The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	120946	157897	4175806	terminase,tail,holin,plate,portal	uncultured_Caudovirales_phage(33.33%)	52	NA	NA
WP_041054788.1|120946_121921_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.6	7.7e-64
WP_019715076.1|121965_122388_-|holin	holin family protein	holin	D6R405	Bacillus_phage	72.9	2.0e-48
WP_041054785.1|122433_123327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229944.1|123413_123578_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
WP_009967793.1|123574_123910_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003229943.1|123919_125020_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_003229942.1|125022_125295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086352741.1|125291_125870_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	4.3e-14
WP_003229940.1|125853_126900_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	8.3e-72
WP_004398572.1|126892_127318_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	36.4	1.5e-11
WP_003229938.1|127330_127594_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_101172376.1|127590_128571_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.6	1.9e-41
WP_032722169.1|128583_129243_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	2.1e-25
WP_103030677.1|129235_133993_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.3e-44
WP_003229934.1|133995_134133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032722171.1|134174_134624_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	41.1	2.7e-11
WP_106610765.1|134781_134868_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_103030678.1|135222_135666_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	3.2e-25
WP_103030679.1|135668_137069_-|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	38.9	4.1e-74
WP_103030680.1|137069_137261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030681.1|137257_137695_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_103030682.1|137707_138211_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	45.7	7.1e-37
WP_103030683.1|138207_138570_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_103030684.1|138566_138962_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_103030685.1|138966_139278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229922.1|139288_140224_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	65.0	8.6e-105
WP_103030686.1|140242_141217_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.5	2.8e-58
WP_103030687.1|141232_142636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030688.1|142710_143610_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	6.9e-51
WP_103030689.1|143606_145139_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.3	2.1e-148
WP_103030690.1|145142_146438_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.6	6.7e-156
WP_103030691.1|146430_147225_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	57.7	3.0e-66
WP_059352316.1|147285_148149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158650568.1|148417_148939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030693.1|149016_149208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059352314.1|149349_149805_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	73.5	3.5e-59
WP_059352313.1|149899_150604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059352312.1|150680_151229_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_059352311.1|151334_151541_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	73.1	1.4e-20
WP_032725202.1|151625_152054_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	2.8e-42
WP_083510055.1|152148_152298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083510054.1|152288_153230_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	4.0e-57
WP_116758330.1|153111_153789_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	32.2	1.5e-05
WP_059352309.1|153865_154720_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	74.8	4.6e-113
WP_059352308.1|154722_155682_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	73.9	9.7e-136
WP_041055602.1|155787_155982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125825444.1|155941_156115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030694.1|156111_156366_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	9.1e-09
WP_015714341.1|156362_156932_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
WP_032725213.1|157005_157146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032722187.1|157148_157388_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021480133.1|157543_157897_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	48.6	8.0e-11
>prophage 2
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	296911	392137	4175806	protease,plate,head,terminase,tail,coat,holin,capsid,tRNA,portal	Bacillus_phage(63.83%)	109	NA	NA
WP_014664820.1|296911_298057_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	5.8e-87
WP_103030747.1|298083_299112_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_014664822.1|299141_299342_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_040082286.1|299334_300339_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.8	5.2e-07
WP_014664824.1|300349_300955_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_103030748.1|301093_301606_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_103030749.1|301653_302961_-	MFS transporter	NA	NA	NA	NA	NA
