The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	2861	30239	4931011	portal,lysis,capsid,head,holin,tail,protease,integrase,terminase	Escherichia_phage(52.94%)	44	12428:12443	31935:31950
WP_063101268.1|2861_3122_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.8	7.1e-41
WP_001312914.1|3163_3550_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_000097533.1|3549_4254_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_001209399.1|4313_4658_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_001312916.1|4654_5104_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	7.9e-64
WP_001147820.1|5100_5439_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000983037.1|5447_5753_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_000601355.1|5764_5953_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000257489.1|6004_7210_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_001193631.1|7224_7875_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466247.1|7852_9094_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_000478567.1|9093_9276_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_021562585.1|9287_11045_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_021558836.1|11044_11527_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	99.4	3.5e-86
WP_032191482.1|11675_12026_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	2.1e-64
WP_032191479.1|12265_12643_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	9.6e-63
12428:12443	attL	ATCCACCGCATCACCG	NA	NA	NA	NA
WP_032191664.1|12645_12921_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	5.5e-44
WP_032191478.1|12910_13303_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	96.2	5.9e-55
WP_032191476.1|13391_13544_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_021558737.1|13540_13966_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	87.2	2.3e-60
WP_134876106.1|14518_14773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032084568.1|15583_16273_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
WP_000140004.1|16269_16635_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
WP_032191473.1|16635_17691_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	7.0e-87
WP_032191662.1|17692_17965_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.5	1.3e-05
WP_001260977.1|18100_18358_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220600.1|18363_18663_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	99.0	3.9e-51
WP_032191472.1|19878_20235_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_032191471.1|20292_20715_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	8.8e-65
WP_032191469.1|20755_21826_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693850.1|21897_22323_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032191468.1|22319_22535_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103684.1|22584_23301_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	5.9e-53
WP_000379575.1|23573_23729_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|23888_24107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394519.1|24129_24537_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.9	1.0e-09
WP_000920491.1|24514_24748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001605305.1|24741_24909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|25308_25497_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|25493_25685_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_032191466.1|25778_28250_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000003742.1|28311_28581_+	excisionase	NA	NA	NA	NA	NA
WP_032166781.1|28549_29668_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_001113313.1|29771_30239_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	29.5	2.4e-07
31935:31950	attR	CGGTGATGCGGTGGAT	NA	NA	NA	NA
>prophage 2
NZ_CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	1292280	1329328	4931011	transposase	Stx2-converting_phage(35.71%)	32	NA	NA
WP_085949199.1|1292280_1293554_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.6e-172
WP_001424073.1|1294168_1295782_-|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	5.4e-171
WP_000624688.1|1295812_1296163_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|1296159_1296594_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000221545.1|1297373_1297943_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|1298202_1298604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|1298591_1299026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|1299380_1299761_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612633.1|1299757_1301290_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	81.4	1.2e-239
WP_000823243.1|1301528_1302887_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937736.1|1303265_1303457_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_000555341.1|1303619_1303877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|1305627_1306149_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|1306145_1307099_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188280.1|1307185_1309510_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879152.1|1309554_1310457_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|1310453_1311452_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|1311448_1312405_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|1312405_1313173_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177059.1|1313730_1313988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001424070.1|1315473_1316295_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014639406.1|1316297_1317386_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_001424779.1|1318405_1319350_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000088350.1|1319530_1320670_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.7e-68
WP_001293435.1|1320823_1322821_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001409274.1|1322883_1324254_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145479.1|1324407_1324626_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300609.1|1324676_1325459_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_001424065.1|1325455_1326478_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	7.8e-200
WP_000251886.1|1326649_1327024_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001422798.1|1327204_1327333_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000080195.1|1327714_1329328_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 3
NZ_CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	2057134	2064410	4931011		Sodalis_phage(33.33%)	7	NA	NA
WP_042634289.1|2057134_2058454_-	hypothetical protein	NA	B6SCW4	Bacteriophage	43.2	1.2e-35
WP_000909176.1|2058453_2059131_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_042634290.1|2059124_2059586_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.5	2.9e-61
WP_042634291.1|2060348_2063105_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.1	1.5e-298
