The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	1009434	1019415	4918774		Escherichia_phage(83.33%)	8	NA	NA
WP_102597128.1|1009434_1010010_-	aldolase	NA	A0A077SK32	Escherichia_phage	76.5	6.1e-77
WP_158649437.1|1010792_1011242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158649438.1|1011284_1012073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000590403.1|1012910_1014173_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847979.1|1014169_1015078_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	3.0e-118
WP_001300386.1|1015273_1016041_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1016091_1016748_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272928.1|1016853_1019415_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	1487622	1502663	4918774	tail,integrase,transposase,lysis	Enterobacteria_phage(65.22%)	24	1479123:1479137	1510091:1510105
1479123:1479137	attL	CTGGAAGATGGCCTG	NA	NA	NA	NA
WP_016246961.1|1487622_1488693_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
WP_001303849.1|1488670_1488889_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545733.1|1488928_1489096_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_032082902.1|1489184_1489466_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	98.9	8.2e-51
WP_032180382.1|1489657_1490206_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	98.9	5.4e-99
WP_000763367.1|1490202_1490424_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001386642.1|1490522_1490804_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|1490814_1491006_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_098027589.1|1490978_1491161_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.1	5.7e-21
WP_001254223.1|1491477_1491654_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386643.1|1491656_1491998_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950954.1|1491990_1492185_+	protein ninF	NA	NA	NA	NA	NA
WP_057103202.1|1492204_1492567_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	3.3e-60
WP_000971068.1|1492563_1492704_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|1492789_1493173_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000019448.1|1493963_1494944_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000839596.1|1496232_1496448_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|1496447_1496945_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_077628513.1|1497161_1497344_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	2.5e-16
WP_000738423.1|1497434_1497728_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_032083248.1|1498090_1498285_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	2.2e-26
WP_102597142.1|1498673_1499222_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.7	2.1e-87
WP_098027592.1|1500395_1500791_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_085949152.1|1501390_1502663_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
1510091:1510105	attR	CTGGAAGATGGCCTG	NA	NA	NA	NA
>prophage 3
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	1584547	1653726	4918774	plate,lysis,terminase,portal,tail,protease,integrase,capsid,head	Salmonella_phage(64.71%)	80	1578190:1578204	1594770:1594784
1578190:1578204	attL	TGAAAAACCTGAAAG	NA	NA	NA	NA
WP_000290937.1|1584547_1585600_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|1585788_1585980_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_024220196.1|1585995_1586565_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	4.2e-38
WP_000188450.1|1586710_1586914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1586978_1587488_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956192.1|1587495_1587792_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|1587909_1588251_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244209.1|1588318_1588552_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	2.4e-32
WP_000752613.1|1588551_1588779_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_029364117.1|1588775_1589633_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	1.2e-161
WP_073464781.1|1589629_1592044_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_001154434.1|1592197_1592386_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217562.1|1592396_1592630_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_073464779.1|1592958_1594851_+	NTPase KAP	NA	NA	NA	NA	NA
1594770:1594784	attR	CTTTCAGGTTTTTCA	NA	NA	NA	NA
WP_000885505.1|1595375_1596047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077897245.1|1596098_1597148_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	4.1e-172
WP_073464775.1|1597147_1598914_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_102597144.1|1599056_1599890_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	1.2e-121
WP_000742498.1|1599906_1600965_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059203.1|1600968_1601619_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	1.6e-110
WP_000673520.1|1601714_1602179_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000868175.1|1602178_1602382_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1602385_1602601_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069910.1|1602581_1603097_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	2.1e-89
WP_000196196.1|1603093_1603522_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	89.4	1.8e-57
WP_001039945.1|1603617_1604049_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_000829123.1|1604041_1604494_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.5	9.4e-57
WP_006656620.1|1604499_1604862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993777.1|1605125_1605704_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_000177580.1|1605700_1606060_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000268285.1|1606046_1606955_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_001086836.1|1606947_1607553_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_102597145.1|1607549_1608959_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.7	2.0e-153
WP_069907513.1|1608915_1609383_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	98.7	1.0e-82
WP_042630958.1|1609354_1609957_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	7.8e-99
WP_102597146.1|1609956_1610508_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	69.6	1.1e-56