WP_014664827.1|303031_304057_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_014664828.1|304293_304941_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	5.4e-05
WP_014664829.1|304988_305108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158309477.1|305273_305636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040082282.1|305918_307373_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_040082280.1|307414_308137_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_040082279.1|308243_308843_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_040082278.1|308990_310148_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_040082277.1|310263_311370_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_040082276.1|311356_312226_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_040082275.1|312179_313772_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_103030750.1|313874_315062_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A141ZJV0	Faustovirus	27.8	2.3e-33
WP_014664839.1|315021_315564_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_040082272.1|315587_316445_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|316461_316905_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_014664841.1|316962_318249_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_103030751.1|318281_318860_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003222623.1|319182_319467_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_014477547.1|319479_319818_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_010330275.1|319820_320129_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014664844.1|320275_321142_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_014664845.1|321134_321929_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_014664846.1|322077_322884_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_014664847.1|322885_323566_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014664848.1|323618_324137_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_040082268.1|324133_325006_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|325036_326050_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_041053829.1|327082_327313_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_103030752.1|327290_327500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030753.1|328249_328648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101514191.1|328683_328872_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	50.0	7.2e-11
WP_103030754.1|329030_330803_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	55.8	1.2e-123
WP_069837749.1|330815_331277_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_103030755.1|331327_332296_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	68.5	3.1e-65
WP_103030756.1|332350_332614_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.7e-24
WP_031600555.1|332628_332841_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
WP_072693029.1|332892_333066_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	73.7	5.6e-18
WP_103030757.1|333065_333434_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	48.4	2.7e-17
WP_103030758.1|333447_335031_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	51.1	1.3e-65
WP_103030759.1|335213_335522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030760.1|335537_337436_-	teichoic acid biosynthesis protein	NA	A0A185AMX0	Staphylococcus_phage	32.1	9.5e-42
WP_103030761.1|337487_339191_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.3	8.2e-178
WP_072693023.1|339205_340045_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	59.0	8.9e-93
WP_072693022.1|340038_344526_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.5	2.0e-66
WP_103030762.1|344725_345103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019260068.1|345167_345779_-|tail	tail protein	tail	J7KKC8	Streptococcus_phage	35.1	3.6e-11
WP_077670783.1|345793_346186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032725460.1|346182_346581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077670782.1|346580_346895_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	2.2e-12
WP_077670781.1|346884_347187_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	2.8e-12
WP_046160659.1|347204_347666_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	58.9	1.0e-10
WP_069837311.1|347692_348979_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	45.2	2.7e-80
WP_088325970.1|349018_349756_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	56.4	6.9e-57
WP_088325968.1|349703_351011_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.7	9.3e-105
WP_088325966.1|351011_351203_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_069837308.1|351213_352923_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.5	6.0e-205
WP_088325964.1|352919_353435_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.2e-33
WP_103030763.1|353663_354029_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	3.9e-29
WP_158650569.1|354088_354229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030764.1|354389_354704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030765.1|354951_355230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060399192.1|355671_356085_-	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	97.7	5.6e-64
WP_103030766.1|356170_356521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030767.1|356508_356745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030768.1|356737_356956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030769.1|356968_357370_-	hypothetical protein	NA	M4ZR14	Bacillus_phage	97.0	3.0e-62