WP_001208878.1|2063091_2063463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628966.1|2063455_2063797_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001058743.1|2063807_2064410_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.0e-25
>prophage 4
NZ_CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	3097291	3104431	4931011		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3097291_3097930_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3097926_3099189_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3099185_3100094_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3100289_3101057_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|3101107_3101764_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|3101869_3104431_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 5
NZ_CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	3141328	3256823	4931011	portal,lysis,capsid,plate,head,tail,integrase,tRNA,terminase	Salmonella_phage(68.52%)	114	3183866:3183903	3218466:3218503
WP_000047176.1|3141328_3143959_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|3144193_3144379_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_042634227.1|3145561_3146128_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287457.1|3146124_3146553_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611802.1|3146625_3148182_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130207.1|3148331_3148847_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|3148910_3150449_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|3150465_3151638_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|3151764_3152295_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119750.1|3152385_3152721_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|3152710_3153448_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000165699.1|3153571_3154756_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216521.1|3155047_3156040_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774978.1|3156097_3157162_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985494.1|3157154_3158357_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_042634226.1|3158711_3159671_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	4.5e-133
WP_000246537.1|3159680_3161825_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	6.4e-196
WP_000080944.1|3161797_3162208_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|3162204_3162450_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|3162697_3163027_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|3163178_3163523_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|3163559_3164009_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|3164676_3165081_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229444.1|3165127_3165652_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|3165661_3165961_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|3166143_3166302_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522415.1|3166385_3166835_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|3166835_3167498_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|3167518_3168919_-	GABA permease	NA	NA	NA	NA	NA
WP_000097660.1|3169156_3170437_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_000772854.1|3170450_3171899_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271984.1|3171921_3173190_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001315804.1|3173209_3174187_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000961357.1|3178161_3179535_+	DUF5507 domain-containing protein	NA	NA	NA	NA	NA
WP_072161517.1|3179920_3180109_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	69.2	9.1e-06
WP_000927517.1|3180263_3180383_+	hypothetical protein	NA	NA	NA	NA	NA
3183866:3183903	attL	GCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000660070.1|3184098_3185832_+	deoxycytidylate deaminase	NA	NA	NA	NA	NA
WP_000218398.1|3186211_3187228_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	93.5	6.1e-189
WP_000932270.1|3187230_3187863_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.9	1.1e-58
WP_000102105.1|3187984_3188227_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000460865.1|3188259_3188769_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	6.6e-83
WP_000956186.1|3188776_3189073_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	93.9	1.1e-21
WP_000996711.1|3189190_3189532_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	1.9e-54
WP_001244211.1|3189599_3189833_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	4.6e-31
WP_000752613.1|3189832_3190060_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104161.1|3190056_3190914_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	94.7	1.8e-157
WP_000017515.1|3190910_3193325_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_001154434.1|3193478_3193667_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|3193677_3193911_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_032235580.1|3194281_3194977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001384725.1|3195376_3195634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001384724.1|3195750_3196155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520371.1|3196185_3197211_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.5	6.9e-172
WP_001098447.1|3197210_3198977_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_000216261.1|3199119_3199953_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.7	1.5e-121
WP_000742510.1|3199969_3201028_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000059211.1|3201031_3201682_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.9e-111
WP_000673529.1|3201777_3202242_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	8.4e-77
WP_000868175.1|3202241_3202445_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|3202448_3202664_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_085959187.1|3202683_3203157_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000730950.1|3203158_3203536_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	1.1e-15
WP_001384723.1|3203532_3203961_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	3.8e-47
WP_001039945.1|3204056_3204488_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_000829119.1|3204480_3204927_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	86.3	2.3e-63
WP_000993744.1|3204995_3205574_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	9.4e-94
WP_000177580.1|3205570_3205930_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000268289.1|3205916_3206825_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.7e-143
WP_001086842.1|3206817_3207423_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	7.5e-110
WP_000104774.1|3207419_3209507_+|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	42.7	3.6e-74
WP_001098219.1|3209506_3209920_+|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	73.0	5.8e-21
WP_000046128.1|3210026_3211199_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	1.0e-203
