The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	186	5457	5366808	holin	Salmonella_phage(50.0%)	6	NA	NA
WP_077265603.1|186_1503_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1589_1994_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1980_2286_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|2275_2905_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|2901_3402_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|3588_5457_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 2
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	335575	342481	5366808	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|335575_336439_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|336449_337223_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|337464_338358_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|338603_339965_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|340283_341006_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_062955084.1|341002_342481_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	383014	398760	5366808		Enterobacteria_phage(33.33%)	15	NA	NA
WP_062955058.1|383014_384421_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_062955056.1|384644_385709_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
WP_062956182.1|385722_386592_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
WP_048996045.1|386623_387514_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_004175260.1|387528_388083_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_000704907.1|388262_389429_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_016947628.1|389857_389977_-	small membrane protein	NA	NA	NA	NA	NA
WP_062955151.1|390377_391382_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
WP_073547076.1|392221_393286_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_063002077.1|393299_394169_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_048996045.1|394200_395091_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_015958693.1|395105_395660_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_015958692.1|395746_396577_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_062955124.1|396605_397439_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_062955125.1|397428_398760_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	6.9e-15
>prophage 4
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	1375342	1386230	5366808		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|1375342_1378450_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|1378504_1379770_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|1379800_1380889_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|1380975_1381236_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_002904004.1|1381533_1382394_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|1382414_1383176_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002210514.1|1383437_1384340_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210515.1|1384351_1385617_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
WP_002210516.1|1385609_1386230_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	1614503	1652969	5366808	integrase,terminase	uncultured_Caudovirales_phage(34.04%)	56	1644082:1644096	1650091:1650105
WP_004152576.1|1614503_1615370_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|1615369_1616143_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|1616139_1617336_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|1617335_1617689_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|1617690_1618344_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|1618397_1618964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|1619006_1619189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|1619238_1619580_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|1619579_1620602_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|1620604_1620907_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|1620907_1621507_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|1621506_1623510_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|1623499_1623652_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|1623687_1624113_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|1624116_1624557_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|1624567_1625713_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|1625716_1626157_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|1626251_1626638_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|1626637_1627144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|1627140_1627560_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|1627528_1627810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|1627849_1628791_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|1628802_1629297_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|1629300_1630503_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|1630554_1631103_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|1631158_1632610_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|1632847_1634248_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|1634198_1634951_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|1635052_1635373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|1635607_1635997_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|1635993_1636524_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|1636526_1636775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|1637180_1637963_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|1637959_1638436_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|1638432_1639395_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|1639396_1641055_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|1641631_1641853_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|1641950_1642619_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|1642789_1643104_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|1643096_1643285_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|1643454_1643820_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|1643812_1644067_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|1644038_1644257_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
1644082:1644096	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|1644253_1644679_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|1644675_1644870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|1644866_1645694_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|1645798_1646317_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|1646322_1647033_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|1647022_1647247_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|1647243_1647456_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|1647452_1647932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|1648110_1648353_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|1648333_1649515_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|1649711_1650260_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
1650091:1650105	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|1650458_1651991_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|1652207_1652969_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 6
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	1685902	1716946	5366808	transposase,holin,integrase	Enterobacteria_phage(35.48%)	41	1685684:1685699	1714252:1714267
1685684:1685699	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|1685902_1686574_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|1686760_1687588_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|1687663_1688929_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|1688930_1689350_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|1689429_1690914_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|1691811_1692234_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|1692826_1693531_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|1694146_1694494_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|1694657_1695449_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|1696430_1697135_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|1697171_1697459_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|1697455_1697995_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|1697991_1698291_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004232548.1|1698940_1699630_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|1699629_1699770_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|1699766_1700405_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|1700397_1701066_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|1701062_1701230_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|1701210_1701678_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|1702198_1703227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|1703434_1703680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|1703735_1704038_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|1704034_1704883_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|1704879_1705740_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|1705825_1706047_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|1706087_1706315_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|1706426_1707125_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|1707147_1707267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|1707412_1708489_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|1708570_1708774_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|1709202_1709397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|1709485_1709770_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|1709785_1710631_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|1710627_1710915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|1710916_1711597_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|1711593_1712022_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|1712018_1712681_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|1712888_1714076_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|1714252_1715143_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
1714252:1714267	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|1715142_1716135_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|1716136_1716946_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 7