WP_102597147.1|1610535_1611102_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_000046120.1|1611244_1612417_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|1612426_1612942_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1612996_1613299_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_102597148.1|1613313_1613433_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	4.8e-13
WP_102597149.1|1613425_1616503_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000980400.1|1616499_1616985_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_001011793.1|1616981_1618082_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	7.6e-177
WP_000972391.1|1618172_1618391_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|1618626_1620312_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1620581_1620959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|1620988_1621246_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|1621405_1621693_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|1621676_1622399_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1622459_1623362_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1623449_1623926_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|1624276_1625389_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|1625483_1626617_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_102597150.1|1626626_1627580_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1627576_1628422_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1628481_1628970_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149682.1|1629010_1630138_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
WP_001295339.1|1630336_1631068_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|1631358_1632027_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1632026_1632743_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1632749_1633481_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|1633498_1634227_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|1634444_1634960_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1635085_1635409_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|1635405_1636236_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|1636232_1637246_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|1637344_1638775_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566376.1|1638785_1639787_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815337.1|1639823_1641542_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_102597151.1|1641674_1642643_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_045173909.1|1642654_1644307_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1644450_1645350_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1645844_1646540_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599802.1|1646965_1648624_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001380339.1|1648620_1649577_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746443.1|1649727_1650843_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188144.1|1650839_1652786_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1652858_1653083_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1653405_1653726_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 4
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	1879992	1957253	4918774	plate,holin,lysis,tRNA,terminase,portal,tail,protease,integrase,capsid,head	Enterobacteria_phage(30.88%)	94	1897080:1897101	1948127:1948148
WP_024165649.1|1879992_1881111_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_000003742.1|1881079_1881349_-	excisionase	NA	NA	NA	NA	NA
WP_102597155.1|1881410_1883882_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_016231063.1|1883974_1884166_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000449192.1|1884162_1884351_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|1884882_1885257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|1885268_1885421_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|1885693_1886410_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|1886459_1886675_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|1886671_1887097_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262389.1|1887168_1888239_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_001151137.1|1888279_1888702_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	4.4e-64
WP_001266134.1|1888698_1888995_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_024239178.1|1888991_1889453_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	91.7	1.0e-37
WP_000403777.1|1889430_1889787_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1889837_1890050_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1890135_1890300_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1890301_1890565_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1890575_1891445_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1891560_1891665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1891853_1892066_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001341388.1|1892233_1892512_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_053878997.1|1892513_1893563_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.3e-109
WP_001217436.1|1893575_1893947_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1893936_1894308_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1894459_1895278_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1895564_1895762_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_114042822.1|1895899_1896613_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1897080:1897101	attL	CACCGGGAGGCACCCGGCACCA	NA	NA	NA	NA
WP_102597157.1|1897380_1899231_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000411809.1|1899532_1899739_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731192.1|1899743_1900088_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992126.1|1900138_1900672_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|1900827_1901010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1901022_1901154_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_012816791.1|1901381_1901567_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1902094_1902409_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299691.1|1902490_1902715_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	87.3	1.0e-19
