The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025716	Escherichia coli strain BH100L substr. MG2017 chromosome, complete genome	5033214	136376	167204	5033214	bacteriocin,transposase	Erysipelothrix_phage(20.0%)	26	NA	NA
WP_000471925.1|136376_136661_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001311381.1|136828_137068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282227.1|137068_137359_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000085117.1|137525_137714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543774.1|137767_138058_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000331776.1|138513_139278_+	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_000003823.1|139438_142102_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_000963500.1|142116_144009_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_000102485.1|144216_145641_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
WP_000784420.1|145882_147640_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_001295775.1|147993_150591_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_001346485.1|150765_151128_+	YacL family protein	NA	NA	NA	NA	NA
WP_000734302.1|151165_151960_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000818414.1|151975_152842_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_001295568.1|152947_153295_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_001189641.1|153460_155011_+	multicopper oxidase CueO	NA	NA	NA	NA	NA
WP_099989771.1|155207_156555_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001298426.1|156702_159093_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|159298_159835_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651600.1|159875_160538_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|160646_161573_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000682770.1|161956_162478_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000901994.1|163880_164321_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000277856.1|164384_165614_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000621507.1|165617_165998_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_000339891.1|166271_167204_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.4	6.5e-60
>prophage 2
NZ_CP025716	Escherichia coli strain BH100L substr. MG2017 chromosome, complete genome	5033214	200294	340931	5033214	plate,transposase,protease,tRNA	Bacillus_phage(16.0%)	117	NA	NA
WP_000753942.1|200294_201719_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
WP_000929439.1|201873_203031_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272188.1|203084_203471_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186656.1|203780_204605_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094534.1|204635_207308_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|207369_208164_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246882.1|208531_209257_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|209391_210243_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|210389_211115_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|211264_211822_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811912.1|211913_213110_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|213298_214057_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922441.1|214069_214927_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001298422.1|214938_216291_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|216320_218753_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|218874_219360_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|219363_220389_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|220493_220949_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|220952_221741_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139678.1|221740_222889_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569423.1|222885_223482_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294798.1|223518_227001_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000055741.1|227013_227973_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020992.1|228070_230212_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901082.1|230268_230658_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176517.1|230722_232036_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_099989771.1|232077_233426_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000360465.1|233518_234343_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260694.1|234395_236114_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094007.1|236224_236932_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202331.1|236928_237333_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|237450_238266_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294595.1|238305_238959_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593991.1|238951_239983_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140167.1|240170_240743_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997016.1|246412_247216_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
WP_000648563.1|247212_248127_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|248367_249168_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211721.1|249245_250016_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644691.1|250064_251423_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052743.1|251494_252250_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298196.1|252283_253006_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917867.1|253002_253470_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	8.0e-51
WP_001298181.1|253534_254266_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	5.8e-40
WP_001049698.1|254803_255589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000013180.1|255928_256408_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000069182.1|256425_257784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023151815.1|257794_261262_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001298176.1|261341_262784_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088598.1|262788_263532_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614309.1|263528_266291_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.1	3.6e-82
