The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	1085317	1092457	4833062		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1085317_1085956_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1085952_1087215_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1087211_1088120_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1088315_1089083_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1089133_1089790_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|1089895_1092457_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	1163996	1171760	4833062	transposase,integrase	Escherichia_phage(66.67%)	6	1155231:1155244	1172070:1172083
1155231:1155244	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_085947771.1|1163996_1165158_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000577254.1|1165310_1167029_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000214990.1|1167030_1168779_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|1168850_1169267_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1169305_1170535_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|1171277_1171760_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1172070:1172083	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 3
NZ_CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	1435519	1480663	4833062	portal,coat,lysis,holin,tail,integrase,terminase	Enterobacteria_phage(52.54%)	62	1433051:1433067	1482673:1482689
1433051:1433067	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|1435519_1436953_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274885.1|1437168_1438083_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197025.1|1438154_1439402_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|1439931_1440132_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001281185.1|1440255_1440600_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	95.6	6.5e-58
WP_000152200.1|1440657_1441458_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.5	1.7e-157
WP_000002088.1|1441500_1441785_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	92.6	9.4e-47
WP_000206740.1|1441777_1442467_-	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	79.1	4.1e-96
WP_000151160.1|1442468_1443068_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	94.1	3.8e-45
WP_001065198.1|1443064_1443709_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.1	1.1e-130
WP_000812168.1|1443705_1444224_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	64.2	6.6e-54
WP_001214452.1|1444220_1444385_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_001111278.1|1444395_1444689_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001016190.1|1444705_1445254_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	97.8	3.6e-103
WP_000168259.1|1445262_1445778_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	88.3	1.3e-65
WP_000365276.1|1445778_1446486_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	5.0e-137
WP_000865176.1|1447096_1447285_-	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	59.3	3.8e-12
WP_000657742.1|1447284_1447614_-	hypothetical protein	NA	A0A088CPT8	Enterobacteria_phage	72.9	1.9e-14
WP_000392415.1|1447666_1448032_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	99.2	1.1e-58
WP_000804697.1|1448089_1448368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216180.1|1448370_1448679_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	65.7	8.2e-28
WP_000872381.1|1449032_1449686_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.8	1.9e-122
WP_000067727.1|1449803_1450019_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438534.1|1450128_1450425_+	hypothetical protein	NA	G9L678	Escherichia_phage	98.0	2.0e-47
WP_000166207.1|1450457_1450604_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000065676.1|1450596_1451496_+	hypothetical protein	NA	K7PH26	Enterobacteria_phage	99.7	6.1e-164
WP_000131504.1|1451485_1452922_+	AAA family ATPase	NA	K7P7N4	Enterobacteria_phage	99.4	4.4e-273
WP_001294157.1|1453006_1453276_+	hypothetical protein	NA	A0A220NQU9	Salmonella_phage	40.3	2.6e-06
WP_000810178.1|1453316_1453763_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	93.2	3.4e-75
WP_000153270.1|1453759_1454287_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254255.1|1454283_1454460_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000386657.1|1454462_1454822_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
WP_000950973.1|1454821_1454998_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000002243.1|1455711_1456002_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008199.1|1455998_1456361_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994515.1|1456357_1456546_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001235461.1|1456542_1457166_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_029798719.1|1457306_1457489_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	95.0	1.5e-26
WP_000783734.1|1457599_1457923_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|1457906_1458383_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000088943.1|1458379_1458847_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	6.1e-75
WP_001139680.1|1458834_1458987_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001058931.1|1459190_1459676_+	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
WP_000807791.1|1459924_1460167_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	2.9e-36
WP_000729921.1|1460246_1460735_+	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	99.4	4.1e-90
WP_000417851.1|1460712_1462212_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
WP_000752844.1|1462212_1464378_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.7	0.0e+00
WP_000373008.1|1464391_1465303_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	6.3e-161
WP_001196941.1|1465302_1466598_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.1	4.7e-242
WP_001349928.1|1466642_1466897_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	95.5	1.1e-25
WP_001054835.1|1466874_1467375_+	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	98.2	1.2e-89
WP_001122413.1|1467374_1468793_+	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.9	1.0e-274
WP_000785560.1|1468792_1469641_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.2	3.8e-99
WP_000614044.1|1469640_1470096_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	1.1e-86
WP_000964882.1|1470098_1470791_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000246948.1|1470800_1472189_+	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	64.0	7.7e-150
WP_001029828.1|1472188_1474186_+	hypothetical protein	NA	Q716G2	Shigella_phage	95.9	0.0e+00
WP_000287053.1|1474275_1474536_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	98.8	3.6e-37
WP_001280400.1|1474657_1476856_+|tail	phage tail protein	tail	F8UBT4	Escherichia_phage	37.6	4.1e-105
WP_000575660.1|1476888_1478016_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	30.2	1.0e-19
WP_000958678.1|1478261_1479419_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	3.7e-222
WP_000368131.1|1479730_1480663_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1482673:1482689	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	1710840	1720281	4833062		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569367.1|1710840_1711767_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	9.7e-24