WP_052893166.1|1903117_1903627_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	42.7	2.3e-11
WP_053886798.1|1903598_1905527_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.5e-260
WP_000259002.1|1905510_1905717_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_053882797.1|1905713_1907306_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.4e-184
WP_001254039.1|1907295_1908801_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256818.1|1908837_1909185_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|1909242_1910271_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|1910322_1910697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053877344.1|1910689_1911043_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|1911057_1911633_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|1911629_1912025_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|1912032_1912785_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479105.1|1912798_1913230_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533425.1|1913256_1913670_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000082490.1|1913650_1916230_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000847304.1|1916226_1916556_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_044703882.1|1916555_1917254_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.7	4.7e-132
WP_053882738.1|1917264_1918008_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.8e-146
WP_072162833.1|1917953_1918586_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.1	2.7e-102
WP_053893917.1|1918826_1922300_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001228318.1|1922367_1922967_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
WP_053919030.1|1923118_1924432_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.0e-78
WP_001023425.1|1924433_1924703_+	hypothetical protein	NA	Q9EYE9	Enterobacteria_phage	96.6	9.3e-44
WP_000938114.1|1927052_1928414_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.4	2.8e-51
WP_000799400.1|1928777_1929641_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1929624_1930761_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|1931010_1932237_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1932285_1933407_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|1933482_1934943_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|1934942_1935614_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1935782_1937153_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1937156_1937798_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1937833_1938940_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1938993_1939455_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1939464_1940118_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1940289_1941540_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000885267.1|1941946_1944274_-	ATPase AAA	NA	NA	NA	NA	NA
WP_000741318.1|1944592_1945720_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.5	2.7e-121
WP_001527050.1|1945700_1945946_-	phage excisionase	NA	NA	NA	NA	NA
WP_000008214.1|1946000_1946537_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	94.9	1.4e-94
WP_000081258.1|1946665_1947490_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.9e-149
WP_000135682.1|1947555_1947918_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000016389.1|1948386_1948821_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
1948127:1948148	attR	TGGTGCCGGGTGCCTCCCGGTG	NA	NA	NA	NA
WP_000549626.1|1948792_1948999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450735.1|1949246_1949873_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|1949970_1950171_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|1950208_1950760_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|1950935_1951115_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_102597158.1|1951104_1951659_+	GntR family transcriptional regulator	NA	U5P0H6	Shigella_phage	99.1	2.0e-56
WP_001259079.1|1951658_1952207_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	100.0	2.3e-97
WP_000424732.1|1952206_1952632_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785313.1|1952618_1953677_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.4	4.3e-201
WP_102597159.1|1954139_1954772_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	3.3e-108
WP_021570487.1|1954768_1955071_+	phage exclusion protein Ren	NA	M1FPD5	Enterobacteria_phage	96.7	1.0e-43
WP_001070442.1|1955138_1955471_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001348591.1|1955519_1955669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021570486.1|1955726_1957253_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.5	1.0e-30
>prophage 5
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	1960639	1969192	4918774	tail,transposase	Enterobacteria_phage(60.0%)	6	NA	NA
WP_021570481.1|1960639_1962547_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	61.2	1.4e-05
WP_054623587.1|1962546_1963131_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	4.1e-105
WP_085948316.1|1965142_1966415_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000207933.1|1966779_1967901_+	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_000539894.1|1968613_1968766_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
WP_001295666.1|1968868_1969192_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
>prophage 6
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	2071128	2136851	4918774	holin,terminase,portal,tail,protease,integrase,transposase,head	Escherichia_phage(34.0%)	77	2063881:2063895	2091570:2091584
2063881:2063895	attL	CCCAGCAGCCAGCAG	NA	NA	NA	NA
WP_000113681.1|2071128_2072259_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2072236_2072485_-	excisionase	NA	NA	NA	NA	NA
WP_021561102.1|2072549_2075021_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090200.1|2075113_2075305_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449191.1|2075301_2075490_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001336457.1|2075806_2076019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358769.1|2076061_2076340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021533604.1|2076299_2076701_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_001171958.1|2076723_2076942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|2077101_2077257_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|2077510_2077972_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_001053425.1|2078079_2078355_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000702041.1|2078338_2078764_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|2078835_2079876_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|2079787_2080330_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450702.1|2080363_2081134_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	6.7e-87
