The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	7623	78745	4865660	transposase,protease	Ralstonia_phage(30.0%)	54	NA	NA
WP_011407164.1|7623_8460_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8646_9453_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9729_10923_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11076_11748_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11832_12594_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12640_13063_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13066_13480_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13775_14543_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14553_14823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|14897_16358_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17004_18015_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18286_19489_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19630_21769_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|21979_22273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22304_22802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113085515.1|23048_24029_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.2	5.3e-89
WP_011257025.1|24076_25243_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25389_25956_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27430_28639_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29266_30289_-	sugar kinase	NA	NA	NA	NA	NA
WP_011258529.1|31111_32080_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_146770128.1|32474_33704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407177.1|33685_34408_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.1e-05
WP_012443646.1|35009_36386_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_012443643.1|39398_39641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39582_39906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40371_41352_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_011407184.1|41970_43260_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_011407185.1|43699_44035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44309_44741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|45089_46499_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041181902.1|46776_46992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|47816_48077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48093_48426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48425_48884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407913.1|49243_50458_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|50978_51776_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|53491_54457_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|54453_54732_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011407196.1|54875_56195_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407197.1|56312_57359_+	methylamine utilization protein	NA	NA	NA	NA	NA
WP_011407198.1|57499_57997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703730.1|58160_58793_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_011257110.1|58809_60972_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011407199.1|61086_61272_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257109.1|61294_63898_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_094187819.1|63894_65784_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_011257107.1|65840_67598_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_011407200.1|67600_69835_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_011257104.1|71886_73515_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011257103.1|73511_74876_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257102.1|75068_76010_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_011407202.1|76250_77975_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_109181945.1|77981_78745_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	109262	135478	4865660	transposase	Ralstonia_phage(50.0%)	25	NA	NA
WP_011258529.1|109262_110231_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_109182056.1|110443_111763_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407219.1|111951_112935_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011407220.1|113656_116029_+	HPr kinase	NA	NA	NA	NA	NA
WP_012443591.1|116387_116525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257061.1|116904_118533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407223.1|119090_119474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407224.1|119470_119956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407225.1|119959_120322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407226.1|120438_121875_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_011407227.1|122116_122968_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_011257053.1|123427_123745_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011257052.1|124050_124938_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_011407229.1|125644_126595_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	3.0e-97
WP_125168735.1|126708_126918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|126985_127246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|127298_127580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162866901.1|127745_128777_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407232.1|128917_129865_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|130119_130431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257044.1|131605_131782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|131897_132368_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|132537_133230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|133321_133720_+	host attachment protein	NA	NA	NA	NA	NA
WP_115801897.1|134521_135478_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	8.1e-42
>prophage 3
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	220995	384997	4865660	holin,transposase,tRNA	Bacillus_phage(16.67%)	110	NA	NA
WP_011257198.1|220995_222900_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|223160_223340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|223473_223941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|224098_225058_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|225042_225660_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|225702_226122_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_011257201.1|226374_227280_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.2	4.4e-37
WP_011257202.1|227528_228413_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|228476_229259_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|229303_230065_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|230228_230558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|230876_231968_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|232036_233635_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|233799_235044_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|235495_236125_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|236331_238308_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|239694_240360_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257214.1|240639_241650_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|241646_242378_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|242731_244261_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|244370_247403_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257218.1|247701_250740_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|250904_251957_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|252125_252371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|252369_253335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|253334_255995_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_008573820.1|257813_258017_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257226.1|261655_262300_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|262440_263331_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|263458_263941_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|266976_267510_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011407313.1|270325_271384_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|271691_272765_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|273527_274580_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|275227_276358_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407314.1|276612_276927_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011257241.1|277674_278064_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|278271_278478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|278709_279678_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011257243.1|279931_282094_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|282641_283946_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|284005_284608_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|284604_286509_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407325.1|295827_296643_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_041182297.1|296989_297952_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|298056_298819_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|300618_301677_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|301687_301978_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|301967_302630_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|302626_303178_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|303189_303939_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|303938_304733_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|305117_305405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|305423_305981_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|305998_306964_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407336.1|307808_308765_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
WP_109182012.1|308836_309599_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|309638_310437_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|310568_311783_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_109182063.1|311842_312673_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407798.1|312835_314071_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|315469_315898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|315908_316358_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257273.1|316338_316566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|316873_318628_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|319642_320405_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|320458_321043_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|321200_322583_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407350.1|322585_324985_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|325088_327731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|328478_331928_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|332120_332705_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|333181_333958_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407355.1|334138_335440_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011257283.1|335442_335802_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|336238_337720_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|337912_338878_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|339704_341867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|341993_344162_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011407359.1|344799_345429_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011407360.1|345431_345863_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407361.1|345919_346498_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|346593_347346_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|347570_347960_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|348073_349747_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|349743_350388_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011407366.1|354072_354357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182066.1|354708_355507_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|355566_356330_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|360283_361249_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|362309_363416_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465421.1|365209_366148_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011407377.1|366266_367016_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	5.6e-54
WP_012446343.1|367018_367810_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|367827_368823_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_075242284.1|368859_369687_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011407379.1|369771_370773_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|370838_371111_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_153296754.1|371231_371393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465424.1|371596_372184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|372180_372381_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407383.1|372441_374043_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024712051.1|374074_374821_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_011407385.1|374817_376011_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407386.1|376420_377443_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|377582_379148_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|379158_380172_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|380161_380863_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|381046_384061_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_109181945.1|384234_384997_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	568940	618438	4865660	integrase,transposase,tRNA	Sinorhizobium_phage(14.29%)	43	577091:577107	615226:615242
WP_109181928.1|568940_569906_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407489.1|570373_571693_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257475.1|572222_572738_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011407490.1|573140_575363_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_103057279.1|575831_576857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959707.1|576840_577443_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
577091:577107	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_069959708.1|577773_578718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407493.1|579236_580613_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407494.1|580697_582599_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_011257482.1|582784_583000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|583106_583883_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407496.1|584044_584719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407497.1|584715_585489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257486.1|585712_586276_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011257487.1|586286_588779_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257488.1|588961_590236_-	RDD family protein	NA	NA	NA	NA	NA
WP_069959711.1|590277_591000_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257490.1|591040_591514_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_011257491.1|591556_592699_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011407499.1|592770_593907_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257493.1|594039_594552_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011257494.1|594945_595869_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011407500.1|595868_597182_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257496.1|597232_598954_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011257497.1|599118_600396_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257498.1|600593_601418_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407501.1|601421_602477_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257500.1|602642_604109_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_042465436.1|604105_604609_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257502.1|604718_605852_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_011407503.1|606094_606616_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407504.1|606815_607730_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011257505.1|607830_608271_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_103057280.1|608379_610254_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011407506.1|610446_610767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407507.1|611395_612583_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.0e-110
WP_011257520.1|612803_613010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|613006_613279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407508.1|613275_613521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257523.1|613664_613793_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011407512.1|615456_616692_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