WP_103030770.1|357366_357549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103030771.1|357561_357747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158650570.1|357743_358106_-	hypothetical protein	NA	H0USU9	Bacillus_phage	59.6	4.6e-14
WP_046159989.1|358092_358284_-	hypothetical protein	NA	D6R426	Bacillus_phage	80.4	8.1e-18
WP_103030773.1|358284_358800_-	hypothetical protein	NA	D6R425	Bacillus_phage	95.9	6.4e-94
WP_014479861.1|358833_359373_-	hypothetical protein	NA	Q9ZXC2	Bacillus_phage	96.1	1.8e-94
WP_014479860.1|359369_359807_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	91.7	4.8e-74
WP_103030774.1|360008_362426_-	DNA primase	NA	D6R422	Bacillus_phage	89.0	0.0e+00
WP_103030775.1|362486_362924_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	96.6	3.8e-79
WP_019260095.1|362947_363145_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	87.5	1.1e-17
WP_041055408.1|363134_364073_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	93.2	2.8e-164
WP_041055411.1|364076_364631_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	96.2	6.9e-94
WP_103030776.1|364824_365100_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	48.3	1.7e-21
WP_060399201.1|365320_365593_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	94.4	1.4e-39
WP_069839654.1|365872_366307_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	91.0	2.6e-64
WP_060399203.1|366320_366767_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	88.5	3.5e-72
WP_103030777.1|366806_368234_+	recombinase family protein	NA	Q9T200	Bacillus_phage	84.8	3.8e-229
WP_083252877.1|368237_368654_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_040082267.1|368690_369260_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_095432363.1|369411_370410_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_103030778.1|370543_371290_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_103030779.1|371429_372722_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_103030780.1|372781_375424_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.8	1.7e-161
WP_003222590.1|375871_376063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103030781.1|376081_377107_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_103030782.1|377139_378846_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_103030783.1|378975_380268_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_071581540.1|380297_381272_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_103030784.1|381268_382057_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_083252879.1|382046_382991_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_071581542.1|383023_383854_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_014664862.1|383861_385229_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014114673.1|385976_386564_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014664864.1|386560_388885_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	2.6e-182
WP_014664865.1|389065_390724_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|390874_392137_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 3
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	982192	989925	4175806	holin	Organic_Lake_phycodnavirus(50.0%)	9	NA	NA
WP_103031011.1|982192_982873_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_103031012.1|982889_983810_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_103031013.1|983821_984475_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_103031014.1|984489_985635_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	2.7e-15
WP_014665404.1|985918_986452_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014478003.1|986483_987158_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_103031015.1|987175_988093_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228349.1|988106_988760_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003243370.1|988782_989925_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
>prophage 4
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	1382569	1462419	4175806	bacteriocin,tRNA,protease,coat	Bacillus_phage(21.43%)	78	NA	NA
WP_014665762.1|1382569_1384240_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_103031166.1|1384236_1384665_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|1384976_1385108_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_080478285.1|1385064_1385217_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	NA	NA	NA	NA
WP_103031167.1|1385241_1386588_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|1386600_1386762_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_040081524.1|1386758_1387478_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	5.6e-19
WP_103031168.1|1387470_1388781_+|bacteriocin	bacteriocin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_103032367.1|1388770_1389931_+	insulinase family protein	NA	NA	NA	NA	NA
WP_103031169.1|1389935_1391216_+	insulinase family protein	NA	NA	NA	NA	NA
WP_103031170.1|1391212_1391914_+|bacteriocin	bacteriocin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_103031171.1|1391919_1393296_-	YncE family protein	NA	NA	NA	NA	NA
WP_103031172.1|1393335_1394691_-	YncE family protein	NA	NA	NA	NA	NA
WP_103031174.1|1394920_1396066_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	44.8	5.1e-83
WP_014665774.1|1396049_1396169_+	PhrC/PhrF family phosphatase-inhibitory pheromone	NA	NA	NA	NA	NA