WP_001207660.1|3211208_3211724_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|3211778_3212081_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|3212095_3212215_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282739.1|3212207_3215285_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
WP_000980384.1|3215281_3215767_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.8e-66
WP_001011766.1|3215763_3216864_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.5	3.4e-177
WP_000972389.1|3216954_3217173_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
WP_000151541.1|3217576_3218350_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_000162574.1|3219035_3219518_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3218466:3218503	attR	GCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600189.1|3219649_3220126_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117846.1|3220115_3220406_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|3220467_3220809_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|3220957_3222619_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|3222704_3223583_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|3223705_3224299_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|3224353_3225640_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|3225660_3226452_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|3226618_3227980_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|3228116_3228365_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|3228383_3228932_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|3228962_3229730_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|3229771_3230119_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|3230194_3230677_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969010.1|3230692_3231919_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|3231908_3232427_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|3232576_3232942_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|3233151_3234222_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|3234232_3235354_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200101.1|3235396_3236557_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001700969.1|3236655_3236703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|3236806_3237148_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|3237418_3238156_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079100.1|3238290_3239271_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040129.1|3239267_3239999_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|3240128_3242702_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|3248567_3249866_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|3249862_3250186_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|3250231_3251587_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082969.1|3251700_3254361_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000138184.1|3254392_3255091_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|3255159_3255579_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|3255785_3256823_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	3747169	3756610	4931011		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569358.1|3747169_3748096_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|3748100_3748832_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3748812_3748920_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3748979_3749711_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3749932_3751618_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3751614_3752334_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|3752380_3752851_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|3752890_3753352_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_103042683.1|3753476_3755477_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292774.1|3755473_3756610_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 7
NZ_CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	3849418	3856957	4931011		Enterobacteria_phage(28.57%)	7	NA	NA
WP_001116049.1|3849418_3850813_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
WP_000999466.1|3850970_3851966_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183060.1|3852208_3853102_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699430.1|3853474_3854560_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.1e-100
WP_001023629.1|3854559_3855462_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	4.4e-29
WP_000857541.1|3855516_3856395_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	6.6e-107
WP_001100798.1|3856399_3856957_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	3.9e-52
>prophage 8
NZ_CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	3923196	4055034	4931011	portal,lysis,capsid,head,holin,tail,transposase,protease,integrase,tRNA,terminase	Enterobacteria_phage(33.33%)	132	3923186:3923245	4030331:4031661
3923186:3923245	attL	TGGATTTGCCCCTATATTTCCAGACACCTGTTATCACTTAACCCATTACTGGCTTGCTGC	NA	NA	NA	NA
WP_085949199.1|3923196_3924470_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.6e-172
WP_001323489.1|3926006_3926717_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000784549.1|3927408_3929430_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_001088826.1|3929560_3931138_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_000194282.1|3931141_3931945_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_000982866.1|3931941_3933042_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_000369518.1|3933038_3942530_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_000623064.1|3942617_3948725_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
WP_000970688.1|3948915_3949875_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000098398.1|3950041_3951844_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.4e-31
WP_001334858.1|3951830_3953633_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001286287.1|3953625_3954906_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703039.1|3954933_3956238_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001300801.1|3957684_3958482_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533615.1|3958717_3959743_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|3959742_3959946_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_103042684.1|3960004_3962446_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.0	1.0e-112
WP_001070256.1|3962539_3962731_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|3962727_3962916_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296188.1|3963315_3963480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|3963483_3963702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001384640.1|3963861_3964017_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	3.4e-06
WP_000233320.1|3964314_3964734_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|3964813_3965068_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693850.1|3965064_3965490_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262376.1|3965561_3966638_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.5e-63