615226:615242	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011407513.1|616760_617150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|617472_618438_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	765889	802208	4865660	transposase,tRNA	Enterobacteria_phage(36.36%)	32	NA	NA
WP_109182077.1|765889_767209_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|767524_768709_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|769238_770552_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|770541_771360_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257674.1|771582_772524_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|772523_773270_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|773495_774551_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|774606_775494_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|775490_776048_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|776044_776953_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|777069_778473_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|778519_779866_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|779999_780731_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|780730_781360_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|781417_783505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|783501_785151_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|785266_785875_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|786425_787070_-	ABC transporter	NA	NA	NA	NA	NA
WP_011257688.1|787066_787993_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|787995_788838_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|788923_790036_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|790205_791465_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|791526_791988_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|792130_793825_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|793936_794341_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|794472_795246_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|795256_795724_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011407624.1|795720_796203_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|796761_798081_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|798238_799558_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|799770_800739_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|800888_802208_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	869720	913779	4865660	transposase,protease	Ralstonia_phage(25.0%)	39	NA	NA
WP_069963827.1|869720_870686_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|871076_871652_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|871764_872274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|872372_872567_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|872656_873634_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|873863_874304_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|874581_875526_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|875608_876352_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|876556_876796_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|876937_878173_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|878343_879699_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|879759_880833_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_011257759.1|880829_881789_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|881785_882139_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_011407663.1|882662_883136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|884156_884483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|884718_886317_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|886462_887359_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|887434_888589_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257765.1|888769_891361_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_012446043.1|891444_891612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407669.1|891683_891821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407670.1|892093_893293_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011409545.1|893742_894711_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407672.1|894952_897169_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|897247_898246_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|898355_898538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464512.1|899517_902505_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041181973.1|902679_903627_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|904131_904668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116100994.1|904738_906058_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407678.1|906402_907365_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
WP_103057230.1|907498_908059_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|908101_908584_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|908746_909223_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|909633_910533_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|910772_911159_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|911788_912916_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257784.1|912915_913779_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 7
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	919079	1082436	4865660	integrase,transposase,protease	Ralstonia_phage(21.43%)	116	1010616:1010634	1079547:1079565
WP_011257788.1|919079_919862_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_115840190.1|919972_921349_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	4.3e-76
WP_011257791.1|921592_922228_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|922854_923388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257793.1|923513_923711_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|923720_924833_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|924813_926148_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257796.1|926381_927302_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|927378_928695_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|928967_930347_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|930367_931024_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|931152_931806_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|932076_932538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703665.1|933597_934482_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|934602_936051_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|936118_936766_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|937582_938656_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|938986_940549_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|940545_941670_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|941745_942003_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|941986_943708_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|943751_944753_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|946029_947907_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|948332_950684_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|950794_951688_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407696.1|951736_954703_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011257817.1|955317_956466_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|956579_957116_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|957312_957795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|960070_961036_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|961032_961206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|961490_961982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|963661_964918_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|965077_965641_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|966007_967366_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|967365_967962_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|968108_968993_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|970974_971589_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|971671_972658_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|972773_973268_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|973512_975342_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|975360_975831_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|976753_977881_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|977981_979364_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|979611_981735_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|982263_982782_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_116100996.1|983489_984591_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|985106_986342_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407710.1|986955_987846_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_011407713.1|991635_992871_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|993853_995173_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|995918_996842_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|997904_998870_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|999171_1000749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|1000816_1001580_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1004248_1005217_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1005477_1005939_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1006487_1006730_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1006723_1007487_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1007519_1008251_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1010070_1010823_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1010616:1010634	attL	GCGACAGCGGCTACACCGG	NA	NA	NA	NA
WP_109181948.1|1010824_1011790_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1012053_1013061_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1013204_1013966_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|1017283_1018576_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1018668_1019295_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1019419_1020706_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1020849_1023321_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1023534_1023807_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1024638_1026609_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1027314_1028493_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1028489_1029257_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1029269_1029926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1029953_1030406_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1030414_1031149_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|1031584_1032289_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041181989.1|1033114_1033744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1034635_1034836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082325231.1|1035231_1037955_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.8e-71
WP_069960070.1|1038022_1040173_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1040169_1041867_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257897.1|1042186_1044391_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_011257898.1|1044387_1046082_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1046078_1046342_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_109182093.1|1046403_1048611_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_011407737.1|1048607_1050287_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1050283_1050547_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1050608_1051166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182094.1|1051248_1052214_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1052312_1052999_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1053109_1053514_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1053724_1054774_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1054794_1055544_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1055543_1056293_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1056292_1057324_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1057341_1057701_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1057725_1058223_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1058219_1058465_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1058461_1058908_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1059469_1061566_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1061572_1061893_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1061990_1062584_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1062685_1063036_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1063155_1063689_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011257916.1|1063685_1065638_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1065630_1066587_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1066592_1067546_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1067584_1069453_+	membrane protein	NA	NA	NA	NA	NA
WP_011407749.1|1070968_1071484_+	peptide deformylase	NA	NA	NA	NA	NA
WP_103057268.1|1072000_1072759_+	cellulase	NA	NA	NA	NA	NA
WP_041182379.1|1073231_1073978_+	cellulase	NA	NA	NA	NA	NA
WP_011407751.1|1074594_1076196_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1077184_1078420_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|1079248_1080217_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
1079547:1079565	attR	CCGGTGTAGCCGCTGTCGC	NA	NA	NA	NA
WP_075241901.1|1080684_1081035_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011407756.1|1081116_1082436_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	1121166	1163612	4865660	transposase	Leptospira_phage(25.0%)	41	NA	NA
WP_109182097.1|1121166_1122268_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_011407778.1|1123698_1124322_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1124345_1124585_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1124634_1125516_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1125665_1126115_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011407781.1|1126265_1126913_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1127004_1127475_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1127471_1128062_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1128670_1128970_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1128966_1129188_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1129423_1129966_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1129976_1131317_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_162013040.1|1131834_1131993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|1132024_1132788_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1133020_1134346_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1134544_1134892_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1134888_1137297_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1137475_1138633_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1138648_1139248_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1139244_1139640_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1139636_1140362_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1140471_1141332_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1141448_1142060_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1142240_1143038_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1143186_1143486_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1143614_1145786_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1145865_1146246_+	RidA family protein	NA	NA	NA	NA	NA
WP_011407792.1|1146266_1148420_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257989.1|1148545_1149484_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1149555_1149798_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1150011_1151301_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|1151677_1152328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257992.1|1152637_1155067_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1155282_1156341_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1156340_1157099_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1157095_1157761_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1157757_1158291_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1158310_1160260_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_094187763.1|1160330_1161129_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257854.1|1161271_1162507_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011407799.1|1162577_1163612_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	1202829	1234670	4865660	transposase	Feldmannia_irregularis_virus(16.67%)	25	NA	NA
WP_109181945.1|1202829_1203592_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|1203681_1204647_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1204756_1206076_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1206538_1207216_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1207295_1207685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1207898_1208786_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_113081219.1|1209219_1210204_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	6.3e-98