WP_103031175.1|1396267_1396741_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_003227545.1|1396772_1397645_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|1397705_1398536_-	spermidine synthase	NA	NA	NA	NA	NA
WP_103031176.1|1398737_1400813_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_103031177.1|1401211_1401712_-	histidine kinase	NA	NA	NA	NA	NA
WP_080478364.1|1402297_1403236_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	45.7	8.8e-57
WP_014665777.1|1404343_1404862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014665778.1|1404875_1405535_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_040081512.1|1405643_1405832_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003242889.1|1405874_1406294_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103031178.1|1406413_1408330_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	42.7	9.6e-143
WP_103031180.1|1409179_1410580_-	MFS transporter	NA	NA	NA	NA	NA
WP_095431140.1|1410576_1411047_-	RrF2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_040081509.1|1411159_1411660_-	YwgA family protein	NA	NA	NA	NA	NA
WP_014665786.1|1411695_1412997_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	5.5e-25
WP_103031181.1|1413158_1413383_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_103031182.1|1413596_1414376_+	prespore-specific transcription regulator RsfA	NA	NA	NA	NA	NA
WP_103031183.1|1414520_1415411_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014665791.1|1415579_1416425_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_014665792.1|1416472_1417372_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_014665793.1|1417517_1418489_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_158650576.1|1418759_1419524_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_014665795.1|1419656_1420436_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_103031184.1|1420451_1421651_-	transaminase BacF	NA	NA	NA	NA	NA
WP_103031185.1|1421651_1422836_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_103031186.1|1422832_1424251_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_014665799.1|1424268_1425030_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	1.3e-21
WP_014665800.1|1425032_1425740_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_040081502.1|1425729_1426344_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_014665803.1|1426495_1427734_-	MFS transporter	NA	NA	NA	NA	NA
WP_103031187.1|1427941_1429354_-	amino acid permease	NA	NA	NA	NA	NA
WP_103031188.1|1429353_1431054_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_103031189.1|1431127_1432675_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014665807.1|1432906_1434181_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_040081494.1|1434356_1434821_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_103031190.1|1435144_1435600_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_103031191.1|1435592_1436444_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.4	2.2e-38
WP_040081490.1|1436457_1437405_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.5	1.7e-71
WP_014665812.1|1437404_1438145_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	42.3	5.3e-49
WP_103031192.1|1438169_1439189_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_103031193.1|1439191_1439914_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_103031194.1|1439906_1441028_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_103031195.1|1441027_1441897_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_103031196.1|1443086_1444511_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_103031197.1|1444515_1445286_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_014665822.1|1445605_1446142_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_014665823.1|1446185_1446557_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_095431121.1|1446618_1447941_-	purine permease	NA	NA	NA	NA	NA
WP_014665825.1|1447960_1448278_-	YwdI family protein	NA	NA	NA	NA	NA
WP_103031198.1|1448444_1449815_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_040081472.1|1449839_1450517_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	2.4e-48
WP_103031199.1|1450530_1451337_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_041521100.1|1451426_1451960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103031200.1|1452007_1452643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040081468.1|1452635_1452974_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069838467.1|1453117_1453933_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_014665831.1|1454022_1454271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103031201.1|1454364_1455804_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	27.8	5.7e-23
WP_103031202.1|1455800_1457186_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_014481261.1|1457487_1458258_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_103031203.1|1458296_1459127_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|1459166_1459469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046381416.1|1459998_1462419_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
>prophage 5
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	1935665	2000784	4175806	plate,integrase,terminase,tail,holin,capsid,tRNA,portal	Bacillus_phage(42.86%)	78	1948589:1948636	2001914:2001961
WP_103031391.1|1935665_1936409_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003241966.1|1936570_1937008_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004399691.1|1937028_1937421_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_069148835.1|1937883_1938651_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014662543.1|1938835_1939279_+	YbaK family protein	NA	NA	NA	NA	NA
