The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033600	Pasteurella multocida strain CQ6 chromosome, complete genome	2354071	33425	77326	2354071	integrase,tail,tRNA,terminase,head	Mannheimia_phage(58.14%)	60	34987:35032	85695:85740
WP_014325699.1|33425_34868_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
34987:35032	attL	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
WP_014390695.1|35136_36309_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	53.1	2.0e-111
WP_051127937.1|36684_36957_-	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	41.1	4.9e-08
WP_016533427.1|37255_37555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570062.1|37564_38098_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	36.6	1.3e-20
WP_014391447.1|38232_38832_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	37.6	4.6e-19
WP_014391448.1|38882_39671_-	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_016570064.1|39742_40096_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_016533530.1|40138_40330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570065.1|40341_40806_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_064775601.1|40809_41421_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016533454.1|41413_42265_-	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_016570067.1|42268_43255_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	39.9	5.8e-51
WP_016570068.1|43432_43669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|43655_43940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|44006_44318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391102.1|45527_46061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102827045.1|46148_46412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081375317.1|46508_47759_-	SIR2 family protein	NA	Q38324	Lactococcus_phage	31.5	5.3e-25
WP_102827047.1|48446_48737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570073.1|49458_49773_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	50.0	2.4e-19
WP_016570074.1|49769_50060_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	50.0	2.2e-14
WP_080673118.1|50084_50549_-	hypothetical protein	NA	A0A0M3LP99	Mannheimia_phage	60.5	1.2e-19
WP_016570076.1|50559_50955_-	hypothetical protein	NA	A0A0M3LQX0	Mannheimia_phage	77.8	2.2e-57
WP_016570077.1|51022_51679_-	helix-turn-helix domain-containing protein	NA	A0A0M3LSL8	Mannheimia_phage	61.2	5.9e-68
WP_016570078.1|51809_52016_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LSY2	Mannheimia_phage	64.7	8.7e-18
WP_016570079.1|52064_52517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391467.1|52574_52835_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	65.3	3.5e-16
WP_015691057.1|52919_53738_+	hypothetical protein	NA	Q7Y5W1	Haemophilus_phage	58.2	5.6e-76
WP_015691058.1|53734_55099_+	AAA family ATPase	NA	A0A0M3LQC0	Mannheimia_phage	51.7	2.0e-126
WP_015691059.1|55095_55464_+	site-specific DNA-methyltransferase (adenine-specific)	NA	A0A0M3LPV8	Mannheimia_phage	87.4	5.3e-50
WP_015691060.1|55473_55824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691061.1|55845_56352_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	82.7	9.8e-79
WP_016570080.1|56502_57105_+	protein ninG	NA	H6WRY9	Salmonella_phage	37.7	5.3e-31
WP_016533470.1|57104_57470_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_099821837.1|58271_58529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069915984.1|58525_59056_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	48.0	3.6e-39
WP_079157976.1|59028_59352_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_156707166.1|60011_60212_-	addiction module toxin, HicA family	NA	D6R431	Bacillus_phage	44.8	1.1e-06
WP_014390737.1|60294_60792_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
WP_156707167.1|60775_62011_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LPI9	Mannheimia_phage	75.9	4.0e-190
WP_102827081.1|62020_63424_+	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	59.8	3.0e-154
WP_064775738.1|63413_65015_+|head	phage head morphogenesis protein	head	A0A0M3LQ07	Mannheimia_phage	52.1	3.3e-152
WP_015691070.1|65017_65236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691071.1|65210_65645_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	61.2	3.1e-41
WP_015691073.1|65980_66751_+	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.2	1.5e-25
WP_015691074.1|66768_67926_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	43.3	8.3e-81
WP_015691075.1|67982_68219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691076.1|68235_68703_+	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
WP_015691077.1|68704_69079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102827082.1|69080_69482_+	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	60.6	1.1e-37
WP_064964910.1|69481_69877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064964909.1|69889_70906_+	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	72.8	2.4e-140
WP_005756587.1|70979_71384_+	hypothetical protein	NA	A0A0M3LPJ3	Mannheimia_phage	56.7	3.7e-36
WP_015691081.1|71392_71722_+	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	62.5	4.6e-29
WP_015691082.1|71729_72056_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	37.6	1.2e-16
WP_064964908.1|72073_75322_+	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	35.4	2.9e-91
WP_102827080.1|75318_76023_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.1	1.2e-79
WP_102827079.1|76025_76760_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	62.7	1.9e-86
WP_102827078.1|76702_77326_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	55.3	9.6e-52
85695:85740	attR	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP033600	Pasteurella multocida strain CQ6 chromosome, complete genome	2354071	1108505	1117863	2354071		Sinorhizobium_phage(16.67%)	9	NA	NA
WP_014326205.1|1108505_1109780_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.8e-92
WP_005753554.1|1109820_1110438_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_014326206.1|1110437_1111325_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005724296.1|1111394_1112342_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
WP_005753553.1|1112417_1113971_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_010906540.1|1114205_1114997_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
