The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025597	Mycobacterium tuberculosis strain GG-36-11 chromosome, complete genome	4411469	889044	947617	4411469	tRNA,protease,transposase,bacteriocin	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889044_890305_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890360_891455_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_102804241.1|891444_892242_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892238_893246_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893290_894592_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894603_894951_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894944_895601_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|895792_898057_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|898053_898683_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898803_899760_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899704_901303_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901607_901997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902083_903667_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903697_904792_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904877_905060_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905206_906313_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906395_907265_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907310_907991_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908153_908456_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908457_909291_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909583_910006_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|910002_910815_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910944_911712_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911708_912656_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912698_913475_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913530_914172_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914229_916284_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916449_917619_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917706_918723_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918884_919526_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919606_920662_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920713_921106_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921163_921586_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921547_921838_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921942_922848_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922866_923682_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_010886090.1|927809_930458_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930925_931570_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931550_932102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932251_932905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932975_934004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934692_935463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935549_936362_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936429_937290_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937565_937808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102804281.1|938084_939377_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939360_940365_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940428_941079_-	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_003898611.1|941162_942440_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_102804242.1|942652_944167_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944315_944708_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_009935595.1|944910_946029_+	S-sulfocysteine synthase CysK2	NA	NA	NA	NA	NA
WP_003404402.1|946028_947288_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947284_947617_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP025597	Mycobacterium tuberculosis strain GG-36-11 chromosome, complete genome	4411469	2941158	2976524	4411469	capsid,terminase,head,tRNA,integrase,protease,transposase	Tupanvirus(11.11%)	40	2969959:2969986	2980941:2980968
WP_003413486.1|2941158_2943237_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943345_2943573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943569_2944955_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945299_2945800_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945816_2946257_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946403_2947081_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947065_2947419_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947431_2947857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947853_2948528_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948605_2949427_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949562_2950456_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950458_2951277_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951291_2952473_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952531_2952963_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953476_2954718_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_030030838.1|2955027_2955390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955736_2956861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956862_2957402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957541_2958840_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958878_2959160_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959304_2959790_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959816_2960074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960074_2962411_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962439_2962682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962682_2963360_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963555_2964212_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964374_2964821_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964995_2965328_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965447_2965807_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965908_2966367_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966502_2966883_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966879_2968376_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2968610_2968802_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2969959:2969986	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970092_2970524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970520_2971519_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971532_2971997_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972129_2973390_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973764_2975204_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975211_2975745_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975897_2976524_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980941:2980968	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 3
NZ_CP025597	Mycobacterium tuberculosis strain GG-36-11 chromosome, complete genome	4411469	3710389	3796327	4411469	tRNA,transposase	Burkholderia_virus(28.57%)	57	NA	NA
WP_102765681.1|3710389_3711650_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3711705_3711867_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3711888_3713418_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3713350_3714289_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003917150.1|3714297_3715665_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.0	3.1e-18
WP_003417415.1|3715733_3716951_+	D-alanyl-D-alanine carboxypeptidase DacB1	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3717046_3718555_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3718551_3719703_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3719893_3720739_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003900026.1|3721213_3721654_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3721687_3722557_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3722577_3723588_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_009940431.1|3723872_3724505_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3724571_3725801_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3726083_3727433_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3727444_3728584_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3728580_3729312_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023637497.1|3729320_3736892_-	PPE family protein	NA	NA	NA	NA	NA
WP_003417619.1|3743154_3743412_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_009938649.1|3743667_3753141_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3753766_3754213_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003900675.1|3754249_3754990_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009938650.1|3755284_3755572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031703197.1|3755908_3767059_-	PPE family protein	NA	NA	NA	NA	NA
WP_003417738.1|3767302_3768097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417739.1|3768178_3768550_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
WP_157132559.1|3768447_3768666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906084.1|3768692_3768956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417745.1|3769067_3769457_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417749.1|3769470_3769764_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417751.1|3769760_3770606_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417757.1|3770729_3771005_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003417760.1|3771001_3771259_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003900033.1|3771300_3772491_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417765.1|3772607_3772976_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003417767.1|3772972_3773524_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417769.1|3773530_3774112_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417772.1|3774092_3774461_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|3774438_3774831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030031607.1|3774827_3777458_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003417878.1|3777693_3778158_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_009938654.1|3778524_3780300_+	PE family protein	NA	NA	NA	NA	NA
WP_003417881.1|3780300_3780945_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003417882.1|3780943_3781378_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003908228.1|3781466_3784706_-	error-prone DNA polymerase DnaE2	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
WP_003900036.1|3784897_3786238_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003417892.1|3786279_3787455_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003417895.1|3787508_3787613_+	PE family protein	NA	NA	NA	NA	NA
WP_003900037.1|3787691_3788333_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003417897.1|3788333_3788582_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003417900.1|3788586_3790014_+	amidase	NA	NA	NA	NA	NA
WP_003417903.1|3790121_3790775_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417905.1|3790813_3792319_-	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417908.1|3792323_3793214_-	diterpene synthase	NA	NA	NA	NA	NA
WP_003417910.1|3793222_3794833_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_075155233.1|3794777_3795023_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_087902221.1|3795065_3796327_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