WP_014662544.1|1939338_1940052_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A0N6W8I1	Bacillus_phage	30.5	4.8e-15
WP_040081013.1|1940146_1941205_+	iron-sulfur carrier protein/transcriptional regulator SalA	NA	NA	NA	NA	NA
WP_014662546.1|1941241_1941799_-	spore germination protein GerD	NA	NA	NA	NA	NA
WP_103031392.1|1941908_1942505_+	KinB-signaling pathway activation protein	NA	NA	NA	NA	NA
WP_015252978.1|1942505_1943270_-	polysaccharide deacetylase family sporulation protein PdaB	NA	NA	NA	NA	NA
1948589:1948636	attL	CTTCCATGGTAAGGAAGAGGTCAGCGGTTCGAGCCCGCTTGGAAGCTT	NA	NA	NA	NA
WP_103031393.1|1948741_1949926_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	40.5	1.5e-74
WP_103031394.1|1949912_1950446_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	50.6	1.8e-38
WP_103031395.1|1950526_1951132_-	hypothetical protein	NA	O64079	Bacillus_phage	75.8	7.2e-60
WP_019713074.1|1951363_1951690_-	helix-turn-helix transcriptional regulator	NA	O64078	Bacillus_phage	91.6	1.5e-48
WP_103031396.1|1951855_1952104_+	helix-turn-helix transcriptional regulator	NA	A0A290G4F8	Caldibacillus_phage	45.7	4.4e-08
WP_103031397.1|1952119_1952311_+	helix-turn-helix domain-containing protein	NA	U5P0W4	Brevibacillus_phage	44.8	2.9e-07
WP_103031398.1|1952375_1952909_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103031399.1|1952898_1953159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031400.1|1953741_1953927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031401.1|1953923_1955897_+	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	48.3	1.7e-155
WP_103031402.1|1955896_1956121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031403.1|1956113_1956995_+	recombinase RecT	NA	D7RWF9	Brochothrix_phage	61.3	2.0e-87
WP_103031404.1|1956991_1957693_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	70.0	3.2e-96
WP_103031405.1|1957897_1958662_+	hypothetical protein	NA	U5Q085	Bacillus_phage	31.9	2.0e-11
WP_010330160.1|1958675_1958957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031406.1|1958931_1960230_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	42.6	1.6e-93
WP_103031408.1|1960543_1960999_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	67.6	6.0e-51
WP_103031409.1|1960971_1961664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031410.1|1961790_1961973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014112378.1|1962042_1962246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031411.1|1962286_1962766_+	hypothetical protein	NA	A0A0M3ULE9	Bacillus_phage	38.1	4.0e-21
WP_103031412.1|1962783_1963071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031413.1|1963067_1963340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031414.1|1963373_1963976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031415.1|1963972_1964254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031416.1|1964250_1964649_+	hypothetical protein	NA	M4ZR14	Bacillus_phage	89.4	6.8e-59
WP_019712760.1|1964730_1965117_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	56.5	4.2e-29
WP_103031417.1|1965185_1965938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031419.1|1966694_1967039_+	structural protein	NA	M4ZRM2	Bacillus_phage	57.0	4.8e-29
WP_103031420.1|1967106_1967580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031421.1|1967635_1968913_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	40.2	3.6e-77
WP_103031422.1|1969050_1969299_+	hypothetical protein	NA	A8ATN7	Listeria_phage	36.7	2.7e-05
WP_103031423.1|1969428_1969959_+	YfbU family protein	NA	NA	NA	NA	NA
WP_103031424.1|1970044_1970932_+|terminase	terminase	terminase	A0A1L2JY44	Aeribacillus_phage	70.7	2.4e-16
WP_103032378.1|1970931_1972236_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.3	2.7e-157
WP_103031425.1|1972240_1973773_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	54.4	7.4e-154
WP_103031426.1|1973769_1974687_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.9	2.8e-55
WP_103031427.1|1974733_1975393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031428.1|1975444_1976632_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	51.7	5.5e-80
WP_103031429.1|1976663_1977599_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.0	5.1e-105
WP_103031430.1|1977610_1977964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031431.1|1977969_1978362_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	37.7	3.8e-14
WP_103031432.1|1978358_1978721_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_103031433.1|1978717_1979218_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.2	3.0e-40
WP_103031434.1|1979230_1979668_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_032724149.1|1979664_1979856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031435.1|1979856_1981257_+|tail	phage tail sheath protein	tail	S5MNC1	Brevibacillus_phage	39.3	1.7e-75
WP_103031436.1|1981259_1981703_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	7.1e-25
WP_080010220.1|1981977_1982064_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_103031437.1|1982219_1982669_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.6	2.3e-10
WP_019713118.1|1982710_1982848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031438.1|1982850_1988193_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.5	7.0e-42
WP_103031439.1|1988185_1988845_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	35.8	6.7e-27
