361_20213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032426541.1|21462_22386_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
WP_042919284.1|23690_24671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181774.1|24817_25171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181772.1|25232_26054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103214908.1|26081_27155_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_014386491.1|27193_28174_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_004026538.1|28428_29505_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_116287996.1|29568_31542_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004181768.1|31613_31844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181767.1|31954_33199_+	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
WP_087759866.1|33431_34552_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
33898:33916	attL	CCTGTGGCCAGTGCGTCCA	NA	NA	NA	NA
WP_004181765.1|35176_35395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181763.1|35982_36225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181762.1|36272_36737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186937.1|36746_37154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065801680.1|37196_38156_+	DNA replication protein	NA	NA	NA	NA	NA
WP_042934801.1|38152_38911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|38907_39231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026552.1|39381_39699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386529.1|39764_40901_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152765.1|40986_42471_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
41894:41912	attR	CCTGTGGCCAGTGCGTCCA	NA	NA	NA	NA
WP_016946352.1|42986_43241_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_065801681.1|43326_44394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158649448.1|45048_45591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|45751_46636_-	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_004026565.1|47883_48336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065801682.1|48578_48893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181742.1|49867_50080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049007085.1|50173_50452_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004118061.1|50999_51404_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_004196929.1|51679_52162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196935.1|52540_54040_-	kinase	NA	NA	NA	NA	NA
WP_032720947.1|54067_55801_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|55800_56841_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026585.1|56933_57572_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|57572_58214_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_014386542.1|58238_58877_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026591.1|59356_59815_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_032720946.1|59817_61041_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_065800116.1|61051_62008_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_065801645.1|62007_63087_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.6e-40
>prophage 2
NZ_CP026172	Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence	243967	177951	184490	243967	transposase	Burkholderia_phage(33.33%)	8	NA	NA
WP_004026466.1|177951_178212_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004026465.1|178244_178679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026464.1|178675_179419_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
WP_103214927.1|179545_180961_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	4.1e-106
WP_038992075.1|181050_182253_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
WP_001118619.1|182344_183268_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_004181828.1|183896_184145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181829.1|184172_184490_+	DUF3846 domain-containing protein	NA	A0A2H4P7A4	Pseudomonas_phage	46.5	6.0e-10
>prophage 3
NZ_CP026172	Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence	243967	204430	218115	243967	tail,transposase	Escherichia_phage(35.71%)	19	NA	NA
WP_001118619.1|204430_205354_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_004026417.1|205808_206129_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
WP_004026416.1|206209_206524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197205.1|206644_206896_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026415.1|207061_207280_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_014386581.1|207373_207871_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	57.0	1.5e-23
WP_062826758.1|207867_208056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883219.1|208757_209402_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
WP_004197228.1|209818_210205_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_004197183.1|210484_210700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158649451.1|210783_211119_+	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	3.3e-14
WP_016947068.1|211455_211938_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
WP_103214931.1|211934_212624_+	DUF551 domain-containing protein	NA	A0A1V0E5M5	Salmonella_phage	31.1	2.4e-19
WP_016947069.1|212623_212809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120310.1|213078_213351_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
WP_103214932.1|214119_214569_+|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
WP_004026394.1|214638_215247_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
WP_014386579.1|215534_215990_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_004197197.1|216873_218115_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
>prophage 1
NZ_CP026173	Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence	64271	17427	56182	64271	integrase,transposase,protease	Escherichia_phage(25.0%)	44	30584:30597	51933:51946
WP_001067855.1|17427_18132_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|20028_21033_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|21214_21391_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|21720_22536_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|22596_23400_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|23399_24236_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000427619.1|25161_26166_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|26244_29217_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|29219_29777_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000993245.1|29906_30119_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|30081_30201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|30184_30421_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277463.1|30417_30783_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
30584:30597	attL	GCCAGTGCGTCCAG	NA	NA	NA	NA
WP_000281123.1|30800_32483_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
WP_000522993.1|32521_32929_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732276.1|32956_33232_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294660.1|33247_33598_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_001166628.1|33669_34125_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_011977766.1|34824_35160_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|35332_35614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|35667_36279_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_153933072.1|36275_36422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|36427_37132_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_103214937.1|37858_38860_-|protease	CAAX protease	protease	NA	NA	NA	NA
WP_023302479.1|39015_39597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|40228_40435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|40480_40789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|40816_41146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|41213_41570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152339.1|41576_41909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|41908_42691_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_011977773.1|43582_43813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045340523.1|43904_44378_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152347.1|44758_45091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|45467_46442_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|46438_47644_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|47965_48862_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|49262_50534_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_001568036.1|50533_50965_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_103214939.1|51374_52859_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.9e-29
51933:51946	attR	CTGGACGCACTGGC	NA	NA	NA	NA
WP_001568038.1|53107_54079_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_049193275.1|54081_54753_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_009309993.1|54813_55044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064160217.1|55480_56182_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	2.1e-26
