The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026028	Escherichia coli strain CIT chromosome, complete genome	4639673	247636	296320	4639673	transposase,integrase	Streptococcus_phage(20.0%)	49	262122:262181	296430:296489
WP_000006255.1|247636_248134_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|248357_250097_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|250056_250827_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|250897_251953_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|252004_252298_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|252300_252699_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|252708_253161_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|253466_253733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|253665_254202_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|254258_255716_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|255976_256435_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|256526_257771_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|257828_258230_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|258268_259324_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|259611_260715_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|260726_261980_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262122:262181	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|262551_262893_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|262913_263231_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|263249_263471_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|263479_263956_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|263971_264430_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|264527_264767_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|264843_265311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|265333_265777_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|265776_266004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|266407_267229_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|267320_268184_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|268512_269406_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|269826_270978_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|273324_274341_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|274548_275952_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|275938_276871_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|276979_278026_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|279247_279586_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|279608_279959_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_010723086.1|280052_281207_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|281501_282410_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|282424_284392_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|284618_286001_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|286012_287623_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|287627_288386_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|288524_289529_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|290723_291455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|291545_292172_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|292443_293142_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293168_294023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|294141_294366_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|294362_294803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|294919_296320_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
296430:296489	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP026028	Escherichia coli strain CIT chromosome, complete genome	4639673	518362	581320	4639673	transposase,tRNA,terminase,protease,lysis,integrase	Enterobacteria_phage(50.0%)	66	563978:564024	585280:585326
WP_001295836.1|518362_518986_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|518956_519643_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|519639_522054_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|522484_526765_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|526804_527173_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|527863_528124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|529355_530450_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|530518_531445_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|531674_532157_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|532234_533050_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|533139_534921_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|534933_535710_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|535809_536688_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|536856_538311_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|538370_539732_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|539788_541090_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|541111_542257_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|542484_543270_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|543280_544516_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|544537_545587_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|545903_547571_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_048814512.1|547580_547841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001419715.1|547837_548839_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|548849_549665_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|549661_550555_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|550749_551817_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|551813_552323_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|552440_553163_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|553165_553660_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|553833_555219_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|555254_555776_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|555883_556096_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|556097_556964_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|557434_557977_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|558196_558889_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|558919_561523_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|561501_562542_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|562552_563068_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|563070_563703_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
563978:564024	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|564037_565201_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|565320_565584_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|565906_566002_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|566064_567226_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|567537_567870_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|567917_568067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|568124_569651_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|570115_570667_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|570676_571474_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|571590_571692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|571688_572144_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|572143_572314_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|572306_572597_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|572593_572956_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|572952_573093_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|573178_573562_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|573959_574976_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|574980_576048_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|576620_576836_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|576835_577333_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|577549_577732_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|577822_578116_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|578406_578817_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|579102_579309_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|579473_579668_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|580056_580602_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|580576_581320_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
585280:585326	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP026028	Escherichia coli strain CIT chromosome, complete genome	4639673	1191889	1213282	4639673	portal,tRNA,tail,integrase,plate	Shigella_phage(25.0%)	32	1183884:1183898	1219985:1219999
1183884:1183898	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1191889_1192996_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1193049_1193511_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1193520_1194174_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1194345_1195596_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1196089_1196755_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1196755_1197460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1197917_1198811_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1198901_1200029_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1200009_1200255_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1200291_1200603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1200719_1201061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1200998_1201307_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1201481_1202156_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1202246_1202447_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1202490_1203048_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1203223_1203403_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1203392_1204760_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1204771_1204954_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1204953_1205427_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1205353_1206145_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1206135_1206720_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1206723_1207353_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|1207354_1207768_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1207739_1208342_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1208341_1208836_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1208907_1209462_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1209568_1210402_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943927.1|1210635_1210800_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1210902_1211226_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1211762_1211873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1211925_1212330_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1212550_1213282_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1219985:1219999	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP026028	Escherichia coli strain CIT chromosome, complete genome	4639673	1394099	1434917	4639673	transposase,tRNA,lysis,tail,integrase	Escherichia_phage(45.16%)	43	1395246:1395264	1425621:1425639
WP_010723085.1|1394099_1395116_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1395246:1395264	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1395388_1395646_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1395695_1396646_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1396797_1397550_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_000945011.1|1397744_1398260_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1398270_1399797_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1399833_1401279_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000444929.1|1401278_1402589_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_000885458.1|1402764_1403673_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1404002_1404566_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1404586_1405819_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1406073_1407057_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1407534_1408908_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1409036_1409972_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1410023_1411259_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1411260_1411476_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1411554_1411764_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1411756_1411951_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1412007_1412817_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1412809_1415410_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1415511_1415787_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1415861_1416032_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1416031_1416253_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1416694_1417183_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1417179_1417335_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1417788_1418265_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1418388_1418685_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1418707_1419130_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1419142_1420000_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1420006_1420753_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1420775_1421336_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1421423_1421609_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1421805_1423263_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1423400_1423664_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1423644_1424004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1425769_1426750_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1425621:1425639	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1427072_1430435_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1430434_1431010_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1431107_1431698_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1432014_1432248_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1432316_1432430_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1433208_1433643_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1433783_1434917_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 5
NZ_CP026028	Escherichia coli strain CIT chromosome, complete genome	4639673	1627477	1646688	4639673	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1627477_1628938_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1629026_1630310_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1630914_1631028_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1631096_1631330_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1631646_1632237_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1632334_1632910_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1632909_1633872_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1633822_1634392_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1634780_1635014_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1635071_1635482_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1635633_1635807_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1635978_1636134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1636212_1636278_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1636280_1636469_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1636479_1636692_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1637054_1637552_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1637548_1638082_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1638078_1638390_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1638394_1638610_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1639363_1639579_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1639879_1640092_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1640146_1640236_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1640513_1641266_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001393597.1|1641279_1642329_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_012304870.1|1642330_1642609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1642675_1642927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1643143_1643299_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1643370_1643658_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1643657_1643897_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1643921_1644227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1644429_1644762_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1645198_1645348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1645644_1645875_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1645958_1646366_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1646532_1646688_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP026028	Escherichia coli strain CIT chromosome, complete genome	4639673	2105250	2113921	4639673		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2105250_2106354_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2106361_2107609_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2107605_2108163_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2108162_2109044_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2109101_2110001_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2110000_2111086_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2111458_2112352_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2112526_2113921_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 7
NZ_CP026028	Escherichia coli strain CIT chromosome, complete genome	4639673	2463323	2474533	4639673	integrase,tail	Enterobacteria_phage(50.0%)	17	2461298:2461314	2478208:2478224
2461298:2461314	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2463323_2464256_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2464567_2465725_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2465877_2466240_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2466236_2467157_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2467153_2468485_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2468519_2468801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2469099_2469540_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2469566_2470085_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2470134_2470410_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2470409_2470904_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2470900_2471269_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2471626_2471989_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2472054_2472879_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2473006_2473543_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2473533_2473896_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2473895_2474201_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2474332_2474533_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2478208:2478224	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP026028	Escherichia coli strain CIT chromosome, complete genome	4639673	2855115	2862254	4639673		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2855115_2857677_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2857782_2858439_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2858489_2859257_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2859452_2860361_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2860357_2861524_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2861615_2862254_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