WP_001282177.1|266300_267065_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000224521.1|267069_268416_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013428.1|268418_268943_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433567.1|268939_270232_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896716.1|270236_271286_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863399.1|271249_273091_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001189667.1|273096_273522_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|273526_275011_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|275033_275537_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|276242_276761_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_021573161.1|276981_278964_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	2.5e-24
WP_000571853.1|279070_280117_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528851.1|280109_281549_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|281523_281814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227712.1|283064_283568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|283661_284150_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|284420_285191_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|285344_285818_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973131.1|285860_288305_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|288544_289123_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_099156434.1|289185_290534_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001298188.1|290625_292365_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207578.1|292309_293095_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|293165_294221_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|294272_294566_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|294568_294967_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|294976_295429_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001335538.1|295606_296758_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.8e-31
WP_000602124.1|296754_297369_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|297425_298883_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291991.1|299143_299602_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189578.1|299693_300938_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|300995_301397_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749900.1|301435_302491_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
WP_001285288.1|302779_303883_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893298.1|303894_305148_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_001335540.1|305648_306245_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.4	1.7e-98
WP_000258743.1|306331_307969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266639.1|308660_308888_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000120393.1|308993_309221_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335706.1|309469_310903_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282079.1|311872_312436_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_089644009.1|312643_314175_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	2.8e-44
WP_001298025.1|315120_316143_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
WP_001297096.1|316142_316922_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000273845.1|316972_318724_-	NTPase	NA	NA	NA	NA	NA
WP_071587598.1|319721_319964_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_001335133.1|320244_321279_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	43.4	1.4e-71
WP_065377602.1|322155_323010_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.9	2.9e-51
WP_000165816.1|323006_323306_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024186735.1|324781_325060_+	microcin McmA	NA	NA	NA	NA	NA
WP_000406621.1|325236_325923_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001540934.1|326017_326476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337392.1|327687_328257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152851977.1|328531_328816_-	S/F1C fimbrial major subunit operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000046975.1|329171_329501_+	S/F1C fimbrial major subunit operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000768216.1|329874_330420_+	S-fimbrial adhesin major pilin SfaA-I	NA	NA	NA	NA	NA
WP_077613614.1|330505_331030_+	S/F1C fimbrial minor subunit SfaD	NA	NA	NA	NA	NA
WP_000975446.1|331070_331766_+	S/F1C fimbrial biogenesis chaperone SfaE/FocC	NA	NA	NA	NA	NA
WP_000490940.1|331836_334467_+	S/F1C fimbrial biogenesis usher protein SfaF/FocD	NA	NA	NA	NA	NA
WP_000237768.1|334479_335007_+	S/F1C fimbrial adhesin minor pilin SfaG/FocF	NA	NA	NA	NA	NA
WP_000767892.1|335028_335520_+	S-fimbrial adhesin minor subunit SfaS	NA	NA	NA	NA	NA
WP_011579069.1|335581_336481_+	S-fimbrial adhesin minor pilin SfaH	NA	NA	NA	NA	NA
WP_000012018.1|336784_337525_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011579070.1|337671_338223_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099989771.1|339583_340931_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 3
NZ_CP025716	Escherichia coli strain BH100L substr. MG2017 chromosome, complete genome	5033214	875869	933956	5033214	integrase,protease,transposase	Bacillus_phage(14.29%)	56	896745:896760	922027:922042
WP_099156434.1|875869_877217_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001218658.1|877652_879803_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_000386550.1|879830_880793_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000253501.1|880933_882019_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|882246_882507_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146336.1|882771_883038_-	C4-type zinc finger protein YbiI	NA	K4F9U1	Cronobacter_phage	50.0	2.1e-16
WP_000990157.1|883111_883789_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.3	5.2e-19
WP_000430009.1|884004_886287_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710618.1|886551_886812_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001275941.1|887087_888014_+	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_001267234.1|888010_890236_-	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_000569080.1|890352_891075_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|891071_891731_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|891869_892616_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|893019_893523_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|893822_894710_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|894944_895010_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|895062_895578_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_102804196.1|895627_897196_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
896745:896760	attL	GCAACAAAAAATGTCG	NA	NA	NA	NA