WP_001151161.1|2081149_2081575_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|2081749_2082415_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018428.1|2082595_2082808_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	3.1e-26
WP_001004956.1|2082973_2083624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|2083604_2084708_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001403449.1|2085098_2085371_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|2085372_2086419_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_001554974.1|2086431_2086791_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	3.5e-38
WP_001064895.1|2086787_2087477_+	antiterminator	NA	I6PDF8	Cronobacter_phage	45.1	1.1e-51
WP_001336255.1|2087548_2088388_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	40.2	1.8e-45
WP_000615423.1|2088384_2089128_+	protein phosphatase	NA	I6PCV8	Cronobacter_phage	43.1	1.6e-48
WP_077466990.1|2089238_2089565_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.8	2.0e-45
WP_000874518.1|2090839_2092693_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.2	0.0e+00
2091570:2091584	attR	CCCAGCAGCCAGCAG	NA	NA	NA	NA
WP_000284510.1|2092843_2093059_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193304.1|2093063_2093408_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_000369850.1|2093373_2093646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001554972.1|2093751_2094285_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	3.6e-100
WP_021566721.1|2094441_2094624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|2094638_2094770_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_071606003.1|2094992_2095178_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	90.2	7.3e-24
WP_000347013.1|2095590_2095731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2095863_2096049_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_001102142.1|2096436_2096985_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.0	6.7e-57
WP_094083981.1|2096914_2098885_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	2.1e-262
WP_000259005.1|2098868_2099075_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001441764.1|2099071_2100664_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_000201501.1|2102182_2102566_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|2102558_2102912_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|2102927_2103461_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|2103457_2103853_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|2103860_2104613_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479094.1|2104626_2105058_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	78.1	3.7e-42
WP_000533402.1|2105084_2105498_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_016230889.1|2105478_2108052_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.2	0.0e+00
WP_000847298.1|2108048_2108378_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001335877.1|2108377_2109076_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000194723.1|2109086_2109830_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_072129443.1|2109775_2110408_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	2.1e-102
WP_016235292.1|2110751_2114225_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_000526135.1|2114414_2114873_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001233154.1|2115003_2115603_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.5e-107
WP_000216487.1|2115754_2118781_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.5	7.0e-55
WP_000885577.1|2118780_2119365_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|2119419_2120088_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|2120144_2120414_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001079505.1|2121187_2121694_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_054623337.1|2121739_2122240_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2122325_2122505_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|2122885_2123692_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|2123691_2124885_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001340286.1|2124896_2126255_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
WP_000763511.1|2126258_2127854_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194582.1|2127853_2129416_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2129507_2129552_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|2129689_2130571_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2130567_2131188_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001326916.1|2131215_2133111_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|2133321_2134197_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|2134236_2134827_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559286.1|2134823_2135582_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|2135801_2136851_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	2158297	2209627	4918774	holin,lysis,terminase,tail,integrase,capsid	Shigella_phage(40.32%)	70	2150297:2150313	2193168:2193184
2150297:2150313	attL	TTTCAGGTTGCCAGCCA	NA	NA	NA	NA
WP_000573407.1|2158297_2159104_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_001128858.1|2159105_2160098_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146163.1|2160097_2160988_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001563184.1|2161164_2162352_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.1	2.7e-119
WP_001563185.1|2162315_2162558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001563186.1|2162611_2162863_-	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	92.8	7.8e-37
WP_016238040.1|2162911_2163592_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	2.5e-130