WP_011407838.1|1210379_1212467_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1212618_1213278_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1213358_1214156_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407841.1|1214178_1214358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1214376_1214781_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1214814_1215174_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1215417_1216290_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1216362_1217589_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1217833_1218451_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_042464589.1|1219987_1221595_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011258050.1|1221591_1222017_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1222041_1222545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1223987_1224437_+	azurin	NA	NA	NA	NA	NA
WP_011407853.1|1227683_1228973_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407854.1|1229258_1232438_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258055.1|1232934_1233804_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|1233825_1234497_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|1234493_1234670_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	1449950	1588240	4865660	transposase,tRNA	Ralstonia_phage(19.23%)	109	NA	NA
WP_109181897.1|1449950_1450916_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182392.1|1451268_1451973_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1452510_1452735_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_011407979.1|1452734_1454807_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_011407980.1|1455038_1455896_+	pirin family protein	NA	NA	NA	NA	NA
WP_082323236.1|1456931_1459334_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_027704078.1|1459388_1460249_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075241467.1|1460317_1460896_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044757488.1|1460885_1462298_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_044757009.1|1462307_1464731_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.4e-37
WP_103057235.1|1464727_1465675_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_158645225.1|1465890_1466274_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|1466668_1467217_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|1467611_1468169_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407990.1|1468218_1470327_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069964947.1|1470348_1472250_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
WP_027704078.1|1472304_1473165_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075251795.1|1473233_1473812_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_113101709.1|1474275_1474509_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258252.1|1474505_1474658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407994.1|1474729_1475296_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_012444346.1|1475292_1475445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407995.1|1475498_1476086_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_154583424.1|1476082_1476235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162013049.1|1476438_1476873_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069959784.1|1476869_1479278_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1479622_1480084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408000.1|1480330_1481221_-	pirin family protein	NA	NA	NA	NA	NA
WP_125168744.1|1481398_1481917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|1481988_1482702_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_011258259.1|1482805_1483555_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_042465485.1|1483915_1484167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408003.1|1484499_1486557_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	28.6	1.2e-79
WP_069960076.1|1488504_1489626_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_012444362.1|1489640_1490447_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_069959785.1|1490451_1491735_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011408007.1|1491761_1492277_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069959786.1|1492287_1494444_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_011408009.1|1494511_1496509_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1496527_1496857_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_125168745.1|1496896_1497115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756996.1|1497346_1500811_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_011258270.1|1501213_1501756_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1502167_1503076_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_094187763.1|1503421_1504220_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|1504363_1505083_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_109181900.1|1505238_1506273_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|1507023_1507992_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011408014.1|1509001_1509385_+	membrane protein	NA	NA	NA	NA	NA
WP_011408015.1|1509507_1510677_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_162866902.1|1510671_1511703_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.0e-71
WP_011408017.1|1511790_1512603_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1513118_1513502_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|1513660_1514824_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408020.1|1514854_1515667_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011258529.1|1516353_1517322_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011407237.1|1517943_1518900_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075242217.1|1518973_1519705_+	nitrilase	NA	NA	NA	NA	NA
WP_069960180.1|1519726_1520830_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_011258289.1|1520898_1522302_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1522315_1522822_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1523227_1523686_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1524463_1524667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|1526228_1526714_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1526941_1527157_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1527407_1527887_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011408031.1|1528018_1528447_-	cytochrome c	NA	NA	NA	NA	NA
WP_011258297.1|1528519_1529350_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011408032.1|1529411_1530179_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258299.1|1530178_1530394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1530539_1531331_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_041182398.1|1531488_1532652_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408036.1|1534885_1535524_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1535699_1537640_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1537856_1538411_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_103057262.1|1538632_1540063_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	1.1e-119
WP_012444398.1|1540165_1541584_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011258309.1|1542000_1542726_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011408038.1|1542824_1543235_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182034.1|1543286_1544243_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011408040.1|1544486_1546868_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011408042.1|1550223_1550406_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258316.1|1550538_1551579_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1551651_1553097_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011258802.1|1554627_1555596_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408046.1|1555946_1556492_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_011408047.1|1556488_1557952_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1559412_1559667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258324.1|1560069_1560603_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|1560628_1561030_+	membrane protein	NA	NA	NA	NA	NA
WP_011408050.1|1560998_1561379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1561375_1561618_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_075239995.1|1561654_1562305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258329.1|1562981_1564886_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_011408052.1|1565149_1567546_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011408053.1|1567695_1568418_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258334.1|1571337_1571838_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075241746.1|1571779_1573456_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1573602_1574868_+	potassium transporter	NA	NA	NA	NA	NA
WP_011408056.1|1574926_1576120_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011408057.1|1576116_1576806_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011408058.1|1576911_1578381_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1578400_1579237_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1579262_1580366_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011408060.1|1580362_1583419_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258343.1|1583484_1584075_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011258344.1|1584206_1586039_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_094187715.1|1586114_1586878_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|1586920_1588240_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	1719080	1784955	4865660	transposase,tRNA	Bacillus_phage(20.0%)	42	NA	NA
WP_011257310.1|1719080_1720316_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1720366_1721130_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959795.1|1721196_1722573_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_008578058.1|1722951_1723626_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_011408164.1|1724256_1724661_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|1724739_1725237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959808.1|1725375_1727172_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408166.1|1727727_1728273_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959809.1|1728374_1732496_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408167.1|1732716_1735359_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182063.1|1736800_1738315_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_094187715.1|1738485_1739248_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408171.1|1739559_1740072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408172.1|1740134_1741253_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408173.1|1741249_1741528_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408174.1|1741524_1742277_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011258497.1|1742273_1743173_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|1743256_1743337_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_042464698.1|1743626_1745813_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042465507.1|1746123_1747566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756949.1|1747898_1750001_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069959810.1|1750242_1752687_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_011408178.1|1752700_1753225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408179.1|1753424_1755452_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408180.1|1755465_1756185_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011258505.1|1756181_1757096_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
WP_011258506.1|1757390_1758266_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_044756943.1|1758262_1759213_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005913706.1|1759462_1759864_+	response regulator	NA	NA	NA	NA	NA
WP_011258508.1|1759881_1760244_+	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_003482487.1|1760243_1760774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116101002.1|1760813_1762850_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.5	6.2e-23
WP_069963843.1|1762963_1769890_+	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011408184.1|1769897_1771100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258512.1|1771133_1771610_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011258513.1|1771860_1772484_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408185.1|1772495_1773578_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258518.1|1778199_1779264_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_011258519.1|1779260_1779992_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_041182065.1|1780016_1781705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258521.1|1782116_1783220_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_011408191.1|1783719_1784955_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	1925939	1984727	4865660	tRNA,transposase,protease	Acidithiobacillus_phage(25.0%)	48	NA	NA
WP_011258626.1|1925939_1928768_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1928828_1929929_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|1930397_1930925_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1931326_1931500_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1931660_1931915_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258631.1|1932089_1932356_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_041182418.1|1932546_1933113_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_109181915.1|1934600_1935920_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|1936312_1936498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445232.1|1936687_1938064_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011408277.1|1938203_1938677_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408279.1|1940348_1941398_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|1941512_1941848_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|1942136_1942427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408282.1|1943317_1944436_-	alkene reductase	NA	NA	NA	NA	NA
WP_103057305.1|1944656_1945868_+	MFS transporter	NA	NA	NA	NA	NA
WP_011258643.1|1947790_1948246_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011408284.1|1948519_1949122_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|1949157_1949766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|1949825_1950020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408285.1|1950089_1951460_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_109181916.1|1951744_1952507_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408287.1|1952898_1955463_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011408290.1|1956443_1956791_+	RidA family protein	NA	NA	NA	NA	NA
WP_011408291.1|1956952_1958023_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408292.1|1958040_1958823_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011408293.1|1958819_1959365_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_011408294.1|1959361_1960657_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
WP_011408295.1|1960653_1961538_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_011408296.1|1961537_1962788_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011408297.1|1962784_1963783_-	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_012445217.1|1964008_1964842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|1964838_1965402_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012445216.1|1965460_1965829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464748.1|1965914_1966697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408301.1|1967315_1967744_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_041182084.1|1967745_1968342_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011258663.1|1968549_1970634_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408302.1|1970858_1971308_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_162866904.1|1972098_1973130_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408305.1|1973400_1974798_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408306.1|1974794_1975772_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_069959816.1|1975953_1977891_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|1978311_1979088_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|1979092_1979767_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_116101041.1|1981397_1982774_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011408311.1|1982813_1983209_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069959817.1|1983251_1984727_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
>prophage 13