WP_099156434.1|897211_898559_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000464491.1|898625_899294_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001692.1|899293_900010_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|900016_900748_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|900765_901494_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001298306.1|901711_902227_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|902352_902676_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255186.1|902672_903503_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001305933.1|903499_904513_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136521.1|904611_906042_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566395.1|906052_907054_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815370.1|907090_908809_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000178694.1|908941_909910_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458842.1|909921_911574_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|911717_912617_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|912936_913632_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599809.1|914057_915716_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|915712_916669_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746478.1|916819_917935_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188148.1|917931_919878_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|919950_920175_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000085201.1|920579_921818_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	2.0e-125
WP_001206970.1|922227_922437_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
922027:922042	attR	CGACATTTTTTGTTGC	NA	NA	NA	NA
WP_000103622.1|922575_922755_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
WP_021527564.1|922888_923086_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609226.1|923078_923390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543626.1|923382_923610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791981.1|923615_923903_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761778.1|923899_925654_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.8	2.2e-93
WP_000557485.1|925942_926200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126651.1|926196_926619_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001298307.1|926982_927156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082952.1|927248_929162_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	57.1	1.0e-213
WP_000373413.1|929418_929904_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	67.5	5.9e-49
WP_000140261.1|929906_930188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|931328_931649_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934027.1|931679_933956_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.5e-166
>prophage 4
NZ_CP025716	Escherichia coli strain BH100L substr. MG2017 chromosome, complete genome	5033214	2666324	2742479	5033214	terminase,integrase,tRNA,capsid,tail,transposase,holin	Salmonella_phage(46.15%)	78	NA	NA
WP_000940006.1|2666324_2667065_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553454.1|2667183_2667987_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_001298397.1|2668131_2668986_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000983031.1|2669176_2670457_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244186.1|2670448_2671588_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_001298395.1|2671956_2672379_+	DoxX family protein	NA	NA	NA	NA	NA
WP_099156434.1|2672453_2673801_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000158511.1|2673974_2674847_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_000700787.1|2674858_2675953_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_001276657.1|2675985_2676984_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000493464.1|2677008_2678520_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
WP_001124927.1|2678542_2679526_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001298394.1|2679622_2682904_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_001298408.1|2683021_2684215_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919159.1|2684278_2685532_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_023151811.1|2685860_2687051_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2687095_2687434_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298400.1|2687494_2688829_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215878.1|2688818_2689532_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|2689696_2691124_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001298398.1|2691699_2695587_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	2.2e-130
WP_000734193.1|2695844_2697401_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001298403.1|2697397_2697934_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190644.1|2697958_2698594_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001298401.1|2698802_2699651_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001288820.1|2700288_2700936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000904982.1|2701016_2701571_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	3.7e-87
WP_001115569.1|2701600_2702095_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	92.8	1.1e-79
WP_000805550.1|2702094_2702688_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.9	4.5e-59
WP_001106827.1|2702659_2703100_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_001096981.1|2703126_2703816_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	70.0	3.7e-28
WP_000049952.1|2703815_2704496_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	3.4e-103
WP_001197080.1|2704492_2705692_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	1.7e-185
WP_001270631.1|2705691_2706045_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
WP_000301073.1|2706044_2706797_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	2.5e-86
WP_000718774.1|2707238_2708012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824896.1|2708107_2708440_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.5	1.1e-22
WP_000081732.1|2708439_2709504_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	3.2e-156
WP_000155120.1|2709506_2709809_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	6.3e-49
WP_001298404.1|2709808_2710396_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_000990889.1|2710395_2712381_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
WP_000393960.1|2712558_2713011_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
