The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025600	Mycobacterium tuberculosis strain GG-77-11 chromosome, complete genome	4411508	2941168	2976399	4411508	tRNA,integrase,protease,capsid,head,transposase,terminase	Tupanvirus(12.5%)	39	2969969:2969996	2980951:2980978
WP_003413486.1|2941168_2943247_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943355_2943583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943579_2944965_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945309_2945810_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945826_2946267_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003902320.1|2946362_2947091_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947075_2947429_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947441_2947867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947863_2948538_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948615_2949437_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_103656214.1|2949572_2950466_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2950468_2951287_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951301_2952483_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952541_2952973_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953486_2954728_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2955142_2955400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955746_2956871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956872_2957412_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2958888_2959170_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959314_2959800_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2959826_2960081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960084_2962421_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962449_2962692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962692_2963370_+	membrane protein	NA	NA	NA	NA	NA
WP_012054325.1|2963565_2964222_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964384_2964831_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2965005_2965338_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965457_2965817_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965918_2966377_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966512_2966893_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966889_2968386_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2968620_2968812_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2969969:2969996	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970102_2970534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970530_2971529_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971542_2972007_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972139_2973400_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973774_2975214_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975221_2975755_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2975907_2976399_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
2980951:2980978	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