WP_000783120.1|1711771_1712503_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1712483_1712591_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1712650_1713382_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1713603_1715289_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1715285_1716005_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1716051_1716522_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1716561_1717023_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001349936.1|1717147_1719148_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001349937.1|1719144_1720281_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 5
NZ_CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	1732792	1796093	4833062	capsid,portal,head,lysis,holin,tRNA,tail,plate,integrase,terminase	Escherichia_phage(41.3%)	73	1760035:1760062	1791009:1791036
WP_001295427.1|1732792_1734826_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|1734957_1736067_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|1736329_1736611_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1736903_1737446_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|1737526_1738201_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945468.1|1738216_1740697_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405707.1|1740712_1741747_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1741828_1742167_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134569.1|1742385_1743210_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1743330_1743603_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195605.1|1743825_1744614_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1744610_1745411_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001297420.1|1745475_1746294_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|1746345_1747092_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|1747065_1748031_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846224.1|1748027_1749032_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|1749028_1750306_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1750562_1751615_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|1751924_1752779_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853892.1|1752807_1754070_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1754079_1754532_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1754562_1754847_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490714.1|1754850_1756206_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1756253_1757294_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1757393_1758173_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1758254_1759154_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001352710.1|1759559_1759877_+	hypothetical protein	NA	NA	NA	NA	NA
1760035:1760062	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1760141_1761155_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1761270_1761570_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1761691_1761967_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217680.1|1762144_1762645_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_000557703.1|1762708_1762933_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277968.1|1762932_1763232_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	4.2e-45
WP_001113270.1|1763234_1763459_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027664.1|1763455_1763731_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268602.1|1763720_1765997_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000744812.1|1767161_1768595_+	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_001350078.1|1768587_1769160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038162.1|1769218_1770247_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_000156872.1|1770246_1772019_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085948.1|1772192_1773047_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_001248584.1|1773105_1774179_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	7.4e-201
WP_000203430.1|1774182_1774926_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.0	2.3e-121
WP_001350080.1|1775025_1775535_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
WP_000846399.1|1775534_1775738_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|1775741_1776023_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144178.1|1776022_1776520_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000736570.1|1776534_1776960_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
WP_000040687.1|1776947_1777373_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	8.0e-66
WP_000917165.1|1777480_1777948_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	3.3e-81
WP_001001782.1|1777940_1778393_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_001093712.1|1778459_1779095_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	6.5e-112
WP_000127163.1|1779091_1779439_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121496.1|1779443_1780352_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_001285343.1|1780344_1780956_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000049773.1|1782123_1782564_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	61.9	2.7e-48
WP_000805553.1|1782535_1783129_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	63.0	1.3e-58
WP_096147428.1|1783128_1783623_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	94.1	6.6e-80
WP_000905100.1|1783653_1784247_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_001286686.1|1784306_1785497_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_001251408.1|1785509_1786028_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1786084_1786360_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1786392_1786512_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069967.1|1786504_1788952_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.8	0.0e+00
WP_000978889.1|1788966_1789446_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882938.1|1789445_1790609_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000468308.1|1790689_1790908_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|1791180_1792542_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
1791009:1791036	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|1792644_1792941_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1792942_1793239_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|1793447_1793780_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137869.1|1793970_1794693_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000675150.1|1794689_1796093_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 6
NZ_CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	2295732	2349296	4833062	portal,capsid,head,lysis,transposase,tail,integrase,terminase	Enterobacteria_phage(48.08%)	71	2286200:2286215	2318635:2318650
2286200:2286215	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000598292.1|2295732_2296059_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2296264_2297479_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836076.1|2297490_2298510_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.3e-16
WP_001360138.1|2298567_2298678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876956.1|2298697_2299978_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	5.6e-155