WP_103031440.1|1988859_1989840_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.3	2.7e-40
WP_103031441.1|1989836_1990103_+	DUF2577 family protein	NA	NA	NA	NA	NA
WP_103031442.1|1990115_1990541_+	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	35.6	1.1e-11
WP_103031443.1|1990533_1991580_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	1.8e-71
WP_103031444.1|1991563_1992142_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	4.3e-14
WP_019712734.1|1992138_1992411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031445.1|1992414_1994172_+|terminase	terminase	terminase	A0A1L2K2Q1	Aeribacillus_phage	28.5	2.0e-14
WP_103031446.1|1994181_1994517_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_010330111.1|1994513_1994678_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	69.8	1.9e-15
WP_103031447.1|1994766_1995660_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_103031448.1|1995709_1996132_+|holin	holin family protein	holin	D6R405	Bacillus_phage	83.5	4.8e-55
WP_103031449.1|1996174_1997146_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	68.5	7.0e-65
WP_044430364.1|1997197_1997662_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_103031450.1|1997680_1999444_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	54.3	1.4e-127
WP_103031451.1|1999653_2000784_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	39.8	6.4e-70
2001914:2001961	attR	CTTCCATGGTAAGGAAGAGGTCAGCGGTTCGAGCCCGCTTGGAAGCTT	NA	NA	NA	NA
>prophage 6
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	2534727	2543092	4175806		Synechococcus_phage(50.0%)	8	NA	NA
WP_003233955.1|2534727_2536023_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
WP_014663061.1|2536096_2536822_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.7	2.7e-45
WP_003219409.1|2536814_2537069_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014663062.1|2537065_2537749_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_103031682.1|2537732_2539961_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	1.9e-158
WP_003233947.1|2539936_2541367_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_069149094.1|2541467_2542508_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.2e-64
WP_014663065.1|2542504_2543092_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	42.1	2.2e-29
>prophage 7
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	3067122	3100194	4175806	tRNA,coat	Bacillus_phage(75.0%)	35	NA	NA
WP_103031888.1|3067122_3067806_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_040083433.1|3067903_3068356_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014479465.1|3068483_3068972_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_014663554.1|3069123_3069633_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014663555.1|3069727_3070051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014663556.1|3070090_3070477_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014476457.1|3070636_3070993_+	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_040083432.1|3071273_3071480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040083431.1|3071561_3071717_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_014479471.1|3071862_3072117_+	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_158650586.1|3072190_3074470_-	UvrD-helicase domain-containing protein	NA	A0A068EQC7	Bacillus_phage	35.1	1.6e-91
WP_040083429.1|3074586_3074841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031889.1|3074912_3075335_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014663564.1|3075338_3075854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103031890.1|3075890_3076613_-	esterase family protein	NA	NA	NA	NA	NA
WP_103032407.1|3076968_3078090_+	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.0	1.8e-16
WP_103031891.1|3078082_3079255_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_103031892.1|3079481_3080027_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_103031893.1|3080095_3081286_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_103031894.1|3082569_3084432_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	54.6	7.4e-124
WP_103031895.1|3086195_3087359_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	29.3	1.8e-43
WP_103031896.1|3087605_3087923_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_103031897.1|3088160_3088916_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003232839.1|3089075_3089423_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_103031898.1|3089986_3091933_+	mannose transport/utilization transcriptional regulator ManR	NA	NA	NA	NA	NA
WP_103031899.1|3092082_3094041_+	PTS mannose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_103031900.1|3094056_3095004_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_103031901.1|3095173_3095656_+	YjdF family protein	NA	NA	NA	NA	NA
WP_103031902.1|3095699_3096206_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069838970.1|3096415_3096811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103031903.1|3097038_3097518_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003232825.1|3097555_3097750_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_014663588.1|3097806_3098139_-	YjdJ family protein	NA	NA	NA	NA	NA
WP_103031905.1|3098860_3099823_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_103031906.1|3099972_3100194_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	3133778	3207219	4175806	protease,terminase,tail,holin,plate,portal	Bacillus_phage(23.26%)	85	NA	NA