WP_000100829.1|2163588_2164374_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000995032.1|2164379_2164676_-	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_032207275.1|2164672_2166745_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	86.8	0.0e+00
WP_001563190.1|2166852_2167239_-	hypothetical protein	NA	V5USC5	Shigella_phage	80.5	1.9e-50
WP_001563191.1|2167312_2167534_-	protein kil	NA	A0A088CE40	Shigella_phage	95.9	1.7e-35
WP_000189936.1|2167991_2168201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005964.1|2168169_2168529_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	73.5	2.7e-38
WP_032257054.1|2168560_2169274_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	97.9	4.4e-125
WP_000198444.1|2169277_2169661_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000191544.1|2170158_2170920_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	46.3	1.1e-09
WP_001274760.1|2170951_2171665_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_000437871.1|2171765_2171966_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
WP_032257057.1|2172104_2172401_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	96.9	3.4e-47
WP_000438870.1|2172415_2172634_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_032257059.1|2172654_2173731_+	DNA-binding protein	NA	V5URT9	Shigella_phage	95.9	1.1e-199
WP_000790391.1|2173737_2174478_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.8	3.6e-122
WP_032261758.1|2174503_2175274_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	3.1e-108
WP_001118163.1|2175289_2175685_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000206792.1|2175741_2176326_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|2176441_2176546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|2176734_2176947_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_000119356.1|2177156_2177336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818160.1|2177354_2177840_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000042397.1|2177890_2178208_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000290554.1|2178913_2179579_+	hypothetical protein	NA	A0A088CD42	Shigella_phage	79.2	1.9e-90
WP_001076834.1|2179633_2180044_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_001254267.1|2180040_2180223_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	91.7	2.4e-27
WP_000211434.1|2180497_2181181_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	85.7	2.3e-107
WP_001004035.1|2181255_2181978_+	DNA-binding protein	NA	A0A0N7KZI6	Stx2-converting_phage	97.5	1.7e-124
WP_000002252.1|2181977_2182268_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001008116.1|2182264_2182627_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	99.2	3.2e-63
WP_000992060.1|2182626_2182821_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001204886.1|2182813_2183248_+	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000874468.1|2184013_2185924_+	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
WP_000142783.1|2186063_2186246_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_001290235.1|2186271_2186517_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	86.4	9.1e-14
WP_000284506.1|2186593_2186809_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087450.1|2186813_2187347_+	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000675931.1|2187567_2187681_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_077627825.1|2187902_2188088_+|lysis	lysis protein	lysis	A0A0P0ZDR7	Stx2-converting_phage	96.7	2.8e-23
WP_000934362.1|2188221_2188803_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001086085.1|2189405_2190221_+|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_001387707.1|2190201_2191908_+|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_032188285.1|2191907_2194052_+	hypothetical protein	NA	A0A088CE71	Shigella_phage	100.0	0.0e+00
2193168:2193184	attR	TTTCAGGTTGCCAGCCA	NA	NA	NA	NA
WP_032257831.1|2194209_2195217_+	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	91.6	2.1e-165
WP_032257832.1|2195240_2196455_+|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	99.3	1.3e-233
WP_032257833.1|2196509_2196902_+	hypothetical protein	NA	A0A088CD63	Shigella_phage	99.2	3.4e-63
WP_032257834.1|2196952_2197414_+	hypothetical protein	NA	A0A088CBQ5	Shigella_phage	97.4	2.4e-63
WP_032257835.1|2197397_2197961_+	hypothetical protein	NA	A0A088CE76	Shigella_phage	98.9	3.7e-103
WP_032257836.1|2197960_2198611_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	99.5	3.9e-120
WP_053893470.1|2198607_2200545_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
WP_001023407.1|2200546_2200816_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001146321.1|2201438_2203064_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.4	0.0e+00
WP_000197188.1|2203060_2204329_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_000455633.1|2204343_2204622_+	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_001459282.1|2204627_2205245_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
WP_032257521.1|2205324_2206062_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.6	2.9e-111
WP_000078907.1|2206294_2206435_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_050485605.1|2206491_2206893_+	hypothetical protein	NA	Q08J75	Stx2-converting_phage	97.7	3.0e-70
WP_032257519.1|2206984_2207641_+	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	98.6	1.7e-102
WP_032257518.1|2207643_2208090_+	hypothetical protein	NA	V5UT82	Shigella_phage	96.6	4.9e-74
WP_032257517.1|2208099_2208351_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	97.4	1.8e-12
WP_000012439.1|2208361_2209627_+	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
>prophage 8
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	2268506	2352845	4918774	holin,lysis,tRNA,terminase,tail,integrase,transposase,head	Escherichia_phage(40.0%)	85	2269358:2269374	2360727:2360743
WP_000628058.1|2268506_2269739_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2269358:2269374	attL	GTTTTTTGCGCTGATAA	NA	NA	NA	NA
WP_000387388.1|2269993_2270977_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2271454_2272828_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157376.1|2272956_2273892_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000040838.1|2273944_2275180_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.3	1.1e-240