WP_000109249.1|2713014_2713455_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000046934.1|2713465_2714611_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	5.2e-160
WP_001298391.1|2714614_2715178_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_001142475.1|2715152_2715542_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
WP_000008727.1|2715528_2716083_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	1.7e-79
WP_001125664.1|2716079_2716487_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	4.3e-69
WP_000627477.1|2716715_2717657_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.3	3.2e-155
WP_001066729.1|2717668_2718175_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
WP_000873175.1|2718178_2719399_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	3.2e-200
WP_000184961.1|2719413_2720148_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	85.6	1.8e-97
WP_000113489.1|2720038_2721505_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
WP_001130788.1|2721504_2723127_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_000162795.1|2723129_2723702_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
WP_000779565.1|2723763_2724288_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_001194119.1|2724271_2724748_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000781776.1|2724751_2725093_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001174015.1|2725538_2725880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|2725911_2726334_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001337135.1|2726615_2728808_-	replication protein	NA	B6SCY1	Bacteriophage	71.3	1.2e-173
WP_000170998.1|2728811_2729024_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_000049986.1|2729144_2729768_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000051353.1|2730547_2731450_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001113502.1|2731452_2732754_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	7.2e-134
WP_000769011.1|2732769_2733318_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_001298623.1|2733369_2734008_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	68.8	3.9e-72
WP_000490741.1|2734075_2734345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065468.1|2734401_2736465_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	8.7e-275
WP_000216034.1|2736470_2736674_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	55.4	3.2e-12
WP_000008824.1|2736679_2736901_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000128190.1|2736890_2737373_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.6	3.6e-70
WP_000312950.1|2737372_2737666_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	5.0e-27
WP_085961393.1|2737635_2738667_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	53.0	1.1e-100
WP_000212683.1|2738663_2738984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127138.1|2739018_2740413_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.7	7.3e-217
WP_001138328.1|2740606_2742004_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000054755.1|2742218_2742479_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 5
NZ_CP025716	Escherichia coli strain BH100L substr. MG2017 chromosome, complete genome	5033214	3714543	3780368	5033214	integrase,transposase,tRNA	Bacillus_phage(30.77%)	55	3735635:3735664	3755261:3755290
WP_000165543.1|3714543_3715548_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001031711.1|3715540_3716299_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_000816280.1|3716291_3716969_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000742141.1|3716986_3717823_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
WP_000343172.1|3717929_3719216_-	cell division protein DamX	NA	NA	NA	NA	NA
WP_000439850.1|3719307_3720396_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_000818618.1|3720452_3720974_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_000816005.1|3721374_3722613_-	DNA uptake porin HofQ	NA	NA	NA	NA	NA
WP_001264138.1|3722524_3722929_-	DNA utilization protein HofP	NA	NA	NA	NA	NA
WP_001055747.1|3722918_3723359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069330.1|3723342_3723882_-	DNA utilization protein HofN	NA	NA	NA	NA	NA
WP_001296474.1|3723881_3724661_-	DNA utilization protein HofM	NA	NA	NA	NA	NA
WP_001298208.1|3724780_3727333_+	peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA	NA	NA	NA	NA	NA
WP_000045736.1|3727499_3728060_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_000104564.1|3728379_3730515_+	intracellular growth attenuator protein IgaA	NA	NA	NA	NA	NA
WP_001295168.1|3730579_3731248_+	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
WP_000660483.1|3731258_3731660_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_001135574.1|3731684_3732563_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
3735635:3735664	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001138064.1|3735659_3738626_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|3738628_3739189_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|3739314_3739665_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|3739867_3740881_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001206316.1|3741029_3741821_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|3741984_3742332_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3742325_3743165_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|3743292_3743793_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|3743968_3744751_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|3744740_3746264_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|3747981_3748842_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|3748844_3750560_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|3750598_3751267_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|3751302_3751539_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|3751535_3751898_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|3751915_3753610_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|3753661_3754084_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|3754119_3754395_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|3754408_3754759_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|3754830_3755265_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001253707.1|3756097_3757450_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
3755261:3755290	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
WP_001157751.1|3757446_3758166_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001304926.1|3758357_3758870_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_000980733.1|3758966_3761288_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_001200455.1|3761725_3761953_+	ferrous iron transporter A	NA	NA	NA	NA	NA
