The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025593	Mycobacterium tuberculosis strain GG-111-10 chromosome, complete genome	4411563	889029	947593	4411563	protease,tRNA,transposase,bacteriocin	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|889029_890290_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|890345_891440_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|891429_892227_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|892223_893231_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003404103.1|893275_894577_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|894588_894936_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|894929_895586_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010924301.1|895777_898042_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.2	1.8e-273
WP_003404117.1|898038_898668_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|898788_899745_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|899689_901288_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|901592_901982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900214.1|902068_903652_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|903682_904777_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|904862_905045_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|905191_906298_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003404139.1|906380_907250_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|907295_907976_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|908138_908441_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|908442_909276_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003900215.1|909568_909991_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|909987_910800_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|910929_911697_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|911693_912641_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|912683_913460_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|913515_914157_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|914214_916269_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|916434_917604_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|917691_918708_-	acyl-ACP desaturase DesA1	NA	NA	NA	NA	NA
WP_003404326.1|918869_919511_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|919591_920647_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|920698_921091_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|921148_921571_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003900218.1|921532_921823_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|921927_922833_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|922851_923667_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_015345040.1|927794_930434_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|930901_931546_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|931526_932078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|932227_932881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|932951_933980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|934668_935439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|935525_936338_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|936405_937266_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|937541_937784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|938060_939353_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|939336_940341_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|940404_941055_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|941138_942416_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|942628_944143_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|944291_944684_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_003404395.1|944886_946005_+	S-sulfocysteine synthase CysK2	NA	NA	NA	NA	NA
WP_003404402.1|946004_947264_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|947260_947593_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP025593	Mycobacterium tuberculosis strain GG-111-10 chromosome, complete genome	4411563	2941191	2976557	4411563	head,capsid,transposase,protease,integrase,tRNA,terminase	Tupanvirus(11.11%)	41	2969992:2970019	2980974:2981001
WP_003413486.1|2941191_2943270_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2943378_2943606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2943602_2944988_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2945332_2945833_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945849_2946290_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2946436_2947114_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2947098_2947452_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2947464_2947890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900535.1|2947886_2948561_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948638_2949460_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2949595_2950489_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2950491_2951310_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2951324_2952506_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2952564_2952996_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2953509_2954751_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2955060_2955423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955769_2956894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956895_2957435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010924557.1|2957574_2958873_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2958911_2959193_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2959337_2959823_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2959849_2960107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2960107_2962444_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2962472_2962715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962715_2963393_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2963588_2964245_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2964407_2964854_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2965028_2965361_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2965480_2965840_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965941_2966400_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2966535_2966916_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966912_2968409_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2968598_2968835_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2968907_2969081_+	hypothetical protein	NA	NA	NA	NA	NA
2969992:2970019	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2970125_2970557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2970553_2971552_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2971565_2972030_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2972162_2973423_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899411.1|2973797_2975237_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2975244_2975778_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2975930_2976557_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2980974:2981001	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