WP_000079604.1|2275181_2275397_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001298826.1|2275496_2275685_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_021500490.1|2275677_2275872_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_001004423.1|2275935_2276988_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	63.3	1.4e-116
WP_000102216.1|2276999_2280125_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	82.8	0.0e+00
WP_001359121.1|2280575_2280746_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	92.9	7.9e-25
WP_000560227.1|2280745_2280967_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.2e-36
WP_001133037.1|2281536_2281746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2281746_2282385_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379546.1|2282396_2282549_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.3e-07
WP_000410105.1|2282854_2283274_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2283370_2283613_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702023.1|2283609_2284032_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899742.1|2284044_2284914_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.3	2.2e-78
WP_000788990.1|2284920_2285667_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_032313847.1|2285688_2286459_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	5.7e-86
WP_001141093.1|2286474_2286867_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	61.9	5.9e-39
WP_000206794.1|2286923_2287508_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|2287623_2287728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967410.1|2287916_2288129_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
WP_071525388.1|2288365_2288617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940348.1|2288688_2289288_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.0	1.6e-104
WP_000228019.1|2289287_2289578_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_000640148.1|2289574_2290129_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
WP_000211416.1|2290402_2290984_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_000917763.1|2291227_2291425_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301789.1|2291560_2292274_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001427258.1|2292723_2293155_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.5	6.2e-66
WP_032362312.1|2293726_2295580_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000284518.1|2295729_2295945_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_102597164.1|2295949_2296294_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	4.2e-57
WP_000992128.1|2296344_2296878_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_001082545.1|2297176_2297644_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.3	2.9e-77
WP_000453587.1|2298085_2298631_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|2298605_2300531_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|2300527_2300734_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_102597165.1|2301772_2302273_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.8	7.2e-66
WP_000683137.1|2302269_2302665_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235098.1|2302672_2303425_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|2303438_2303861_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|2303887_2304301_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_102597166.1|2304281_2306894_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.1	0.0e+00
WP_000847298.1|2306890_2307220_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_044869462.1|2307219_2307918_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	1.2e-130
WP_102597167.1|2307923_2308667_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.0e-148
WP_072065989.1|2308612_2309245_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.1	5.8e-105
WP_102597168.1|2309480_2312957_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.4	0.0e+00
WP_001360257.1|2313025_2313649_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_000268905.1|2313713_2315027_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_102597169.1|2315028_2315298_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	3.0e-42
WP_122988840.1|2315408_2315486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300461.1|2317523_2317958_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2318098_2319232_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000019448.1|2319461_2320442_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000628236.1|2320798_2324323_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|2324596_2324863_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|2324859_2325282_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|2325392_2326382_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_000900941.1|2326589_2329229_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|2329225_2329411_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|2329418_2329745_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067519.1|2329916_2330822_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|2331057_2332557_+	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|2332614_2334888_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|2335135_2337181_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|2337465_2338395_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|2338406_2338694_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|2338702_2339449_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|2339463_2339961_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|2339968_2341039_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|2341035_2341803_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|2341802_2342591_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|2342592_2344020_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|2344009_2344432_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|2344431_2345637_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|2345663_2346977_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|2347077_2348028_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|2348009_2348600_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|2348703_2348769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949152.1|2351571_2352845_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
2360727:2360743	attR	GTTTTTTGCGCTGATAA	NA	NA	NA	NA
>prophage 9