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	2079286	2164692	5366808	transposase,lysis,capsid,protease,tRNA,integrase,tail,head,portal,plate,terminase	Salmonella_phage(47.92%)	80	2134812:2134830	2164767:2164785
WP_002898139.1|2079286_2080579_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|2080669_2082013_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|2082021_2082633_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_103010540.1|2082755_2087009_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|2087144_2087639_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|2088144_2089140_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|2089254_2091021_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|2091021_2092743_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|2092787_2093489_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2093842_2094061_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|2094181_2096461_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|2096491_2096809_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2097134_2097356_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|2097432_2099373_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|2099369_2100485_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|2100631_2102290_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|2102709_2103405_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|2103520_2104420_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|2104563_2106216_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|2106226_2107195_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|2107406_2107841_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|2107992_2109711_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|2109749_2110751_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|2110761_2112204_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|2112291_2113305_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|2113301_2114132_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|2114163_2115303_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|2116180_2116696_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|2116922_2117651_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|2117671_2118403_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|2118409_2119126_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|2119125_2119794_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|2119977_2120709_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|2120751_2122224_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|2122220_2122937_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|2123015_2124143_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|2124184_2124673_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|2124730_2125576_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|2125572_2126526_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|2126536_2127670_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|2127833_2128946_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|2129294_2129774_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|2129862_2130765_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|2131586_2131874_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|2132076_2132340_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|2132346_2132730_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|2132996_2134682_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
2134812:2134830	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|2134901_2135120_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|2135211_2136312_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|2136308_2136794_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|2136790_2139418_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|2139410_2139530_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|2139544_2139844_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|2139896_2140412_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|2140421_2141594_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|2141732_2142809_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|2142838_2143042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|2143038_2143770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103010541.1|2143773_2146725_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|2146726_2147326_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|2147318_2148227_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|2148213_2148576_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|2148572_2149145_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|2149239_2149932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|2149928_2150375_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|2150367_2150799_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|2150894_2151323_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|2151319_2151703_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|2151707_2152217_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|2152197_2152413_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|2152416_2152620_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|2152619_2153084_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|2153179_2153830_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|2153833_2154892_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|2154908_2155742_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|2155884_2157651_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|2157650_2158676_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|2158737_2160480_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000019445.1|2160827_2161808_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_004151720.1|2163639_2164692_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
2164767:2164785	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 8
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	2818236	2829889	5366808	integrase	Enterobacteria_phage(70.0%)	13	2818686:2818700	2841742:2841756
WP_004144574.1|2818236_2819340_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
2818686:2818700	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|2819350_2820604_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|2820956_2822147_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|2822134_2823085_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|2823084_2823510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|2824077_2824644_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|2824661_2824907_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|2824903_2825641_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|2826182_2826449_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|2826445_2827003_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|2826999_2827227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|2827223_2827544_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|2827555_2829889_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
2841742:2841756	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 9
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	3297893	3306010	5366808	transposase	Enterobacteria_phage(83.33%)	8	NA	NA
WP_004152207.1|3297893_3300227_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|3300241_3300562_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|3300558_3300786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|3300782_3301331_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|3302154_3302892_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|3302888_3303134_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|3303151_3303718_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_000019445.1|3305029_3306010_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 10
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	4377199	4410457	5366808	capsid,protease,tRNA,integrase,tail,head,portal,terminase	uncultured_Caudovirales_phage(73.33%)	33	4394807:4394824	4410802:4410819
WP_002919147.1|4377199_4378147_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|4378161_4378671_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|4378799_4379924_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|4379895_4380369_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|4380394_4380937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|4380941_4381514_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|4381517_4382336_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|4382332_4382590_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|4382565_4383120_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|4388915_4389137_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|4389430_4392541_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|4392553_4393693_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|4394071_4394722_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
4394807:4394824	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|4394997_4396224_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|4396316_4397258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|4397439_4397724_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|4397734_4398514_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|4398965_4399235_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|4399227_4399416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|4399408_4399723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4399719_4400088_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|4400084_4400450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4400449_4402585_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|4402927_4403263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|4403311_4403824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|4404087_4405254_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|4405305_4405866_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|4405867_4407109_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|4407105_4407441_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|4407437_4407737_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|4407736_4408180_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|4408455_4408812_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|4408795_4410457_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
4410802:4410819	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 11