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	2078869	2199359	4865660	transposase,tRNA	Ralstonia_phage(17.39%)	89	NA	NA
WP_011408357.1|2078869_2080189_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408358.1|2080523_2081450_-	TolC family protein	NA	NA	NA	NA	NA
WP_011258748.1|2081579_2082185_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408359.1|2082523_2084293_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_027703751.1|2084289_2084892_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	4.8e-16
WP_011258751.1|2085150_2085744_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_011258752.1|2085942_2087379_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-38
WP_011258753.1|2087620_2088823_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_011258754.1|2088865_2091694_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011408361.1|2091874_2092807_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408362.1|2092803_2094303_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2094640_2094904_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011258758.1|2095183_2095684_-	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_011258759.1|2095925_2097293_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_109181925.1|2100316_2101079_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408367.1|2102531_2103935_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_042464794.1|2104057_2104480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|2105112_2105949_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_075242602.1|2105958_2106945_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011258772.1|2106941_2107817_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_011408371.1|2107813_2108176_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2108178_2108427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2108562_2109120_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2109211_2110177_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408374.1|2110202_2111552_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_011258777.1|2111544_2111781_+	protein SlyX	NA	NA	NA	NA	NA
WP_042464803.1|2111781_2112534_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_042464805.1|2112867_2113713_+	transporter	NA	NA	NA	NA	NA
WP_041182423.1|2113853_2115029_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011408378.1|2115042_2116353_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011408379.1|2116349_2117336_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011408380.1|2117332_2118538_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011408381.1|2118924_2121678_-	methionine synthase	NA	NA	NA	NA	NA
WP_103057265.1|2121820_2122960_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2122956_2123952_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_011408383.1|2124040_2125222_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464808.1|2125221_2125362_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042464810.1|2125733_2127179_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258790.1|2127745_2130274_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_109181926.1|2130484_2131283_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258793.1|2132353_2133121_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011408388.1|2133122_2133470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2133628_2134597_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115801893.1|2135949_2136915_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2137359_2138544_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_116101003.1|2138598_2140074_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011258799.1|2140395_2140578_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2140726_2141926_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258802.1|2142786_2143755_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258803.1|2143946_2144915_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_109181933.1|2146091_2147194_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_027704061.1|2147380_2147848_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408403.1|2148208_2148868_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2148979_2150329_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187728.1|2150478_2151277_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408404.1|2151716_2153036_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2153248_2154217_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011408405.1|2154280_2154865_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2154964_2155978_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296745.1|2156668_2156941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082336051.1|2157347_2160947_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408408.1|2161086_2161386_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_042464821.1|2161389_2161584_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_116101005.1|2161852_2165575_-	avirulence protein	NA	NA	NA	NA	NA
WP_069959831.1|2168842_2172970_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408412.1|2173258_2174578_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464827.1|2176409_2177495_-	peptidase C13	NA	NA	NA	NA	NA
WP_011408416.1|2177822_2178521_-	acireductone synthase	NA	NA	NA	NA	NA
WP_011408417.1|2178523_2179090_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408418.1|2179101_2179779_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_069959832.1|2179867_2181298_-	amino acid permease	NA	NA	NA	NA	NA
WP_033013325.1|2181374_2182847_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258841.1|2182992_2183580_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2183735_2184977_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258843.1|2185185_2186604_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011408424.1|2186638_2186938_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258845.1|2186934_2188806_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_041182103.1|2189095_2190109_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258848.1|2190108_2190540_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258849.1|2190536_2191139_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011408426.1|2191131_2193069_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258851.1|2193237_2193708_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011258852.1|2193704_2193875_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011408427.1|2193871_2194624_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258853.1|2194718_2195414_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408428.1|2195410_2196055_-	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011408429.1|2196281_2197430_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408430.1|2197569_2198373_+	amidohydrolase	NA	NA	NA	NA	NA
WP_109181928.1|2198393_2199359_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	2281537	2345677	4865660	transposase,tRNA	Xanthomonas_phage(88.24%)	54	NA	NA
WP_041182113.1|2281537_2282494_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	2.4e-41
WP_012444969.1|2283053_2283188_-	aspartate racemase	NA	NA	NA	NA	NA
WP_012444967.1|2283378_2284290_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011408479.1|2284283_2285336_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_011258927.1|2285332_2286388_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_011408480.1|2286393_2287161_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408481.1|2287163_2287448_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_011258930.1|2288036_2289569_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408482.1|2290872_2293380_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_011258933.1|2293376_2294345_+	homoserine kinase	NA	NA	NA	NA	NA
WP_024710669.1|2297280_2297595_-	EthD family reductase	NA	NA	NA	NA	NA
WP_011258935.1|2297756_2299061_+	threonine synthase	NA	NA	NA	NA	NA
WP_041182115.1|2299163_2299907_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_012444952.1|2301171_2302584_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187798.1|2303089_2303888_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2304201_2304528_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2304537_2305452_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2305448_2306744_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011408488.1|2306740_2307832_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2307828_2308956_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2308952_2309555_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2309551_2310286_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2310279_2311056_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2311045_2311666_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_116101007.1|2312251_2316106_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2316330_2316630_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2316633_2316828_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_137455828.1|2317095_2320479_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258951.1|2320936_2321716_-	pectate lyase	NA	NA	NA	NA	NA
WP_075239627.1|2321757_2321856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408500.1|2322192_2322576_+	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	100.0	1.7e-70
WP_011408501.1|2322747_2323395_-	conjugal transfer protein TrbP	NA	A0A1D6ZIU7	Xanthomonas_phage	100.0	3.0e-120
WP_011408502.1|2323396_2324584_-	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	100.0	2.8e-217
WP_011408503.1|2324583_2324913_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_042464851.1|2324912_2326319_-	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	100.0	6.4e-245
WP_011408505.1|2326455_2326686_-	hypothetical protein	NA	A0A1D6ZIT7	Xanthomonas_phage	100.0	1.7e-30
WP_042464854.1|2326697_2326901_-	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_011408506.1|2326904_2327201_-	DNA-binding protein	NA	A0A1D6ZIU6	Xanthomonas_phage	100.0	3.6e-49
WP_042464857.1|2327197_2328139_-	inovirus-type Gp2 protein	NA	A0A1D6ZIT9	Xanthomonas_phage	100.0	1.0e-182
WP_134953795.1|2328224_2328410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408508.1|2328390_2328603_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_069970101.1|2328915_2329545_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408511.1|2329669_2329852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2329973_2330285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|2330354_2331117_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168752.1|2331621_2331945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116101008.1|2332375_2333353_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408516.1|2333653_2334166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|2334298_2335061_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_116101010.1|2336366_2340080_+	avirulence protein	NA	NA	NA	NA	NA
WP_041182100.1|2340348_2340543_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408491.1|2340546_2340846_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069964534.1|2341069_2344825_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|2344914_2345677_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	2350865	2402743	4865660	transposase	Staphylococcus_prophage(20.0%)	43	NA	NA
WP_012444927.1|2350865_2351042_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_116101014.1|2351038_2351710_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_125168753.1|2352735_2352981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|2352964_2353921_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258803.1|2354335_2355304_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_041182129.1|2355448_2356414_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2356391_2360492_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408522.1|2360800_2361985_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2362035_2362935_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2363101_2363608_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2364082_2364715_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2364714_2366571_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258970.1|2366567_2367986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2368009_2368474_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258972.1|2368470_2369250_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2369541_2370582_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2370578_2372348_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2372344_2372809_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2372812_2373475_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2373503_2375912_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2376165_2377131_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2378524_2379259_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2379251_2380493_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2380516_2380969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2380919_2381168_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2381278_2382061_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_027703324.1|2382077_2382281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2382290_2384081_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2384115_2384502_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2384498_2384894_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_005929790.1|2384953_2385124_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2385163_2386036_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2386164_2387262_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2387694_2389125_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2389121_2390129_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2390125_2390845_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_103057278.1|2390947_2392864_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2392919_2393579_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_027703995.1|2395205_2395409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239633.1|2395405_2395795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2396424_2396805_+	response regulator	NA	NA	NA	NA	NA
WP_011408539.1|2397019_2400415_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|2401980_2402743_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	2516817	2564913	4865660	transposase,tRNA	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|2516817_2518212_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2518213_2518471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2518467_2518773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2518769_2519096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2519822_2520485_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2520573_2521104_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2523327_2524599_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2524770_2526138_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2526441_2527887_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2527883_2528570_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2528542_2529562_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2529603_2530164_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2530184_2531141_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2531308_2532085_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2532568_2534704_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2534700_2534892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2536666_2537173_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2537213_2537741_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2537737_2538229_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2538252_2538828_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2538904_2539858_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2539946_2540819_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408616.1|2540815_2541661_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2541773_2542472_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2542635_2543418_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2543426_2543807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2543803_2544514_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2545824_2546373_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011258803.1|2546544_2547513_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011408623.1|2548117_2549353_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2549916_2550237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2550576_2551827_+	porin	NA	NA	NA	NA	NA
WP_011408625.1|2552015_2553035_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	1.6e-48
WP_011408626.1|2553222_2554314_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|2554426_2555401_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2555400_2556270_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2556292_2557123_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2557251_2557962_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|2558094_2558502_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|2558785_2559421_+	ribonuclease T	NA	NA	NA	NA	NA