WP_000737046.1|3761969_3764291_+	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_000157585.1|3764301_3764538_+	[Fe-S]-dependent transcriptional repressor FeoC	NA	NA	NA	NA	NA
WP_000039098.1|3764740_3765634_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	2.5e-69
WP_001060083.1|3765853_3766624_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_001298214.1|3766661_3767345_+	DNA utilization protein GntX	NA	NA	NA	NA	NA
WP_000619389.1|3767403_3767979_+	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_001131758.1|3768342_3769659_+	gluconate transporter	NA	NA	NA	NA	NA
WP_099156434.1|3769719_3771068_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000444365.1|3771148_3773233_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_000081889.1|3773242_3775636_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
WP_000906981.1|3776258_3778964_+	HTH-type transcriptional regulator MalT	NA	NA	NA	NA	NA
WP_099156434.1|3779019_3780368_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 6
NZ_CP025716	Escherichia coli strain BH100L substr. MG2017 chromosome, complete genome	5033214	4067228	4078790	5033214	integrase	Enterobacteria_phage(88.89%)	13	4067046:4067068	4077680:4077702
4067046:4067068	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218974.1|4067228_4068416_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	91.2	1.5e-207
WP_000281857.1|4068462_4068990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001335488.1|4068996_4070082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446153.1|4070378_4070951_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000638629.1|4071024_4071525_-	transactivation protein	NA	NA	NA	NA	NA
WP_001279711.1|4071521_4072256_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	96.3	1.1e-126
WP_001149160.1|4072808_4073075_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980256.1|4073071_4073662_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	89.6	2.0e-59
WP_001244665.1|4073654_4073942_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459296.1|4073934_4074390_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4074525_4074846_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783690.1|4074860_4077194_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_001280586.1|4077752_4078790_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
4077680:4077702	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 7
NZ_CP025716	Escherichia coli strain BH100L substr. MG2017 chromosome, complete genome	5033214	4806871	4879904	5033214	transposase,holin	Escherichia_phage(26.67%)	50	NA	NA
WP_000088532.1|4806871_4808485_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.5	8.6e-177
WP_000624649.1|4808515_4808866_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	2.0e-38
WP_042033708.1|4808862_4809303_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	79.8	5.8e-35
WP_000165816.1|4810185_4810485_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000528123.1|4811404_4814449_-	cytotoxic necrotizing factor CNF1	NA	NA	NA	NA	NA
WP_000509949.1|4814726_4814954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860473.1|4815394_4816831_-	alpha-hemolysin T1SS ABC transporter subunit HlyD	NA	NA	NA	NA	NA
WP_000376543.1|4816849_4818973_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.7	6.4e-47
WP_001142370.1|4819043_4822118_-	RTX toxin hemolysin HlyA	NA	NA	NA	NA	NA
WP_001535080.1|4822129_4822642_-	alpha-hemolysin-activating lysine-acyltransferase HlyC	NA	NA	NA	NA	NA
WP_000789515.1|4823825_4824068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000730195.1|4824095_4824866_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001182766.1|4824865_4825465_-	DUF4405 domain-containing protein	NA	NA	NA	NA	NA
WP_001066997.1|4825605_4826325_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	3.3e-35
WP_000995843.1|4826325_4827798_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	1.9e-21
WP_001063091.1|4832479_4835440_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	24.3	3.9e-34
WP_000635307.1|4835444_4836491_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	43.0	2.0e-65
WP_000631802.1|4838793_4839180_-	toxin-immunity protein system imunity protein CdiI	NA	NA	NA	NA	NA
WP_000554174.1|4839176_4848905_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	33.5	2.8e-28
WP_001164770.1|4848917_4850684_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	2.0e-22
WP_000124167.1|4851047_4851281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260397.1|4851378_4852002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534800.1|4852269_4852818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534801.1|4853084_4853318_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991585.1|4853386_4853947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001126811.1|4854193_4854760_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000426441.1|4855870_4857199_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000556033.1|4857216_4858554_-	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_001298079.1|4858771_4859716_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_000481835.1|4860368_4860698_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000095890.1|4860713_4861115_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000139438.1|4861147_4861813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564322.1|4861824_4862445_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_001086628.1|4862441_4862906_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001275637.1|4862917_4863865_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_000035052.1|4863916_4867303_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_001288714.1|4867329_4868484_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000599365.1|4868499_4868757_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_000570989.1|4868783_4870370_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_001206281.1|4870423_4870702_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502010.1|4870716_4871001_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502008.1|4871018_4871297_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001217008.1|4871816_4872335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270145.1|4872334_4873153_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000926369.1|4873175_4873754_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.1	3.4e-11
WP_085961387.1|4874044_4875258_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	95.3	4.2e-160