WP_040083384.1|3133778_3135050_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_080478209.1|3135194_3136331_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.6	1.7e-94
WP_014663627.1|3136320_3136455_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_014663628.1|3136485_3136740_-	YciI family protein	NA	NA	NA	NA	NA
WP_040083382.1|3136861_3137815_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	71.7	6.8e-65
WP_014479546.1|3137852_3138230_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
WP_040083381.1|3138334_3138937_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	1.7e-45
WP_014663631.1|3139013_3139850_+	manganese catalase	NA	NA	NA	NA	NA
WP_040083380.1|3139893_3140490_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	6.2e-40
WP_014663633.1|3140654_3140993_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.3	2.9e-18
WP_003232712.1|3141171_3141351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040083379.1|3141337_3142174_+	hypothetical protein	NA	S6BFM4	Thermus_phage	29.7	1.9e-23
WP_080478210.1|3142073_3142874_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	5.0e-61
WP_014663637.1|3142873_3143041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014663639.1|3143125_3143476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040083377.1|3143472_3143679_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	2.1e-11
WP_014663641.1|3143793_3144303_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	39.5	3.6e-20
WP_040083376.1|3144420_3145218_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.2	9.4e-60
WP_103031918.1|3145214_3146516_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.9	6.3e-154
WP_103031919.1|3146519_3148007_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	5.9e-140
WP_103031920.1|3148026_3148854_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.7	1.6e-54
WP_003232690.1|3148879_3149815_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_103031921.1|3149836_3150220_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_014663647.1|3150216_3150573_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_069149440.1|3150569_3151055_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	45.7	8.9e-37
WP_040083370.1|3151067_3151508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003220589.1|3151511_3151730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031922.1|3151726_3153127_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	39.3	1.6e-78
WP_003232677.1|3153128_3153572_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_103031923.1|3153698_3154103_+|portal	phage portal protein	portal	A0A249XXA9	Clostridium_phage	36.0	5.7e-13
WP_080478211.1|3154132_3154282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031924.1|3154283_3158165_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	9.3e-44
WP_003232674.1|3158157_3158817_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	3.7e-25
WP_103031925.1|3158832_3159810_+|portal	phage portal protein	portal	H7BV96	unidentified_phage	32.3	3.9e-39
WP_103031926.1|3159809_3160076_+	DUF2577 family protein	NA	S6C459	Thermus_phage	36.4	2.9e-05
WP_014663657.1|3160133_3160559_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	37.3	6.6e-12
WP_069149448.1|3160551_3161598_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
WP_069838922.1|3161581_3162160_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	5.1e-15
WP_103031927.1|3162156_3162429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103031928.1|3162431_3164873_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	39.1	5.7e-23
WP_103031929.1|3164890_3165217_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_103031930.1|3165213_3165378_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	69.8	5.0e-16
WP_103031931.1|3165422_3166262_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_003232655.1|3166314_3166584_+	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	6.2e-24
WP_003232653.1|3166596_3166860_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
WP_040083358.1|3166872_3167766_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	8.9e-83
WP_136654612.1|3167803_3167941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003239095.1|3168026_3168197_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
WP_103031932.1|3168196_3168943_-	toxin-antitoxin-antitoxin system toxin SpoIISA	NA	NA	NA	NA	NA
WP_014663667.1|3169052_3170054_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_003218470.1|3170066_3170684_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_014663668.1|3170960_3172277_-	serine/threonine exchanger	NA	NA	NA	NA	NA
WP_069149457.1|3172664_3173615_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_103031933.1|3173852_3176003_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_014663672.1|3176014_3176986_+	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.0	1.9e-62
WP_103031934.1|3177506_3178877_-|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.3	3.8e-24
WP_103031935.1|3179042_3179861_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_103031936.1|3179989_3180814_+	D-aminopeptidase DppA	NA	NA	NA	NA	NA
WP_103031937.1|3180830_3181757_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_103031938.1|3181762_3182725_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_103031939.1|3182729_3183737_+	dipeptide ABC transporter ATP-binding subunit DppD	NA	G9BWD6	Planktothrix_phage	28.3	6.8e-15
WP_103032408.1|3183739_3185389_+	dipeptide ABC transporter substrate-binding protein DppE	NA	NA	NA	NA	NA
