The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025594	Mycobacterium tuberculosis strain GG-5-10 chromosome, complete genome	4411442	889035	947608	4411442	bacteriocin,transposase,protease,tRNA	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889035_890296_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890351_891446_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891435_892233_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892229_893237_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893281_894583_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894594_894942_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894935_895592_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|895783_898048_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|898044_898674_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898794_899751_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899695_901294_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901598_901988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|902074_903658_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903688_904783_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904868_905051_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905197_906304_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906386_907256_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907301_907982_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908144_908447_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908448_909282_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|909574_909997_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909993_910806_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910935_911703_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911699_912647_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912689_913466_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913521_914163_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914220_916275_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916440_917610_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917697_918714_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918875_919517_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919597_920653_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920704_921097_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921154_921577_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921538_921829_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921933_922839_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922857_923673_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_010886090.1|927800_930449_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930916_931561_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931541_932093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932242_932896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932966_933995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934683_935454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935540_936353_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936420_937281_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937556_937799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938075_939368_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939351_940356_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940419_941070_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941153_942431_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942643_944158_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944306_944699_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_009935595.1|944901_946020_+	S-sulfocysteine synthase CysK2	NA	NA	NA	NA	NA
WP_003404402.1|946019_947279_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947275_947608_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP025594	Mycobacterium tuberculosis strain GG-5-10 chromosome, complete genome	4411442	2941139	2976505	4411442	protease,head,tRNA,transposase,capsid,integrase,terminase	Tupanvirus(11.11%)	41	2969940:2969967	2980922:2980949
WP_003413486.1|2941139_2943218_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943326_2943554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943550_2944936_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945280_2945781_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945797_2946238_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946384_2947062_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947046_2947400_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947412_2947838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947834_2948509_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948586_2949408_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949543_2950437_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950439_2951258_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951272_2952454_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952512_2952944_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953457_2954699_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_030030838.1|2955008_2955371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955717_2956842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956843_2957383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2957522_2958821_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958859_2959141_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959285_2959771_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959797_2960055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960055_2962392_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962420_2962663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102765667.1|2962663_2963341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413654.1|2963536_2964193_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964355_2964802_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964976_2965309_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965428_2965788_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965889_2966348_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966483_2966864_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966860_2968357_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968546_2968783_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968855_2969029_+	hypothetical protein	NA	NA	NA	NA	NA
2969940:2969967	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970073_2970505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970501_2971500_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971513_2971978_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972110_2973371_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973745_2975185_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975192_2975726_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975878_2976505_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980922:2980949	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