WP_011408631.1|2559491_2560811_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2561047_2562109_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2562159_2563344_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181954.1|2563593_2564913_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	2571632	2643945	4865660	protease,transposase,tRNA	uncultured_Mediterranean_phage(33.33%)	53	NA	NA
WP_011259125.1|2571632_2572778_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2572847_2573918_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2574104_2574536_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408638.1|2574659_2576156_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|2576500_2577208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|2580569_2581691_-	phytase	NA	NA	NA	NA	NA
WP_041182147.1|2583963_2584431_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2584581_2585214_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187736.1|2585610_2586373_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2586653_2587685_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2587691_2589485_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2589481_2589766_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|2589997_2590495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2590541_2591048_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2591044_2591665_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2591905_2593810_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_162866905.1|2593897_2594928_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2595052_2596372_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2596605_2597763_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2598039_2599005_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2598982_2600458_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_162013043.1|2600493_2600700_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2602274_2603243_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|2604157_2605126_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075245207.1|2605393_2605627_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2607507_2608728_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2609042_2610440_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011408657.1|2610450_2611668_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2611667_2612306_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2612376_2613237_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2613233_2614022_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2614032_2615238_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2615256_2615682_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2615901_2616534_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2616558_2618931_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2619088_2620294_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259173.1|2620614_2621946_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011408659.1|2621942_2622293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2622324_2622732_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2622728_2623055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2623086_2624463_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|2624699_2628866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703232.1|2628978_2629650_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259179.1|2629714_2631643_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2631805_2634166_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259181.1|2634449_2635418_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_116101016.1|2635475_2636597_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2638024_2638777_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2638857_2639076_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|2639356_2641639_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|2641782_2642103_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2642353_2642812_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2642808_2643945_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 18
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	2725902	2751540	4865660	transposase	Bacillus_phage(50.0%)	15	NA	NA
WP_115801909.1|2725902_2727222_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2727371_2728340_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_125168757.1|2729964_2730444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2738568_2738961_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2738969_2739431_+	cytochrome c	NA	NA	NA	NA	NA
WP_041182155.1|2739935_2740196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133264955.1|2740726_2740981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408705.1|2740984_2741161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116101018.1|2741953_2742919_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_082323190.1|2742925_2744224_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408708.1|2744392_2746078_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_103057301.1|2746074_2747811_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_082325289.1|2748410_2749367_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
WP_011259267.1|2750169_2750433_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_115840191.1|2750574_2751540_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	2768424	2829020	4865660	protease,transposase,tRNA	Moumouvirus(10.0%)	53	NA	NA
WP_012444736.1|2768424_2769849_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2770346_2770784_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2770780_2772031_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2772098_2773160_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2773302_2774343_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011408727.1|2774427_2774715_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2774711_2776061_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011408729.1|2776060_2776900_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_094187715.1|2777798_2778561_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2778587_2778851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2779222_2779711_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_116101020.1|2779934_2781254_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2781390_2782359_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109181979.1|2782558_2783875_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|2784234_2785416_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_011259303.1|2787004_2788675_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_011259304.1|2788891_2789581_-	phytoene synthase	NA	NA	NA	NA	NA
WP_011408736.1|2789609_2790314_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259306.1|2790387_2791107_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_027703270.1|2791137_2792475_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_041182450.1|2792494_2793298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802373.1|2793489_2794056_-	elongation factor P	NA	NA	NA	NA	NA
WP_011408738.1|2794157_2795186_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011259310.1|2795404_2797522_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259311.1|2797518_2798448_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011408739.1|2798499_2799264_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011408740.1|2799382_2800216_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011259314.1|2800468_2801080_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011259315.1|2801334_2801775_+	ribonuclease	NA	NA	NA	NA	NA
WP_011259316.1|2801771_2802197_+	barstar family protein	NA	NA	NA	NA	NA
WP_011259317.1|2802645_2804541_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.4e-48
WP_103057284.1|2804630_2806007_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	2.1e-54
WP_011259319.1|2806109_2806670_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
WP_011408741.1|2806767_2808324_-	YdiU family protein	NA	NA	NA	NA	NA
WP_011408742.1|2808607_2809483_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408743.1|2809683_2810382_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011408744.1|2810552_2810762_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
WP_011408745.1|2811031_2811517_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011259325.1|2811587_2812136_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_011259326.1|2812132_2813314_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012444707.1|2813537_2815607_+	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011259328.1|2815706_2816585_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2816682_2817582_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2817669_2818410_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2818569_2819145_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2819318_2820290_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011408750.1|2820323_2821265_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2821264_2823142_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_012444702.1|2823279_2825013_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|2825065_2825566_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_075243426.1|2825562_2827050_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|2827074_2828142_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_109181945.1|2828256_2829020_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	2832215	2918077	4865660	tRNA,transposase,protease	Bacillus_phage(18.18%)	57	NA	NA
WP_094187754.1|2832215_2832963_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2833279_2835115_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_041182166.1|2835386_2836478_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|2837570_2837972_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|2838835_2839015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2839616_2839907_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2839894_2840173_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_027703931.1|2840657_2840858_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408760.1|2841618_2842803_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109181928.1|2843383_2844349_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|2848913_2849258_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2849468_2849795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2849827_2850268_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|2850346_2850982_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011259354.1|2851375_2852134_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|2852126_2853386_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|2853385_2854030_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|2854559_2855546_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|2857481_2858936_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2859359_2860346_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2860757_2861420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2861474_2861960_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2861959_2862478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2862572_2863451_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2863447_2864728_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2864743_2865745_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2865896_2867261_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|2867515_2867926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2868081_2868912_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2869225_2870473_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011408777.1|2870618_2872112_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2872116_2873703_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2873699_2874902_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115840172.1|2875408_2876797_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|2877030_2878416_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|2879323_2880703_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408783.1|2880702_2882019_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011259379.1|2882101_2883400_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.7e-19
WP_011408784.1|2883707_2884988_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_011408785.1|2885293_2885572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|2885561_2887910_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|2887906_2888752_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_069964545.1|2888758_2890468_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_075242096.1|2890610_2890793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182012.1|2890825_2891588_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259384.1|2891813_2893166_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011408787.1|2893226_2896364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408788.1|2896530_2897385_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_011408789.1|2897555_2898860_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_011408790.1|2899001_2903096_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_011259389.1|2903129_2904116_+	response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
WP_011408791.1|2904240_2905224_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.4e-97
WP_011408792.1|2905672_2910697_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_011408793.1|2910974_2911634_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408794.1|2911648_2912953_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|2912965_2916136_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_109181969.1|2917111_2918077_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	2927431	3000628	4865660	transposase	uncultured_Caudovirales_phage(57.14%)	48	NA	NA
WP_011258188.1|2927431_2928400_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_155296181.1|2928514_2928670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2929278_2930247_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182891.1|2932217_2932949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325293.1|2932980_2935323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2935347_2936076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|2936104_2938447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|2938471_2939215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115840173.1|2939245_2942080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964550.1|2942076_2943006_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964551.1|2943014_2945777_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
WP_041182637.1|2950661_2951051_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|2951211_2952165_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2952097_2952412_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|2952639_2953959_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259409.1|2955063_2955480_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011259410.1|2955476_2955923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259411.1|2956165_2956801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2957300_2958269_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168758.1|2958925_2959426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|2959734_2962836_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|2963825_2964278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|2964532_2966338_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_125168759.1|2966339_2966687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756757.1|2966762_2967470_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_011408825.1|2967621_2968014_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011408826.1|2968060_2968552_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|2968548_2968902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|2968990_2969731_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|2969737_2970712_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|2970713_2971496_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|2971492_2972515_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|2972615_2972924_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|2972920_2973286_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011408829.1|2973319_2975329_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|2975496_2975751_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103057304.1|2977432_2978119_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	1.8e-11
WP_011408833.1|2978434_2979196_+	transporter	NA	NA	NA	NA	NA