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	5169722	5218866	5366808	transposase,lysis,capsid,tRNA,integrase,tail,portal,head,coat,plate,terminase	Salmonella_phage(79.55%)	61	5169137:5169183	5207492:5207538
5169137:5169183	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000019445.1|5169722_5170703_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_062955148.1|5170748_5171747_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|5171749_5172379_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|5172501_5172744_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|5172776_5173286_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|5173293_5173494_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|5173457_5173796_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|5173863_5174097_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|5174096_5174324_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|5174320_5175172_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|5175168_5177553_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004152765.1|5178033_5179518_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|5179625_5179814_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|5179825_5180059_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|5180154_5180838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|5180824_5181904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|5181903_5182905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|5183426_5183696_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|5183752_5184796_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|5184795_5186559_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|5186699_5187533_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|5187549_5188602_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|5188605_5189259_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|5189354_5189819_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|5189818_5190022_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|5190025_5190241_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|5190221_5190731_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|5190735_5191119_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|5191115_5191544_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|5191639_5192062_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|5192054_5192501_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|5192523_5193390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|5193484_5194057_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|5194053_5194416_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|5194402_5195311_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|5195303_5195975_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|5195976_5197926_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|5197935_5199054_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|5199105_5200179_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|5200327_5201500_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|5201509_5202025_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|5202077_5202377_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|5202391_5202511_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|5202503_5205134_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|5205130_5205616_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|5205612_5206707_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|5206773_5206992_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|5207019_5207397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|5208000_5208483_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
5207492:5207538	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|5208593_5209070_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|5209059_5209350_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|5209416_5209758_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|5209905_5211567_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|5211653_5212532_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|5212656_5213247_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|5213366_5214653_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|5214672_5215464_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|5215627_5216992_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|5217251_5217500_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|5217518_5218067_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|5218098_5218866_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP025951	Klebsiella pneumoniae subsp. pneumoniae strain GD4 chromosome, complete genome	5366808	5323582	5361683	5366808	integrase,tail,terminase	Salmonella_phage(36.59%)	46	5316917:5316931	5347022:5347036
5316917:5316931	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|5323582_5325049_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|5325116_5326694_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|5326885_5328136_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|5328078_5328321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|5328317_5328911_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|5328907_5329570_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|5329566_5329725_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|5329717_5330011_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|5330120_5330369_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|5330417_5331299_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|5331295_5332117_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|5332113_5332413_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|5332779_5333361_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|5333515_5333749_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|5333895_5334105_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|5334104_5334872_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|5334868_5335654_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|5335773_5336121_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|5336313_5336724_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|5336707_5336899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|5336895_5337540_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|5337833_5338301_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|5338300_5338594_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|5338590_5339211_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|5339210_5339414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|5339406_5339745_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|5339841_5341326_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032418540.1|5341729_5341987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|5342064_5342649_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|5342645_5344121_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|5344164_5344536_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_004141368.1|5345289_5345496_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|5345510_5347193_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
5347022:5347036	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|5347189_5347486_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|5347488_5348169_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|5348183_5349170_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|5349223_5349661_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|5349671_5350013_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|5350063_5350387_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|5350386_5350992_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|5350991_5353469_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|5353468_5353933_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|5353932_5354472_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|5354482_5357017_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|5357016_5358927_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|5358926_5361683_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
>prophage 1
NZ_CP025952	Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence	170821	3143	52294	170821	transposase	Escherichia_phage(33.33%)	52	NA	NA
WP_001067855.1|3143_3848_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071177725.1|3881_9017_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_059274178.1|9016_11233_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_015059020.1|11283_12021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021559024.1|12223_12955_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000632668.1|12979_13501_-	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_015059018.1|13533_16350_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000944325.1|16346_17720_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_000126338.1|17706_18099_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_071776752.1|18052_18427_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000059817.1|18356_18902_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_000549793.1|18888_19170_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_015059017.1|19285_20029_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_053913405.1|20021_20279_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_015059015.1|20305_22156_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_001229309.1|22152_22575_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	86.8	9.4e-67
WP_000056336.1|22600_22972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087532.1|22968_23607_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_015059014.1|23633_24155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000412447.1|24217_24526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830838.1|24552_25545_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_001203735.1|25541_26174_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015059013.1|26170_26557_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001067855.1|26840_27545_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_008324180.1|27670_28045_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
WP_015493069.1|28670_29030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324185.1|29411_30140_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_008324186.1|30136_30568_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_015493071.1|32690_32921_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032072906.1|33898_34159_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