WP_103031940.1|3185476_3186436_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_103031941.1|3186432_3187533_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_103031942.1|3187529_3188420_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	40.3	1.0e-17
WP_040083344.1|3188432_3189422_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
WP_103031943.1|3189457_3190507_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_103031944.1|3190596_3191457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232595.1|3191616_3192135_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_103031945.1|3192373_3193573_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_103031946.1|3193972_3194704_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_103031947.1|3194795_3195323_+	DinB family protein	NA	NA	NA	NA	NA
WP_103031948.1|3195312_3195828_+	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	31.3	2.5e-13
WP_014663694.1|3196048_3196387_+	multidrug efflux SMR transporter subunit YkkC	NA	NA	NA	NA	NA
WP_103031949.1|3196386_3196704_+	multidrug efflux SMR transporter subunit YkkD	NA	NA	NA	NA	NA
WP_014663695.1|3196774_3197677_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_014663696.1|3198027_3199125_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.8	2.8e-70
WP_103031950.1|3199136_3200384_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.4	9.5e-99
WP_103031951.1|3200512_3200938_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_040083337.1|3200978_3201413_-	organic hydroperoxide resistance transcriptional regulator OhrR	NA	NA	NA	NA	NA
WP_103031952.1|3201555_3201966_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069149472.1|3202284_3202755_-	guanine deaminase	NA	S4VYZ2	Pandoravirus	45.8	4.0e-26
WP_103031953.1|3202889_3203516_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_103031954.1|3203556_3205845_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_014663706.1|3206259_3207219_-|protease	serine protease Isp	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
>prophage 9
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	3610347	3616905	4175806		Bacillus_phage(50.0%)	6	NA	NA
WP_040083097.1|3610347_3610740_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	1.1e-29
WP_095432820.1|3610699_3612802_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	87.0	0.0e+00
WP_014664066.1|3612819_3613809_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.8	1.1e-155
WP_103032092.1|3613857_3614478_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	1.0e-45
WP_103032093.1|3614541_3615309_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.1	1.6e-51
WP_003231746.1|3615936_3616905_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
>prophage 10
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	3819915	3822507	4175806		Bacillus_phage(100.0%)	7	NA	NA
WP_103032175.1|3819915_3820272_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	87.4	4.2e-52
WP_103032177.1|3820928_3821057_-	hypothetical protein	NA	O64090	Bacillus_phage	88.4	8.6e-16
WP_103032178.1|3821066_3821279_-	hypothetical protein	NA	O64089	Bacillus_phage	80.3	1.9e-23
WP_103032179.1|3821282_3821534_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	98.8	3.5e-37
WP_103032419.1|3821599_3821779_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	96.4	5.8e-26
WP_103032180.1|3821890_3822121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103032420.1|3822129_3822507_-	hypothetical protein	NA	O64087	Bacillus_phage	74.8	3.0e-40
>prophage 11
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	3830804	3837390	4175806		Bacillus_phage(100.0%)	9	NA	NA
WP_103032188.1|3830804_3830957_+	hypothetical protein	NA	A0A1P8CWZ1	Bacillus_phage	94.0	1.2e-19
WP_103032190.1|3831694_3832069_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	50.4	1.3e-27
WP_103032191.1|3832853_3832976_+	hypothetical protein	NA	A0A1P8CWN5	Bacillus_phage	89.7	6.1e-11
WP_103032192.1|3833156_3834272_+	response regulator aspartate phosphatase RapK	NA	D6R410	Bacillus_phage	49.2	8.8e-96
WP_069839317.1|3834268_3834391_+	phosphatase RapK inhibitor PhrK	NA	NA	NA	NA	NA
WP_103032193.1|3835683_3836016_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	98.2	5.0e-55
WP_103032194.1|3836182_3836518_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	97.3	6.1e-53
WP_103032195.1|3836560_3836917_-	hypothetical protein	NA	O64028	Bacillus_phage	96.6	3.6e-59
WP_103032196.1|3836922_3837390_-	YolA family protein	NA	O64027	Bacillus_phage	98.7	5.7e-81
>prophage 12
NZ_CP025941	Bacillus subtilis strain BJ3-2 chromosome, complete genome	4175806	4053116	4061011	4175806		Staphylococcus_phage(57.14%)	10	NA	NA
WP_103032282.1|4053116_4054265_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	34.4	5.0e-22
WP_014477219.1|4054387_4054927_-	YpuI family protein	NA	NA	NA	NA	NA
WP_103032283.1|4054981_4055575_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	1.5e-14
WP_014664459.1|4055564_4056320_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	1.9e-09
WP_103032284.1|4056533_4057058_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_014664461.1|4057071_4057446_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|4057559_4058024_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_103032285.1|4058056_4059253_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	55.2	1.4e-115
WP_103032286.1|4059267_4059915_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	1.4e-42
WP_103032287.1|4059925_4061011_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.8	1.5e-55