WP_011408834.1|2979209_2981552_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_115840174.1|2982048_2983014_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756755.1|2983253_2985500_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_042465628.1|2986228_2988340_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_069959907.1|2989024_2991100_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_011259431.1|2991692_2993954_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011408839.1|2994347_2996609_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_011408840.1|2997578_2998364_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|2998499_2998982_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187763.1|2999830_3000628_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	3079803	3091578	4865660	tRNA	Escherichia_phage(22.22%)	12	NA	NA
WP_011259503.1|3079803_3080103_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3080145_3080376_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3080619_3081369_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3081373_3082069_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_012444559.1|3082254_3082554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3082941_3083346_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3084071_3084284_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3084423_3087072_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3087173_3087662_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3087964_3088999_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3089171_3089813_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3089901_3091578_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 23
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	3114252	3190242	4865660	transposase	Brazilian_cedratvirus(20.0%)	57	NA	NA
WP_094187731.1|3114252_3115051_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259536.1|3115465_3116974_+	S10 family peptidase	NA	NA	NA	NA	NA
WP_011408900.1|3117031_3117793_-	YdcF family protein	NA	NA	NA	NA	NA
WP_011259538.1|3117869_3118997_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_011408901.1|3119006_3119633_-	DUF47 family protein	NA	NA	NA	NA	NA
WP_011259540.1|3119905_3121246_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_011408903.1|3121930_3122431_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011259543.1|3122491_3123493_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259544.1|3124297_3125713_+	MFS transporter	NA	NA	NA	NA	NA
WP_012444535.1|3126020_3127742_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.0	3.6e-08
WP_011408904.1|3127835_3128894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444533.1|3129026_3130547_+	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_011259548.1|3130636_3131851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|3131957_3132914_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011259549.1|3133012_3134125_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041182180.1|3134121_3135252_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011408908.1|3135373_3136072_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027703449.1|3136068_3137304_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011259553.1|3137316_3138159_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011259554.1|3138439_3139291_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_042465636.1|3139336_3140470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259555.1|3140466_3141417_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011408910.1|3141413_3142667_-	O-antigen translocase	NA	NA	NA	NA	NA
WP_011408911.1|3142663_3143776_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.4	1.4e-29
WP_011408912.1|3143775_3144708_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408913.1|3144694_3145648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408914.1|3145651_3146323_-	acetyltransferase	NA	NA	NA	NA	NA
WP_011408915.1|3146319_3146751_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_041182464.1|3147145_3147676_+	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_012444527.1|3147759_3149100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408918.1|3149125_3149518_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033013216.1|3149960_3150749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408920.1|3150812_3151394_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012444524.1|3151390_3152047_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_011259567.1|3152043_3153369_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
WP_011259568.1|3153379_3154138_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011408923.1|3154134_3154341_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011259569.1|3154337_3154808_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011408924.1|3154871_3156860_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011259571.1|3156856_3157399_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_027703454.1|3157398_3157896_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011408926.1|3157895_3158600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116101026.1|3158808_3163458_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444515.1|3164520_3165996_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
WP_011408934.1|3166078_3168667_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3168723_3169836_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3169960_3170539_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465046.1|3172031_3174119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959920.1|3174504_3175602_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465048.1|3176018_3179099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|3182134_3182842_+	response regulator	NA	NA	NA	NA	NA
WP_011408941.1|3182838_3183831_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3183827_3186287_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3186400_3187381_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|3187389_3188418_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|3188584_3189382_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|3189444_3190242_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	3199668	3261769	4865660	plate,transposase	Ralstonia_phage(85.71%)	49	NA	NA
WP_011408949.1|3199668_3201006_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069959924.1|3201002_3202394_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|3202390_3202930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|3202938_3204876_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|3205140_3205599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|3205984_3206479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|3206544_3207042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408953.1|3207230_3209936_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	4.3e-80
WP_011408954.1|3209968_3210979_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3210942_3212820_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3212823_3213327_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3213314_3214148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3214183_3214687_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3214786_3216301_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3216293_3216800_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|3218158_3219127_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|3219262_3220579_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260830.1|3220749_3221985_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3222170_3223139_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408960.1|3223190_3225107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|3225131_3225869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3225899_3228242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3228259_3229006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3229034_3231869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465054.1|3232526_3234356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3234369_3234969_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3235056_3235413_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3235409_3235832_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3235847_3236081_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_069960235.1|3236107_3236368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704270.1|3236716_3238501_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_027704269.1|3238533_3239520_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3239930_3243644_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3244169_3244933_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408973.1|3245906_3246668_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011258802.1|3246825_3247794_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408974.1|3247927_3248293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3248351_3248783_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3248794_3250057_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3250040_3251333_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3251702_3252473_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3253229_3254465_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3255764_3256022_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3256461_3257445_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011258802.1|3257760_3258729_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408981.1|3258857_3259820_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3260069_3260228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3260259_3260439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3260803_3261769_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	3415284	3475639	4865660	protease,transposase,tRNA	Burkholderia_virus(14.29%)	50	NA	NA
WP_094187736.1|3415284_3416048_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259756.1|3417071_3419438_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3419434_3420109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3420318_3421257_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3421379_3422729_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3422725_3423613_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3423930_3424737_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3425182_3426400_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3426505_3427474_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3427816_3428485_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3428481_3429255_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075241401.1|3429828_3431781_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3432461_3433487_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3433571_3434645_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3434637_3435741_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3435751_3436678_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3436758_3437409_+	SCO family protein	NA	NA	NA	NA	NA
WP_027703264.1|3437405_3438254_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3438804_3440388_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103057205.1|3441810_3443028_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3442988_3443276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3443386_3443893_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_011259780.1|3444014_3445415_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012445553.1|3445677_3446253_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3446249_3446684_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3446711_3446879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|3447572_3447758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3447792_3448362_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3448454_3449306_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3450693_3452709_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3452979_3453678_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3453718_3454126_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3454563_3455526_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3456809_3458060_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3458067_3459312_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3459539_3460019_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3460129_3460666_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3460775_3461525_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3461732_3462224_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3463337_3464657_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_069963877.1|3464800_3466507_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409090.1|3466540_3467845_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3467876_3468137_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3468138_3469014_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3470848_3471313_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3471364_3471553_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|3471525_3471846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3471842_3473210_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3473355_3473937_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3474193_3475639_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 26
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	3494739	3543410	4865660	integrase,transposase,tRNA	Ralstonia_phage(33.33%)	37	3516712:3516771	3536340:3537159
WP_011409106.1|3494739_3497382_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3497454_3498066_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3498270_3499128_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3499383_3499833_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|3500132_3501098_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3501222_3501985_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3502595_3502889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3503362_3503596_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3503629_3504643_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3504610_3504802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801901.1|3504892_3506212_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3506299_3507514_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3507659_3508187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115840178.1|3508183_3509149_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3509389_3510152_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3510454_3512587_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258802.1|3513137_3514106_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258188.1|3514266_3515235_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115840192.1|3515379_3516345_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_052285784.1|3516391_3516724_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3516712:3516771	attL	TAGGGTCTGTTAACACATCCGAAGCCCATCAACGACCAGAACGAAGCTGAGGAAGCCAAG	NA	NA	NA	NA
WP_094187715.1|3516720_3517484_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|3518355_3519153_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3519186_3519579_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3519669_3520062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3522400_3522820_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3524536_3526321_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3526511_3526712_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3527247_3528042_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3528343_3529102_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3529177_3531040_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3531097_3531439_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3531698_3531974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3535020_3535734_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012445603.1|3535794_3536217_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3536348_3537112_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3540185_3541097_-	RNA methyltransferase	NA	NA	NA	NA	NA
3536340:3537159	attR	TAGGGTCTGTTAACACATCCGAAGCCCATCAACGACCAGAACGAAGCTGAGGAAGCCAAGGAACATGACATCCAGCTTCTCGAAGCGCGTGAAAATCCGTCGGTAGCCCTTCAAGCGACGGAACAGCCTCTCCACTTCGTTGCGCCGCTTGTACATTTCCTTGTCGTACTCCCAAGGATCGACCCGATTGGACTTGGGTGGAACCACCGGCACGAAGCCAAGATCGAGCGCCAACTGGCGGGTTTCATTGCCTTCGTAAGCGCGATCCATCAGCAGATGAACCGGCCGCTCCACTGGCCCCAGGTGTTCAAGCAACGCGCGGCCTGCGGGTGCGTCATGTGCGTTGCCAGGCGTCAATCCGAACGTGATGGCTGTTCGAGCATCTGCGGCAACCATATGAATTTTGGTGTTCCATCCGCCGCGCGATTTCCCGATGGATTGTGGGCCGTTTTTTTTAATGCGCCAGTGCCATCCGGATGCACCTTGATGCTGGTGGAGTCCAGCGAGACCGCTTCGATTTTGATGCGCACGATCTGGCAGGTCTGCAATTGGGCGAACATCCGGTCCAGCACACCGGACTTGGCCCAACGGTTAATGCGCGTGTACACCGTATGCCAGTTGCCAAAGCGCTCGGGCAGACCGCGCCATTTGCAGCCATGCTCTGCGACGTAAAGAAGGGCGTTGACTACCTGCAGGTTGGTCATGCTGACATTGCCGCGTTGCAAAGGTAGGCAATGCTCGATGAGTGCAAATTGTGCTGGCGTGATCTCCATGCCCAATAGTTTAATCGCTCGAGACATTAATGTTAACAGGCCCTAGC	NA	NA	NA	NA
WP_116101028.1|3542444_3543410_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	3590860	3632799	4865660	transposase	Ralstonia_phage(44.44%)	30	NA	NA
