The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025607	Mycobacterium tuberculosis strain GG-186-10 chromosome, complete genome	4411478	889031	947595	4411478	transposase,bacteriocin,tRNA,protease	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889031_890292_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890347_891442_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891431_892229_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892225_893233_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893277_894579_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894590_894938_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894931_895588_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895779_898044_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898040_898670_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898790_899747_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899691_901290_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901594_901984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902070_903654_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903684_904779_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904864_905047_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905193_906300_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906382_907252_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907297_907978_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908140_908443_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908444_909278_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909570_909993_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909989_910802_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910931_911699_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911695_912643_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912685_913462_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913517_914159_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914216_916271_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916436_917606_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917693_918710_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918871_919513_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919593_920649_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920700_921093_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921150_921573_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921534_921825_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921929_922835_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922853_923669_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927796_930436_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930903_931548_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931528_932080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932229_932883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932953_933982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934670_935441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935527_936340_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936407_937268_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937543_937786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938062_939355_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939338_940343_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940406_941057_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941140_942418_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942630_944145_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944293_944686_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944888_946007_+	S-sulfocysteine synthase CysK2	NA	NA	NA	NA	NA
WP_003404402.1|946006_947266_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947262_947595_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP025607	Mycobacterium tuberculosis strain GG-186-10 chromosome, complete genome	4411478	2941180	2976545	4411478	transposase,integrase,tRNA,terminase,capsid,protease,head	Tupanvirus(11.11%)	40	2969980:2970007	2980962:2980989
WP_003413486.1|2941180_2943259_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943367_2943595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031706657.1|2943591_2944977_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945321_2945822_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945838_2946279_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946425_2947103_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947087_2947441_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947453_2947879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947875_2948550_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948627_2949449_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949584_2950478_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950480_2951299_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951313_2952495_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952553_2952985_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953498_2954740_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2955049_2955412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955758_2956883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956884_2957424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957563_2958862_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958900_2959182_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959326_2959812_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959838_2960096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899405.1|2962460_2962703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962703_2963381_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963576_2964233_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964395_2964842_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2965016_2965349_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965468_2965828_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965929_2966388_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966523_2966904_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966900_2968397_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968586_2968823_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968895_2969069_+	hypothetical protein	NA	NA	NA	NA	NA
2969980:2970007	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970113_2970545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970541_2971540_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971553_2972018_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972150_2973411_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973785_2975225_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975232_2975766_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975918_2976545_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980962:2980989	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