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	2512282	2547098	4918774	tail,transposase,lysis,integrase	Enterobacteria_phage(28.57%)	46	2521495:2521510	2551794:2551809
WP_000527809.1|2512282_2513743_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|2513831_2515115_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2515718_2515832_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2515900_2516134_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086522.1|2516450_2517041_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000885600.1|2517138_2517714_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	1.8e-105
WP_071524888.1|2517713_2518022_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000453589.1|2518272_2518818_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.2	9.5e-88
WP_001368374.1|2519206_2519440_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2519497_2519908_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2520059_2520233_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2520404_2520560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2520639_2520705_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2520707_2520896_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2520906_2521119_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2521481_2521979_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2521495:2521510	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001092971.1|2521975_2522509_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2522505_2522817_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2522821_2523037_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2523790_2524006_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2524306_2524519_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2524573_2524663_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2524940_2525693_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2525706_2526756_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2526757_2527036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2527102_2527354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2527570_2527726_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2527797_2528085_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2528084_2528324_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2528348_2528654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2528856_2529189_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|2529625_2530939_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|2531116_2531299_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_001310834.1|2532605_2532962_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001254876.1|2534525_2535677_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_001296941.1|2537759_2537996_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876958.1|2538030_2539311_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001360138.1|2539330_2539441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|2539498_2540518_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2540529_2541744_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2541949_2542276_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2542410_2542752_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2542786_2543347_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2543349_2544060_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|2544167_2544473_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|2544671_2547098_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
2551794:2551809	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 10
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	2961400	3026489	4918774	holin,transposase	Escherichia_phage(17.65%)	46	NA	NA
WP_085949152.1|2961400_2962673_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_158649441.1|2967494_2967665_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	77.8	5.1e-08
WP_000772446.1|2969373_2970540_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|2970539_2971511_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_077816398.1|2972162_2973065_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_053920579.1|2973068_2973374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104873.1|2974134_2974356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274421.1|2974369_2974804_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_122998873.1|2975922_2976225_+	antirestriction protein	NA	NA	NA	NA	NA
WP_024239105.1|2976271_2976694_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|2976690_2976882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021569034.1|2977680_2978133_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	58.0	5.4e-44
WP_024239188.1|2978189_2978423_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001302184.1|2980091_2980250_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_021569031.1|2981148_2981436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024239203.1|2981554_2982376_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.4	2.8e-43
WP_021569028.1|2983593_2983977_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_024239138.1|2986192_2987389_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000411809.1|2987763_2987970_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731192.1|2987974_2988319_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_072164699.1|2989057_2989240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208680.1|2989613_2989799_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2990324_2990639_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_096843318.1|2991420_2992296_+	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	92.8	1.4e-152
WP_000402944.1|2994541_2994754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132890.1|2994925_2995177_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001270415.1|2995173_2995461_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	45.3	5.5e-18
WP_000019448.1|2995739_2996720_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_032146770.1|2997193_2997496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032258008.1|2999460_3000051_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_102597179.1|3000223_3000865_+	T3SS effector NleG family protein	NA	B6ETE1	Enterobacteria_phage	39.6	2.8e-38