WP_001296941.1|2300012_2300249_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048348.1|2300336_2302814_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|2302906_2303098_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2303094_2303283_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001329848.1|2303682_2303847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2303850_2304069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2304228_2304384_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2304550_2304958_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2305041_2305272_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705358.1|2305255_2305777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054512.1|2305757_2306723_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_001151262.1|2306763_2307186_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|2307182_2307539_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_000955178.1|2308845_2309028_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589005.1|2309205_2310519_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|2310955_2311288_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2311490_2311796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2311820_2312060_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2312059_2312347_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2312418_2312574_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2312790_2313042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2313108_2313387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|2313388_2314438_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|2314451_2315204_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2315481_2315571_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2315625_2315838_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2316138_2316354_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2317107_2317323_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2317327_2317639_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2317635_2318169_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2318165_2318663_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2318635:2318650	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2319025_2319238_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2319248_2319437_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2319439_2319505_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2319584_2319740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2319911_2320085_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2320236_2320647_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2320704_2320938_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|2321326_2321872_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027259.1|2321846_2323772_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|2323768_2323975_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001349919.1|2323971_2325573_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000123305.1|2325553_2326873_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_001295978.1|2326882_2327215_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063280.1|2327270_2328296_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158921.1|2328337_2328736_+	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	4.5e-63
WP_000753007.1|2328747_2329101_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000985119.1|2329112_2329691_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|2329687_2330083_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|2330090_2330831_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479150.1|2330846_2331269_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	1.3e-71
WP_000459457.1|2331250_2331685_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840335.1|2331677_2334239_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.3	0.0e+00
WP_000847360.1|2334235_2334565_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	9.6e-59
WP_001152622.1|2334564_2335263_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_001349921.1|2335268_2336012_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
WP_000090891.1|2335948_2336581_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000033679.1|2336641_2340055_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_001233072.1|2340125_2340725_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	9.7e-110
WP_000279140.1|2340789_2343864_+	membrane protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_000885611.1|2343863_2344439_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|2344536_2345127_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2345443_2345677_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2345745_2345859_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2346463_2347747_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527779.1|2347835_2349296_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
>prophage 7
NZ_CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	2547377	2603919	4833062	plate,tail,holin,tRNA,integrase,terminase	Escherichia_phage(74.58%)	66	2545088:2545103	2603080:2603095
2545088:2545103	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000837909.1|2547377_2548511_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001082294.1|2548651_2549086_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000701877.1|2549625_2550198_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.3	1.8e-76
WP_000117760.1|2550212_2553353_-	shikimate transporter	NA	A0A0U2SH60	Escherichia_phage	71.2	0.0e+00
WP_000902859.1|2553376_2553922_-|tail	tail assembly protein	tail	Q8W612	Enterobacteria_phage	76.4	3.8e-76
WP_000600270.1|2553924_2555478_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	79.2	4.6e-228
WP_001199732.1|2555474_2556101_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	2.2e-120
WP_001349878.1|2556084_2557311_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	98.8	5.8e-226
WP_000733802.1|2557332_2557872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014640615.1|2557912_2558287_+	hypothetical protein	NA	A0A0U2QL80	Escherichia_phage	95.8	6.8e-61
WP_001261334.1|2558262_2558610_-	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	94.8	4.1e-60
WP_103143205.1|2558883_2558982_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	83.9	2.3e-08
WP_000063616.1|2559306_2560020_-|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	96.6	1.8e-126
WP_001271172.1|2560019_2561027_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	96.1	1.2e-189
WP_000209259.1|2561026_2561293_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	94.3	2.7e-43
WP_000056323.1|2561289_2561958_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.6	4.3e-122
WP_000016439.1|2561961_2563950_-	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	94.4	0.0e+00
WP_000703979.1|2564013_2564631_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	98.0	4.2e-108
WP_000613371.1|2564627_2565059_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	2.8e-74
WP_000506600.1|2565082_2566420_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	1.0e-244
WP_001139506.1|2566419_2567364_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.4	2.2e-172
WP_000762302.1|2567350_2567791_-	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
WP_000175376.1|2567787_2568228_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000780861.1|2568227_2568698_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_001272365.1|2568755_2569784_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.4	3.3e-190
WP_001349881.1|2569798_2570416_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	100.0	5.9e-118
WP_000059667.1|2570408_2571731_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.2	6.8e-188
WP_024190735.1|2571711_2572431_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.9	6.2e-135
WP_000807710.1|2572489_2573926_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.8	5.2e-266
WP_000021163.1|2573944_2575273_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.9	8.4e-263