WP_001151223.1|3966678_3967089_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	1.2e-63
WP_042634476.1|3967158_3967515_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_000797277.1|3967639_3967822_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	92.6	6.1e-23
WP_001384637.1|3967818_3968010_+	hypothetical protein	NA	A0A0F6R8N3	Escherichia_coli_O157_typing_phage	93.7	3.3e-27
WP_000951709.1|3968011_3968227_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	97.2	5.7e-36
WP_001142589.1|3968228_3968447_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	88.9	5.2e-29
WP_000224213.1|3968448_3968712_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	1.5e-30
WP_000206831.1|3968722_3969067_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	92.1	7.4e-54
WP_000673136.1|3969266_3969557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018425.1|3970696_3970909_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	2.0e-17
WP_000737636.1|3971052_3971445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032173433.1|3971741_3972020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015675170.1|3972021_3973071_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.1e-107
WP_001217424.1|3973083_3973443_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_001064900.1|3973439_3974129_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	5.8e-58
WP_001384627.1|3975290_3975683_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	90.0	3.4e-55
WP_000950569.1|3975672_3975948_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	7.2e-44
WP_000014549.1|3975950_3976328_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	1.3e-64
WP_134267542.1|3976342_3976522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042634360.1|3976760_3976970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140107.1|3977391_3977742_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	6.2e-64
WP_001317918.1|3977890_3978373_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_021562585.1|3978372_3980130_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_000478567.1|3980141_3980324_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_000466247.1|3980323_3981565_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_001193631.1|3981542_3982193_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257489.1|3982207_3983413_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_032191505.1|3983464_3983653_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	98.4	2.7e-26
WP_001605322.1|3983664_3983970_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	80.2	1.7e-38
WP_001605323.1|3983978_3984317_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	98.2	3.5e-56
WP_032159263.1|3984313_3984763_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001605325.1|3984759_3985104_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	99.1	1.2e-56
WP_001605326.1|3985164_3985869_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	94.9	2.8e-116
WP_001312914.1|3985868_3986255_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_077763502.1|3986296_3986557_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	3.5e-40
WP_077763495.1|3989802_3990159_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	5.3e-39
WP_032191512.1|3990158_3990857_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	2.8e-132
WP_064752038.1|3990861_3991605_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	8.6e-148
WP_042634545.1|3991541_3992144_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	1.2e-88
WP_103042685.1|3992204_3995684_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.4	0.0e+00
WP_032191516.1|3995751_3996351_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	3.5e-107
WP_000799406.1|3999245_4000109_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|4000092_4001229_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359457.1|4001478_4002705_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|4002753_4003875_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|4003950_4005411_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|4005410_4006082_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|4006250_4007621_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|4007624_4008266_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|4008301_4009408_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4009461_4009923_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|4009932_4010586_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4010757_4012008_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741338.1|4012121_4013264_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	100.0	6.2e-206
WP_000088653.1|4013253_4013490_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|4013629_4013869_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763387.1|4013916_4014135_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
WP_001386642.1|4014233_4014515_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000129285.1|4014525_4015083_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682314.1|4015075_4015237_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.0	1.2e-22
WP_000186763.1|4015233_4015914_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	3.0e-131
WP_000100847.1|4015910_4016696_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995419.1|4016701_4016998_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	6.8e-48
WP_000233576.1|4017074_4017281_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000581650.1|4017759_4018272_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_000741702.1|4018268_4019408_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001295669.1|4019537_4020230_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|4020340_4020568_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182885.1|4020598_4021138_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
WP_001384422.1|4021224_4022154_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	3.6e-111
WP_000788783.1|4022150_4022864_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	1.7e-108
WP_000608370.1|4022942_4023371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157905615.1|4024372_4024522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000174718.1|4024786_4025242_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	2.7e-59
WP_000224916.1|4025241_4025412_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774480.1|4025404_4025695_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
WP_001099700.1|4025691_4026054_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_000971068.1|4026050_4026191_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|4026276_4026660_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737275.1|4026848_4027931_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|4028504_4028720_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135275.1|4028719_4029109_+	glycoside hydrolase family protein	NA	A0A291AWW2	Escherichia_phage	97.3	1.2e-57