WP_011407175.1|3590860_3591829_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3592849_3593884_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3594267_3594993_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3595124_3595586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3599032_3601153_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3601419_3602265_-	transporter	NA	NA	NA	NA	NA
WP_011257031.1|3603256_3604225_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011259903.1|3604549_3606520_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3606948_3608346_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3608458_3609277_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011259907.1|3609587_3612839_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	6.1e-81
WP_075239010.1|3612825_3613008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259908.1|3613020_3614439_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|3614448_3615099_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011409164.1|3615100_3615706_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3615855_3616077_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3616086_3616512_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_094187731.1|3617003_3617801_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409167.1|3618878_3619658_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3619872_3620502_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3620562_3621318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182227.1|3621646_3622423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182229.1|3622831_3624406_+	protein kinase	NA	NA	NA	NA	NA
WP_011409172.1|3624654_3624921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409173.1|3625199_3628379_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.3	1.2e-73
WP_011258802.1|3628444_3629413_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409174.1|3629538_3630213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409175.1|3630212_3630959_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_075243738.1|3630955_3631765_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011258803.1|3631830_3632799_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
>prophage 28
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	3649063	3692043	4865660	plate,transposase	Staphylococcus_prophage(25.0%)	28	NA	NA
WP_069970072.1|3649063_3650020_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_082325322.1|3649994_3652433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182737.1|3652344_3653376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325323.1|3653384_3655322_-	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_011409194.1|3655233_3656253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325324.1|3656257_3658201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325325.1|3658112_3659135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409198.1|3661099_3662125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082325327.1|3662128_3664996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465165.1|3665014_3665860_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_082325328.1|3665861_3668624_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	9.6e-43
WP_011259938.1|3668716_3669070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3669100_3671830_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3671915_3673007_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069959967.1|3672970_3674806_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011409203.1|3674808_3675297_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003467612.1|3675444_3675942_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409204.1|3676083_3677580_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467601.1|3677583_3678084_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_033005590.1|3678130_3678619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409206.1|3679005_3679614_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011409207.1|3679765_3681100_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011409208.1|3681099_3681888_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_109182112.1|3681994_3684616_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_075242365.1|3684612_3685590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168764.1|3685564_3686140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116101030.1|3686148_3688317_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011258188.1|3691074_3692043_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 29
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	4059785	4154910	4865660	transposase	Ralstonia_phage(17.65%)	64	NA	NA
WP_115840193.1|4059785_4061393_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4061554_4061818_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4061822_4062482_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4062668_4064033_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4064248_4064944_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4065890_4066514_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011260283.1|4066658_4067456_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4067549_4068200_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4068291_4069107_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260285.1|4069126_4069894_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|4071822_4072812_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041182588.1|4072934_4075508_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4075700_4076463_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4076536_4077505_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011409421.1|4078238_4078505_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4079436_4080235_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4081881_4083114_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4083153_4084116_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4084291_4085248_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|4085459_4086428_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|4086763_4087526_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4092363_4092594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409428.1|4093218_4095261_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4095262_4097161_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011260297.1|4097162_4098416_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011260298.1|4098412_4099018_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011409430.1|4099437_4100592_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4100594_4101623_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409431.1|4101619_4102696_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4102736_4104014_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4104058_4104826_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409433.1|4105040_4106207_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011260306.1|4108750_4111648_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011409436.1|4111798_4114489_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_116101033.1|4114770_4115727_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.8e-42
WP_011409439.1|4116217_4117453_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057228.1|4118888_4120073_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4120140_4120878_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4121046_4121562_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4121653_4123156_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4123159_4123600_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4123596_4125408_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260317.1|4125693_4126065_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4126215_4127268_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4127607_4128549_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4128569_4129907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4130078_4130459_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4130583_4131345_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4133593_4134997_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4135119_4136175_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_103057229.1|4136347_4137202_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|4137493_4139677_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_041182275.1|4141267_4143079_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_155296183.1|4143173_4143323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260331.1|4143323_4144337_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260332.1|4144351_4145050_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4145037_4145316_-	YbeD family protein	NA	NA	NA	NA	NA
WP_011260334.1|4146381_4147587_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011260335.1|4148087_4149503_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4149499_4150639_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_125168765.1|4151864_4152407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409455.1|4152378_4153653_-	DUF3380 domain-containing protein	NA	B3FJ91	Pseudomonas_phage	33.7	1.2e-21
WP_075242420.1|4153652_4153871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409456.1|4153947_4154910_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	4180879	4262936	4865660	transposase,protease	Erwinia_phage(18.18%)	55	NA	NA
WP_011260359.1|4180879_4182247_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260360.1|4182357_4182909_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011409475.1|4183424_4184342_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
WP_011409476.1|4184541_4185213_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_011260363.1|4185209_4186064_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409477.1|4186053_4186290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409478.1|4186347_4186746_-	YbaN family protein	NA	NA	NA	NA	NA
WP_027703683.1|4187118_4189254_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409479.1|4189377_4190562_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011409480.1|4190887_4191319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|4191401_4193495_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409482.1|4193562_4193874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260370.1|4194261_4194831_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_011260371.1|4194939_4195905_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260372.1|4196463_4197264_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011409484.1|4197814_4198729_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011409485.1|4198759_4199497_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260375.1|4199527_4200580_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011260376.1|4200584_4201253_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260377.1|4201404_4203342_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_094187780.1|4204068_4204831_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260378.1|4205145_4206795_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409489.1|4208185_4209673_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_069963930.1|4209880_4211335_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
WP_011409492.1|4212569_4215194_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_011260383.1|4215449_4218320_+	insulinase family protein	NA	NA	NA	NA	NA
WP_011409493.1|4218867_4219797_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011409494.1|4219835_4220840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187782.1|4221082_4221846_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4222893_4223679_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4223932_4225606_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4226149_4226596_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4226926_4227211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260390.1|4227805_4228717_-	magnesium transporter	NA	NA	NA	NA	NA
WP_011409498.1|4228962_4229958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260392.1|4230051_4231428_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_082325347.1|4232594_4234295_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_082325348.1|4234703_4236476_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_011409500.1|4236751_4237627_-	DMT family transporter	NA	NA	NA	NA	NA
WP_027703846.1|4237824_4238703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|4240742_4241834_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_041182286.1|4243736_4246061_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260402.1|4246256_4248203_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4248577_4248769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4249159_4250743_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4251090_4251687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409513.1|4253035_4253884_-	amino acid lyase	NA	NA	NA	NA	NA
WP_011409514.1|4253918_4255394_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4255984_4256914_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4257148_4257640_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4257636_4258308_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4258702_4259032_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012444032.1|4259240_4260167_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_094187728.1|4260955_4261754_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|4261901_4262936_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 31
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	4283821	4325529	4865660	transposase,tRNA	Ralstonia_phage(50.0%)	37	NA	NA
WP_109182021.1|4283821_4284787_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4285319_4285700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409536.1|4285902_4286787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409537.1|4286876_4288172_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011409538.1|4288301_4288826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4289251_4290517_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4290513_4291491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4291594_4292398_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4292573_4293383_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4293390_4294189_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465763.1|4294231_4294849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4294973_4295549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|4295760_4297080_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|4297229_4298198_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409546.1|4298323_4299076_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4299113_4299554_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4299760_4300102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4300327_4300705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4300915_4301113_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011409548.1|4301419_4302166_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409549.1|4302258_4303065_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4303288_4304701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260454.1|4304697_4305795_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4305949_4306748_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4306801_4307600_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_116101035.1|4307819_4308782_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|4309229_4309993_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4310274_4311051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4311047_4312364_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408623.1|4312880_4314116_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4314709_4314991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4315551_4315986_-	membrane protein	NA	NA	NA	NA	NA
WP_011409559.1|4316160_4317339_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|4318334_4319297_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4321630_4323802_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4324029_4324386_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4324464_4325529_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
>prophage 32
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	4348479	4406991	4865660	transposase,tRNA	Acinetobacter_phage(30.0%)	45	NA	NA