WP_000089432.1|2575262_2576354_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	92.1	1.0e-144
WP_000126790.1|2576357_2576567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204039.1|2576544_2577477_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	7.1e-83
WP_001291099.1|2577469_2578258_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.1	2.5e-49
WP_133301706.1|2578662_2578845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014545.1|2578859_2579237_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.0e-64
WP_000950573.1|2579239_2579515_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	5.5e-44
WP_001349882.1|2579504_2579897_-|holin	holin	holin	Q8W636	Enterobacteria_phage	96.2	8.4e-54
WP_000640164.1|2581167_2581704_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.3e-68
WP_000228041.1|2581700_2581991_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	4.3e-47
WP_000940320.1|2581990_2582590_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000813259.1|2583058_2583214_-	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	96.1	5.5e-17
WP_000064766.1|2583844_2584822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000569066.1|2584818_2585928_-	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_000228824.1|2585920_2587048_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001151237.1|2587231_2587654_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	7.4e-64
WP_000450660.1|2587669_2588431_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_000788973.1|2588453_2589200_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000899746.1|2589206_2590064_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693802.1|2590076_2590499_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001072342.1|2590495_2590750_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2590829_2591249_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001169153.1|2591679_2591832_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000560220.1|2592252_2592474_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_001349883.1|2592473_2592644_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	6.7e-24
WP_001349884.1|2592718_2592994_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	6.3e-40
WP_000105152.1|2593095_2595696_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.8e-248
WP_000166319.1|2595688_2596498_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2596554_2596749_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2596741_2596951_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2597029_2597245_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2597246_2598482_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157422.1|2598533_2599469_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	4.5e-146
WP_000123740.1|2599597_2600971_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2601448_2602432_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|2602686_2603919_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2603080:2603095	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 8
NZ_CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	3053290	3142571	4833062	capsid,portal,protease,head,lysis,transposase,plate,tRNA,tail,integrase,terminase	Salmonella_phage(57.63%)	93	3131847:3131864	3149924:3149941
WP_000886683.1|3053290_3054583_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|3054673_3056017_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_001295343.1|3056027_3056639_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077017.1|3056793_3060861_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	9.3e-87
WP_000228473.1|3060995_3061490_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3062034_3063000_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|3063122_3064889_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|3064889_3066611_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3066652_3067357_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3067641_3067860_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934053.1|3068544_3070821_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3070851_3071172_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3071494_3071719_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188194.1|3071791_3073738_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|3073734_3074850_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001400542.1|3075000_3075957_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|3075953_3077612_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3078037_3078733_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3079227_3080127_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3080270_3081923_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3081934_3082903_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815350.1|3083035_3084754_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000566372.1|3084790_3085792_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136525.1|3085802_3087233_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3087331_3088345_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|3088341_3089172_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3089168_3089492_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270735.1|3089617_3090133_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027201.1|3090350_3091079_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.2	1.3e-28
WP_000756569.1|3091096_3091828_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3091834_3092551_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3092550_3093219_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3093510_3094242_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149734.1|3094416_3095544_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
WP_000389260.1|3095584_3096073_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3096132_3096978_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|3096974_3097928_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996018.1|3097937_3099071_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126084.1|3099165_3100278_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3100628_3101105_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3101192_3102095_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189121.1|3102155_3102878_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3102861_3103149_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3103308_3103566_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3103595_3103973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3104242_3105928_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3106163_3106382_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011811.1|3106472_3107573_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	2.5e-175
WP_000980390.1|3107569_3108055_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.3e-67
WP_001282753.1|3108051_3111129_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|3111121_3111241_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3111255_3111558_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207659.1|3111612_3112128_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_000046154.1|3112137_3113310_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_000905033.1|3113452_3114019_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_001578906.1|3114049_3114430_+	hypothetical protein	NA	I3PGW0	Xanthomonas_phage	31.8	3.0e-08
WP_085947772.1|3114449_3115663_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000378634.1|3115843_3116449_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.4	1.9e-97