WP_085949199.1|4029105_4030378_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.6e-172
WP_077628513.1|4030769_4030952_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	2.5e-16
WP_000738423.1|4031042_4031336_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001307652.1|4031698_4031893_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
4030331:4031661	attR	GCAGCAAGCCAGTAATGGGTTAAGTGATAACAGGTGTCTGGAAATATAGGGGCAAATCCACAATTTCAGAACATCGACGCTTCTTCGCAAAATAAACCAGGGCGATATCAAAGGCGCATGTGATCAGCTACGTCGCTGGACATATGCTGGCGGTAAGCAATGGAAAGGTCTCATGACTCGTCGTGAGATTGAGCGTGAAATCTGTTTGTGGGGTCAGCAATGAACAGAGTAACCGCGATTATCTCCGCTCTGGTTATCTGCATCATCGTCTGCCTGTCATGGGCTGTTAATCATTACCGTGATAACGCCATTACCTACAAAGCCCAGCGCGACAAAAATGCCAGAGAACTGAAGCTGGCGAACGCGGCAATTACTGACATGCAGATGCGCCAGCGTGATGTTGCTGCACTGGATGAAAAATACACGAAGGAGTTAGCTAATGCGAAAGCTGAAAATGATGCTCTGCGTGATGATGTTGCCGCTGGTCGTCGTCGGTTGCACATCAAAGCAGTCTGTCAGTCAGTGCGTGAAGCCACCACCGCCTCCGGCGTGGATAATGCAGCCTCCCCCCGACTGGCAGACACCGCTGAACAGGATTATTTCACCCTCAGAGAGAGGCTGATCACTATGCAAAAACAACTGGAAGGAACCCAGAAGTATATTAATGAGCAGTGCAGATAGAGCTGCCCATATCGATGGGCAACTCATGCAATTATTGTGAGCAATACACACGCGCTTCCAGCGGAGTATAAATGCCTAAAGTAATAAAACCGAGCAATCCATTTACGAATGTTTGCTGGGTTTCTGTTTTAACAACATTTTCTGCGCCGCCACAAATTTTGGCTGCATCAACAGTTTTCTCCTGTCCAATTCCCGAAACGAAGAAGTGATGGGTGATGGTTTCCTTTGGTGTTACTGCTGTCGGTTTGTTTCCAACAGTAAACGTCTGTTGAGCACATCCTGTAATAAGCATTGCCAGAGCGGCAGAAAACAACATTTTTTTCATCTTATTATCCTGCATTGTTAAAAACGGCAGAATCCTATGTGACAACAATTAAACGATAGTTAAATGGATTGATGAAAATTAAAACTATATAGGTGTACGCTCAGACTATTGGAGGAAGTTGGGGACACTCAGAATCCTGTGGAATGAAATAAACCGGTCTATCCGTCTATTACCCTTTTAGCTGCGCTGTATCGTCGCCGTATTCCCGCATTAACCATGACCGTAGCCCGACGGGGAATTCCTTCTGCGTGAGTGTGCGGGAATAATCAAAAACGATGCACACCGGGTTTTACTGTGCTGACAGACGCAGGGTTACCCTCATAGT	NA	NA	NA	NA
WP_000453580.1|4032281_4032827_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027268.1|4032801_4034727_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|4034723_4034930_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001356819.1|4034926_4036528_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000123313.1|4036508_4037828_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	4.5e-232
WP_001299443.1|4037837_4038170_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063241.1|4038225_4039251_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	1.7e-191
WP_000158875.1|4039292_4039688_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000753000.1|4039699_4040053_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.2e-62
WP_000975068.1|4040064_4040643_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000683105.1|4040639_4041035_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001380324.1|4041042_4041783_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.4	9.5e-131
WP_000479172.1|4041798_4042221_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	3.8e-68
WP_000459457.1|4042202_4042637_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000847350.1|4045205_4045535_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	4.7e-58
WP_001152505.1|4045534_4046233_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	96.1	1.1e-128
WP_000140737.1|4046237_4046981_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.9e-147
WP_000090892.1|4046917_4047550_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
WP_001233178.1|4051094_4051694_+	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	99.5	6.7e-111
WP_000268788.1|4051758_4055034_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	72.2	1.3e-309
>prophage 9
NZ_CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	4463123	4505491	4931011	portal,lysis,tail,protease,transposase,terminase	Enterobacteria_phage(52.38%)	57	NA	NA
WP_122985608.1|4463123_4463237_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	83.3	2.9e-07
WP_000836768.1|4463305_4463539_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|4463856_4464447_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885587.1|4464544_4465120_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.0e-104
WP_024183964.1|4465119_4468143_-|tail	tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_001230352.1|4468207_4468807_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_000515631.1|4468873_4472272_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.6	0.0e+00
WP_023277304.1|4472332_4472980_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_000194816.1|4472877_4473621_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	3.5e-149
WP_001152385.1|4473626_4474325_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447253.1|4474334_4474664_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000372058.1|4474663_4477729_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_001161009.1|4477700_4478030_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001384509.1|4478038_4478425_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.9	2.2e-62
WP_000211131.1|4478485_4479229_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.6	3.6e-130
WP_001079398.1|4479239_4479641_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677102.1|4479637_4480216_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283152.1|4480227_4480503_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_001097052.1|4480495_4480819_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	9.4e-51
WP_001136599.1|4480905_4482933_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_077631397.1|4482910_4484458_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	8.5e-283
WP_001072975.1|4484385_4484598_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507032.1|4484594_4486694_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.6	0.0e+00
WP_000421825.1|4486702_4487242_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031431.1|4487810_4488017_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035574.1|4488317_4488728_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.0	2.1e-63
WP_001019606.1|4488879_4489053_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|4489224_4489380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|4489459_4489525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|4489527_4489716_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4489726_4489939_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|4490302_4490800_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|4490796_4491330_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|4491326_4491638_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|4491642_4491858_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|4492611_4492827_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|4493127_4493340_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|4493394_4493484_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|4493761_4494514_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|4494527_4495577_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|4495578_4495857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|4495923_4496175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|4496391_4496547_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|4496618_4496906_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|4496905_4497145_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|4497169_4497475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|4497677_4498010_+	protein flxA	NA	NA	NA	NA	NA