WP_094187805.1|4348479_4349458_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_115840195.1|4349537_4350503_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_003483093.1|4350515_4350986_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4351328_4351544_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4351624_4352242_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4352790_4353183_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4353186_4353615_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|4353800_4354454_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011409578.1|4354731_4355046_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4355205_4356000_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4356137_4356830_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011409579.1|4357150_4357867_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4357859_4358657_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4358793_4359831_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4359948_4360578_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4360729_4361311_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_094187806.1|4362738_4363840_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|4364444_4366676_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011409586.1|4366865_4368578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260506.1|4368726_4370103_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_094187777.1|4372310_4373109_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964474.1|4374093_4375062_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_069960033.1|4375228_4376200_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|4376392_4377577_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4378044_4378860_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_011409596.1|4379618_4380935_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4381194_4382439_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4382531_4385780_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4385913_4389054_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4389343_4390711_-	VOC family protein	NA	NA	NA	NA	NA
WP_041182775.1|4391455_4392421_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069964616.1|4392839_4393805_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4394267_4394738_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4394766_4395189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4395264_4395699_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4395808_4396324_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4396339_4397365_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4397687_4398284_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_011260532.1|4398641_4400369_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4400418_4401861_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4401845_4403192_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4403382_4404132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4404233_4404845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4404949_4406173_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4406514_4406991_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 33
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	4419858	4477802	4865660	transposase	Leptospira_phage(28.57%)	37	NA	NA
WP_011260549.1|4419858_4421235_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4421245_4421779_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4422207_4423467_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4423605_4424913_-	MFS transporter	NA	NA	NA	NA	NA
WP_109182013.1|4425302_4426268_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|4426997_4428032_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4428382_4428928_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4428953_4429220_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011260556.1|4429394_4431233_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409614.1|4434456_4435599_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
WP_011260560.1|4436725_4437625_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011260561.1|4438572_4441374_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011409617.1|4441450_4441741_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_113101711.1|4442098_4443201_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
WP_125168768.1|4443306_4443978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168769.1|4444037_4444943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409622.1|4445132_4447820_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_011409626.1|4451141_4455071_+	avirulence protein	NA	NA	NA	NA	NA
WP_011409629.1|4456759_4457272_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
WP_075244060.1|4457268_4457496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129215547.1|4457780_4458197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409630.1|4458345_4460352_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_012443890.1|4460348_4460780_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_011260579.1|4460776_4461196_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_075242964.1|4461681_4462446_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011409633.1|4462656_4463247_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_011409634.1|4463380_4464328_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_011409635.1|4464370_4465240_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_011409636.1|4465236_4465737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409640.1|4468835_4469396_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	2.1e-13
WP_011409641.1|4469491_4472317_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011260589.1|4472478_4472997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409642.1|4472996_4473917_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_011260591.1|4474345_4474969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465293.1|4474978_4475164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409643.1|4475266_4475848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182033.1|4476836_4477802_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	4555329	4698733	4865660	tail,transposase,tRNA	Arthrobacter_phage(18.75%)	92	NA	NA
WP_109182036.1|4555329_4556295_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4556395_4556821_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4556863_4557626_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4557688_4558720_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4560080_4561337_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4561333_4562224_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4562220_4562616_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4562635_4563214_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_115801912.1|4563099_4563957_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_011409690.1|4563889_4565278_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|4570063_4572148_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4572247_4574275_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4574517_4576128_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4576138_4577302_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4577430_4578051_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260672.1|4578612_4578948_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4580572_4580884_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4582002_4582521_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_011409700.1|4582792_4584511_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4584601_4584988_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4585049_4586375_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260681.1|4586489_4587803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|4587901_4588627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4588843_4589506_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4589584_4590679_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|4592183_4594943_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|4595195_4596785_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4596784_4599022_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4599310_4600219_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4600308_4602123_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_103057247.1|4602508_4610965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182038.1|4611432_4612230_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409712.1|4612774_4613527_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011260693.1|4613586_4614486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|4614637_4615393_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_011409714.1|4615389_4616025_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4616040_4616268_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|4616340_4617243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|4617397_4618363_+	ferrochelatase	NA	NA	NA	NA	NA
WP_075242173.1|4618460_4619216_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409718.1|4619296_4619755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409719.1|4620025_4620811_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409720.1|4621437_4622343_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	4.1e-43
WP_011260702.1|4622406_4623324_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|4623927_4625265_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4625490_4626558_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409722.1|4626733_4628929_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4628925_4630890_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4630901_4632161_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4632160_4633861_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011260708.1|4633863_4636578_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4636800_4638273_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4639250_4640306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4640533_4641952_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_011409725.1|4641992_4642970_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_042465333.1|4644386_4645688_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|4646149_4649083_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4649181_4650669_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4650700_4651735_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_094187716.1|4652151_4652949_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010374782.1|4653825_4654002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116101037.1|4654255_4655212_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182040.1|4655939_4656702_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4656719_4657820_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4657885_4659007_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011409734.1|4659016_4660093_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4660185_4660866_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|4660898_4661697_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4661825_4663145_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465802.1|4663247_4664204_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.4e-41
WP_011260733.1|4665670_4666129_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4666230_4666659_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|4666905_4667769_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4670945_4671212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4671373_4671622_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|4671830_4672589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4672585_4673281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4673379_4673712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465811.1|4674183_4674606_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4674733_4674979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4675314_4675647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|4676096_4677491_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4678428_4678719_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_011260747.1|4678736_4679018_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_011409750.1|4679112_4681365_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.7	8.7e-10
WP_082325367.1|4681552_4685620_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_011409752.1|4685616_4689030_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_125168771.1|4689077_4689368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4695943_4696489_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4696557_4697085_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011260755.1|4697143_4697680_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_109182045.1|4697767_4698733_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP031469	Xanthomonas oryzae pv. oryzae strain ScYc-b chromosome, complete genome	4865660	4741905	4809069	4865660	transposase,protease	Staphylococcus_phage(25.0%)	55	NA	NA
WP_011258529.1|4741905_4742874_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_162866909.1|4743421_4744541_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	1.2e-41
WP_012446412.1|4745023_4745170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409784.1|4745203_4745506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757244.1|4745651_4746455_-	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	34.7	3.3e-36
WP_011260800.1|4746516_4747545_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011260801.1|4747683_4748655_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011409786.1|4748887_4749742_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409787.1|4749834_4750407_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011260804.1|4750729_4751170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409789.1|4751332_4753834_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.4	6.0e-20
WP_011260806.1|4754522_4754996_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	48.7	2.1e-35
WP_011409790.1|4755308_4756628_-	L-fuconate dehydratase	NA	NA	NA	NA	NA
WP_011260808.1|4757151_4758009_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011260809.1|4758179_4758950_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011409791.1|4758946_4759819_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011409792.1|4759815_4760826_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_012446418.1|4760937_4761105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260812.1|4761138_4762236_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_012446420.1|4762369_4762573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409794.1|4763488_4764157_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011409795.1|4764418_4766362_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.2	1.3e-83
WP_011409796.1|4766659_4767013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075242224.1|4767009_4768068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409798.1|4768154_4768472_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_011260819.1|4768468_4770196_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_011260820.1|4770803_4771505_-	ROK family protein	NA	NA	NA	NA	NA
WP_011409799.1|4771861_4772641_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_011409800.1|4772637_4773075_+	GFA family protein	NA	NA	NA	NA	NA
WP_011409801.1|4773136_4773388_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014501576.1|4773514_4774111_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_069960053.1|4774129_4775701_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409802.1|4775877_4777506_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011409803.1|4777728_4778367_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_011409805.1|4779435_4779795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002809459.1|4779979_4780216_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002809462.1|4780229_4780397_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011260829.1|4780829_4781297_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260830.1|4781293_4782529_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260831.1|4783400_4784456_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_011260832.1|4784448_4785120_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_011260833.1|4785217_4786525_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409807.1|4786541_4787960_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011409808.1|4788531_4789926_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011260838.1|4790273_4792460_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.7	2.2e-111
WP_116101039.1|4792810_4793773_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_113292820.1|4793652_4793940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182049.1|4794520_4795486_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409811.1|4795661_4797077_-	amino acid permease	NA	NA	NA	NA	NA
WP_075242296.1|4797567_4799892_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_041182970.1|4800297_4800660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409815.1|4801037_4801583_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_011260845.1|4804835_4805963_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|4806818_4808159_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4808376_4809069_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