WP_047598917.1|3116448_3117963_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	74.7	8.2e-206
WP_001086814.1|3117959_3118565_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	7.5e-110
WP_000268312.1|3118557_3119466_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	2.3e-142
WP_000177597.1|3119452_3119812_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993765.1|3119808_3120387_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_000339827.1|3120509_3121379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829153.1|3121434_3121881_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.3	1.9e-57
WP_001039935.1|3121873_3122305_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_001080936.1|3122400_3122829_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.0	4.6e-45
WP_000727853.1|3122825_3123203_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001069915.1|3123204_3123717_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	1.8e-88
WP_000171568.1|3123697_3123913_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868174.1|3123916_3124120_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000673523.1|3124119_3124584_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000059191.1|3124679_3125330_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742510.1|3125333_3126392_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000216237.1|3126408_3127242_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098438.1|3127384_3129151_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000520345.1|3129150_3130176_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.2	1.9e-169
WP_000818977.1|3130216_3131998_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
3131847:3131864	attL	TATTTTTTTTGAATGGAT	NA	NA	NA	NA
WP_001059831.1|3132530_3132866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3133058_3133292_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|3133302_3133491_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_000017523.1|3133643_3136058_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
WP_000104176.1|3136054_3136912_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	5.2e-157
WP_000752613.1|3136908_3137136_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244226.1|3137135_3137369_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000963473.1|3137436_3137778_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000934004.1|3137859_3138108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956172.1|3138193_3138490_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460867.1|3138497_3139007_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	86.4	1.0e-75
WP_001069047.1|3139072_3139276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000646893.1|3139335_3139986_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.2	4.2e-34
WP_000350737.1|3139986_3141438_+	NTPase KAP	NA	R9TRQ8	Vibrio_phage	29.7	1.8e-45
WP_000290919.1|3141518_3142571_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.8	2.1e-107
3149924:3149941	attR	ATCCATTCAAAAAAAATA	NA	NA	NA	NA
>prophage 9
NZ_CP026085	Escherichia coli strain DH5alpha chromosome, complete genome	4833062	3801240	3874589	4833062	protease,transposase,plate,tRNA	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_000420794.1|3801240_3802377_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001350058.1|3803247_3803685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350059.1|3803644_3807694_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_000103316.1|3807769_3809911_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|3810120_3810639_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037395.1|3811336_3811837_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3811871_3812096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|3812146_3813622_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|3813628_3814042_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|3814045_3815896_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3815859_3816942_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|3816966_3818247_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3818243_3818768_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246449.1|3818770_3820102_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343298.1|3820106_3820868_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614350.1|3820876_3823684_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.9	1.2e-80
WP_000088862.1|3823680_3824424_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240545.1|3824428_3825841_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122986077.1|3825949_3829384_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|3829394_3830747_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3830770_3831253_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|3831296_3832211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|3832220_3832700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|3832836_3833622_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|3834161_3834893_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3834957_3835425_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001298887.1|3835421_3836144_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|3836177_3836933_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3837004_3838363_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211687.1|3838410_3839181_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3839258_3840059_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648576.1|3840299_3841214_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997038.1|3841210_3842014_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_001140175.1|3847772_3848348_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3848535_3849567_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3849559_3850213_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3850252_3851068_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3851185_3851590_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3851586_3852294_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3852404_3854123_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001297208.1|3854176_3855001_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239192.1|3855155_3855866_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|3855879_3856302_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3856298_3856844_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3857009_3857210_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3857196_3857457_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|3857505_3858804_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3858868_3859258_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021030.1|3859314_3861456_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3861554_3862514_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3862526_3866009_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3866045_3866642_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|3866638_3867787_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3867786_3868575_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3868578_3869034_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|3869138_3870164_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3870167_3870653_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3870774_3873207_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001346129.1|3873236_3874589_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