WP_001534804.1|4875731_4876910_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_001063844.1|4876902_4878093_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_001297096.1|4878102_4878882_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_001298025.1|4878881_4879904_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
>prophage 8
NZ_CP025716	Escherichia coli strain BH100L substr. MG2017 chromosome, complete genome	5033214	4939832	5006412	5033214	terminase,integrase,portal,tail,lysis,protease,transposase,holin	Enterobacteria_phage(45.83%)	71	4927855:4927889	5015263:5015297
4927855:4927889	attL	GTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_099989771.1|4939832_4941180_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001298085.1|4941267_4943418_-	pyruvate/proton symporter BtsT	NA	NA	NA	NA	NA
WP_000919563.1|4943794_4945459_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000118642.1|4945501_4946773_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001235678.1|4946769_4947243_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000034589.1|4947306_4948278_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_001298060.1|4948968_4950621_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_000091596.1|4950791_4951697_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106005.1|4951835_4952858_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001292636.1|4952997_4955289_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_001385190.1|4955542_4956037_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_000799911.1|4956085_4956823_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001298056.1|4956825_4957365_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
WP_000538188.1|4957472_4957946_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_001340933.1|4957936_4958707_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_000936639.1|4959326_4960052_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001298690.1|4960009_4960687_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_000331596.1|4960724_4961513_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001350368.1|4961653_4961890_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_001272356.1|4962450_4963482_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204030.1|4963584_4963998_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092461.1|4963966_4964413_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870712.1|4964427_4965105_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_001218287.1|4965490_4966705_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653746.1|4967080_4968076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206728.1|4968643_4969264_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.6	1.2e-118
WP_001242728.1|4969263_4969626_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
WP_000008232.1|4969616_4970153_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081256.1|4970280_4971105_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000135680.1|4971170_4971533_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000500990.1|4972001_4972514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298691.1|4972829_4973522_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	7.3e-125
WP_001191672.1|4973619_4973880_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	9.3e-41
WP_000515840.1|4973872_4974424_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
WP_001087311.1|4974420_4975257_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	92.4	1.1e-138
WP_024179079.1|4975261_4975486_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
WP_000061519.1|4975482_4976301_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_001315196.1|4976297_4976792_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_000066917.1|4976791_4977445_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210180.1|4977441_4977768_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
WP_000767113.1|4977764_4978154_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061422.1|4978173_4979016_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
WP_001540821.1|4979023_4980013_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001205460.1|4980030_4980372_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|4980384_4980933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|4980919_4981846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917727.1|4982110_4982314_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
WP_000799673.1|4982464_4983517_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
WP_001120490.1|4983593_4983920_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_001197768.1|4983923_4984400_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
WP_001298489.1|4984396_4984840_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	93.9	1.5e-70
WP_000084843.1|4984878_4985253_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	87.9	2.5e-55
WP_000373423.1|4985891_4986386_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000934116.1|4986385_4988488_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|4988484_4988697_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072134767.1|4988624_4990205_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001136583.1|4990149_4992177_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|4992263_4992587_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4992579_4992855_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677099.1|4992866_4993445_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	2.1e-101
WP_001298485.1|4993441_4993843_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	1.6e-71
WP_000211128.1|4993853_4994597_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298500.1|4994657_4995044_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|4995052_4995382_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372054.1|4995353_4998419_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
WP_000447254.1|4998418_4998748_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
WP_001152410.1|4998757_4999456_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.9e-133
WP_000194752.1|4999461_5000205_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.2e-151
WP_032143682.1|5000102_5000750_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	3.0e-112
WP_021518114.1|5000810_5004293_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_021518115.1|5004351_5006412_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
5015263:5015297	attR	GTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