WP_000589012.1|4498446_4499787_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151195.1|4499820_4500240_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000054506.1|4500280_4501246_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	1.7e-55
WP_000705349.1|4501226_4501748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|4501731_4501959_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|4502036_4502444_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|4502635_4502791_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344954.1|4502792_4503368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|4503854_4504043_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_085949199.1|4504217_4505491_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.6e-172
>prophage 10
NZ_CP025753	Escherichia coli strain CV839-06 chromosome, complete genome	4931011	4915473	4930959	4931011	tail	Escherichia_phage(50.0%)	14	NA	NA
WP_074152286.1|4915473_4915599_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	87.5	2.3e-13
WP_000268786.1|4915653_4918929_-	hypothetical protein	NA	K7PGT9	Enterobacteria_phage	71.0	4.6e-302
WP_001230299.1|4918993_4919593_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	4.8e-109
WP_000515626.1|4919661_4923057_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.9	0.0e+00
WP_012311734.1|4923117_4923765_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_001423886.1|4923662_4924406_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.1	6.4e-143
WP_001152456.1|4924410_4925109_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_040079256.1|4925108_4925465_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	1.4e-39
WP_042634620.1|4925442_4928670_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
WP_077763502.1|4928715_4928976_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	3.5e-40
WP_001312914.1|4929017_4929404_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_001605326.1|4929403_4930108_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	94.9	2.8e-116
WP_001605325.1|4930168_4930513_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	99.1	1.2e-56
WP_032159263.1|4930509_4930959_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
>prophage 1
NZ_CP025751	Escherichia coli strain CV839-06 plasmid pCV839-06-p1, complete sequence	110160	20064	60400	110160	integrase,transposase	Sodalis_phage(12.5%)	45	38854:38868	53098:53112
WP_001352368.1|20064_21273_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|21638_22844_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|23287_23608_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|23600_23987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|23994_24681_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001322387.1|24658_25285_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089072.1|25363_26569_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|26681_27275_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001339197.1|27788_28997_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_085967404.1|29066_30196_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	8.7e-51
WP_000904897.1|30226_30850_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001138082.1|30975_33861_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_001044768.1|33921_34338_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|34334_34565_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000111771.1|34860_35151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963206.1|35140_36040_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000698737.1|36089_38315_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
WP_000952217.1|38316_39405_-	transcriptional repressor PifC	NA	NA	NA	NA	NA
38854:38868	attL	CGCGTCCGGCACCTC	NA	NA	NA	NA
WP_000465036.1|39956_40370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164198.1|40371_41151_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
WP_001144036.1|41329_41974_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030199.1|42060_42369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688514.1|42782_43763_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_001278818.1|43755_44172_+	recombinase	NA	NA	NA	NA	NA
WP_000457492.1|44173_45448_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.2	1.7e-143
WP_000109071.1|45447_45885_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|45881_46130_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000273918.1|46547_47450_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086178.1|47834_48518_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.0e-30
WP_001104887.1|48518_48740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274403.1|48751_49186_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015059345.1|49879_50452_+	YubH family protein	NA	NA	NA	NA	NA
WP_072132163.1|50547_50850_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271729.1|50896_51319_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027500.1|51315_51507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276110.1|52276_52804_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_000006014.1|52861_53095_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001145453.1|53153_55112_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.9	3.6e-20
53098:53112	attR	GAGGTGCCGGACGCG	NA	NA	NA	NA
WP_000845897.1|55166_55601_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|55597_56317_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000978012.1|56313_56910_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
WP_000117609.1|57372_57873_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	26.9	9.3e-05
WP_000218863.1|58601_59036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247862.1|59127_59394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039023393.1|59458_60400_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.0	2.7e-61
>prophage 1
NZ_CP025752	Escherichia coli strain CV839-06 plasmid pCV839-06-p2, complete sequence	63821	1095	12260	63821	transposase	Escherichia_phage(42.86%)	7	NA	NA
WP_094392493.1|1095_1329_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	50.0	2.0e-10
WP_000080195.1|1457_3071_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3101_3452_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3448_3874_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_077632055.1|5119_5902_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_000255956.1|5898_6921_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001384779.1|8168_12260_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	42.6	2.4e-284