WP_005724066.1|1115005_1115791_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005724065.1|1115867_1116848_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
WP_014326208.1|1116864_1117863_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
>prophage 3
NZ_CP033600	Pasteurella multocida strain CQ6 chromosome, complete genome	2354071	1473708	1518001	2354071	integrase,terminase,tail	Mannheimia_phage(47.83%)	66	1476580:1476630	1527318:1527368
WP_005719438.1|1473708_1474209_+	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
WP_005725034.1|1475427_1476282_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
1476580:1476630	attL	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
WP_014391441.1|1476656_1477712_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.9	1.6e-62
WP_075271365.1|1477615_1477918_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014391442.1|1478101_1478824_-	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
WP_064775645.1|1478834_1479056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691048.1|1479300_1480209_-	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	36.1	2.5e-40
WP_064775646.1|1480312_1480801_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	51.2	3.2e-34
WP_080637896.1|1480812_1481025_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_016533502.1|1481012_1481378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775647.1|1481374_1481974_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.9e-18
WP_016570064.1|1482882_1483236_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_016533530.1|1483278_1483470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570065.1|1483481_1483946_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_064775601.1|1483949_1484561_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_156707170.1|1485705_1486392_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	45.0	3.1e-43
WP_016570068.1|1486569_1486806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|1486792_1487077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|1487143_1487455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570070.1|1487516_1488164_-	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	64.2	3.5e-36
WP_016533491.1|1488429_1488975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|1489566_1489797_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_016533476.1|1490415_1490799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533477.1|1490795_1491275_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533478.1|1491277_1491541_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_064775603.1|1491686_1492376_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_005720263.1|1492503_1492713_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_014391093.1|1492781_1493009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775604.1|1493066_1493768_+	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014390722.1|1493764_1494118_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_016533442.1|1494119_1495022_+	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_016533441.1|1495021_1495711_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_041423202.1|1495720_1496251_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016569985.1|1496240_1496699_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_016533468.1|1496772_1496985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775605.1|1497072_1497675_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_016533470.1|1497674_1498040_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_143930513.1|1498229_1498415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391475.1|1498628_1498889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014667794.1|1498885_1499416_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	9.7e-45
WP_014667795.1|1499388_1499712_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_064775606.1|1499617_1499899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390736.1|1499933_1500368_-	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_016533497.1|1500396_1500579_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	3.8e-09
WP_014390737.1|1500661_1501159_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
WP_102822904.1|1501142_1502369_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	76.8	2.7e-191
WP_016533291.1|1502383_1503829_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	58.6	2.4e-146
WP_014390740.1|1503782_1504754_+	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
WP_016533290.1|1504768_1506115_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	55.3	4.0e-127
WP_016533289.1|1506114_1506549_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.7	1.1e-54
WP_016533288.1|1506560_1507559_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	74.7	9.1e-145
WP_156707171.1|1507569_1507911_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	73.9	3.7e-13
WP_078819881.1|1507891_1508260_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	3.6e-22
WP_014390746.1|1508262_1508607_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
WP_014390747.1|1508611_1508983_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
WP_016533319.1|1508979_1509351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390749.1|1509362_1509845_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
WP_014390750.1|1509898_1510570_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.4	2.6e-42
WP_078801827.1|1510628_1511003_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_014390752.1|1511078_1511897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390754.1|1512235_1513060_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	70.5	6.1e-46
WP_014390755.1|1513111_1515556_+|tail	tail length tape measure protein	tail	A0A0M3LS54	Mannheimia_phage	48.5	1.1e-156
WP_099803088.1|1515558_1515888_+	hypothetical protein	NA	S5MW28	Escherichia_phage	37.1	8.5e-15
WP_102827076.1|1515977_1516691_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.4	2.1e-82
WP_102827075.1|1516694_1517438_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	59.6	4.3e-83
WP_102827074.1|1517380_1518001_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.9e-52
1527318:1527368	attR	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