WP_015493073.1|34345_34537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|34579_35086_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493075.1|35490_36270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493076.1|36323_36743_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493077.1|36753_36975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|36974_37652_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493079.1|38010_38682_+	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_015493080.1|38861_39284_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493081.1|39283_40555_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_016479949.1|40690_41662_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493083.1|41658_42864_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_022652286.1|43226_43859_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
WP_040219232.1|43912_44113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493085.1|44259_45210_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_015493086.1|45206_45818_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493087.1|45814_46210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|46723_47704_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_042934582.1|48355_48913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|49381_50086_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|50218_50860_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|51009_51510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|51589_52294_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP025952	Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence	170821	59739	160607	170821	transposase,protease,integrase	Escherichia_phage(37.84%)	116	114902:114961	166601:167407
WP_001067858.1|59739_60444_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_071557810.1|60434_60575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333089.1|62385_62667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|62789_63140_-	protein stbB	NA	NA	NA	NA	NA
WP_000959884.1|63142_64105_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|64251_64545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|64621_65305_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|65305_65527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|65540_65975_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_011161242.1|66674_67247_+	YubH family protein	NA	NA	NA	NA	NA
WP_001198928.1|67219_67645_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271762.1|67691_68114_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027493.1|68110_68302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012372796.1|68615_70283_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_000218642.1|71682_71913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|71964_73326_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_015059007.1|73372_73936_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	6.1e-21
WP_000290834.1|74778_75306_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|75363_75597_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000845953.1|77749_78184_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276217.1|78180_78900_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|79179_79338_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001272251.1|80252_80549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234445.1|80659_81481_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_015059008.1|81777_82425_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|82701_83085_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_015059009.1|83275_83962_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_001254386.1|84055_84283_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_021519752.1|84316_84682_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012106.1|84696_85008_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399794.1|85029_85596_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_072095570.1|85606_86311_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_032297072.1|86310_87738_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000002778.1|87727_88318_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_001352845.1|88271_88502_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_001038341.1|88513_88765_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_062955122.1|88761_89277_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001278692.1|89411_89633_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	39.4	4.4e-07
WP_001067855.1|91600_92305_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|92310_92451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|92936_93674_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|93670_93895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954592.1|94016_94193_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|94374_95379_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_042863651.1|95457_98424_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_001067855.1|98544_99249_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000205770.1|99493_100240_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	4.2e-09
WP_000139328.1|100294_100855_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_015059022.1|100986_101187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032083981.1|101572_102172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001736714.1|102335_102566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312851.1|102870_103020_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083837.1|103303_103552_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001375168.1|103796_103871_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_032495102.1|103863_104721_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|105659_106313_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|106405_106663_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|106595_106997_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|108305_109010_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013188475.1|109520_110396_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_012579081.1|110475_111399_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001067855.1|113149_113854_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
114902:114961	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|114964_115669_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839979.1|115734_116253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|116257_116674_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|117059_117764_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000957857.1|118441_118630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|118721_119258_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|119440_120301_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|120470_121226_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067858.1|121675_122380_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_014343505.1|122576_122894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040245917.1|122908_123259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040245921.1|123255_123528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343509.1|124220_124379_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_014343510.1|124606_124981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023807.1|125036_125363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568058.1|125359_126088_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001568057.1|126084_126516_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_015493064.1|126560_128618_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	1.2e-21
WP_001568055.1|128687_128936_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_014343512.1|128984_129527_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_014343514.1|130359_130923_-	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	7.4e-19
WP_014343515.1|130970_132326_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001568051.1|132377_132608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568050.1|132699_132927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568049.1|133605_133926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|133960_134215_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_001568047.1|134402_134594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214014.1|134636_135143_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_013023797.1|135185_135851_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_013214013.1|136294_137062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|137115_137535_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|137544_137766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|137765_138467_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|138903_139134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214012.1|139196_139868_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|139870_140842_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152765.1|141090_142575_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568036.1|142985_143417_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_013214011.1|143416_144688_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_086523286.1|144769_145747_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977818.1|145743_146949_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_004118283.1|148058_148925_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_013214010.1|149702_149960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214009.1|150005_150785_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_011977814.1|150968_151973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977813.1|152002_152206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094960442.1|152251_152773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032738650.1|152830_153181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977810.1|153259_154204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|154782_155013_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|155009_155426_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|155499_157062_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|157046_158069_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000427619.1|159602_160607_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
166601:167407	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACT	NA	NA	NA	NA