WP_102597180.1|3001003_3005098_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	42.9	1.2e-302
WP_102597181.1|3006186_3007395_-	secretion protein EspV	NA	H6WZN3	Escherichia_phage	92.8	3.1e-216
WP_085949152.1|3008317_3009590_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000480498.1|3009883_3010936_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378584.1|3011250_3012567_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|3012668_3014123_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532923.1|3014465_3015182_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000943916.1|3015813_3017457_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011013.1|3017574_3018525_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011466.1|3018626_3019544_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986331.1|3020000_3020936_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193786.1|3020997_3022077_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|3022088_3022832_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_045173184.1|3022828_3023374_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001254932.1|3025337_3026489_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 11
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	3073832	3080139	4918774		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100804.1|3073832_3074378_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
WP_004016728.1|3074382_3075261_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	6.6e-107
WP_004016730.1|3075319_3076219_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.3e-28
WP_000699403.1|3076218_3077304_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_044067113.1|3077676_3078570_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_045174079.1|3078744_3080139_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	6.3e-19
>prophage 12
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	3171765	3180077	4918774		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001373876.1|3171765_3173769_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001373589.1|3173893_3174355_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001295430.1|3174395_3174866_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3174912_3175632_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3175628_3177314_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3177535_3178267_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|3178326_3178434_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3178414_3179146_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569358.1|3179150_3180077_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 13
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	3546357	3620503	4918774	integrase,holin,terminase,tail,protease,transposase	Escherichia_phage(46.15%)	76	3576700:3576716	3617389:3617405
WP_001300563.1|3546357_3547470_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000339476.1|3547561_3549580_+	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_001311024.1|3549590_3550538_+	hydrogenase 4 subunit HyfC	NA	NA	NA	NA	NA
WP_000429104.1|3550554_3551994_+	hydrogenase 4 subunit D	NA	NA	NA	NA	NA
WP_000147987.1|3552005_3552656_+	hydrogenase 4 membrane subunit	NA	NA	NA	NA	NA
WP_000122571.1|3552660_3554241_+	hydrogenase 4 subunit F	NA	NA	NA	NA	NA
WP_001102321.1|3554230_3555898_+	hydrogenase 4 catalytic subunit HyfG	NA	NA	NA	NA	NA
WP_000916055.1|3555907_3556453_+	hydrogenase 4 subunit H	NA	NA	NA	NA	NA
WP_000075558.1|3556449_3557208_+	hydrogenase 4 catalytic subunit HyfI	NA	NA	NA	NA	NA
WP_001326580.1|3557200_3557614_+	hydrogenase 4 assembly chaperone HyfJ	NA	NA	NA	NA	NA
WP_001251544.1|3557643_3559656_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_001244734.1|3559677_3560526_+	formate transporter	NA	NA	NA	NA	NA
WP_000892044.1|3560563_3561625_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000489667.1|3561837_3563301_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000166446.1|3563321_3563681_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_000247065.1|3563818_3564565_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000198328.1|3564614_3565904_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|3565989_3566616_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001336050.1|3566940_3567978_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
WP_001028612.1|3567977_3568616_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.8e-29
WP_000529576.1|3568787_3570854_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001121363.1|3570858_3572400_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_000772731.1|3572438_3574682_-	cyclic-guanylate-specific phosphodiesterase PdeF	NA	NA	NA	NA	NA
WP_001344399.1|3575051_3575225_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|3575538_3576054_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755173.1|3576069_3576609_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
3576700:3576716	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_063209897.1|3576803_3577292_-	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	62.9	1.1e-45
WP_063209895.1|3577288_3577513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063209893.1|3577509_3578136_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	97.6	6.6e-117
WP_097499718.1|3578125_3578434_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	98.0	2.9e-49
WP_097499717.1|3578420_3578825_-	hypothetical protein	NA	T1SA79	Salmonella_phage	98.5	8.4e-65
WP_102597194.1|3578942_3581744_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	65.9	1.2e-56
WP_087598103.1|3581940_3582198_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
WP_021537563.1|3582220_3582949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000126406.1|3583343_3584030_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	81.8	3.5e-103
WP_000671196.1|3584311_3584755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|3584848_3585010_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_024203028.1|3585041_3585338_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	99.0	5.6e-50
WP_102597195.1|3585534_3588009_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.2	0.0e+00
WP_102597196.1|3588014_3589817_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.8	0.0e+00
WP_102597197.1|3589813_3592327_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	97.8	0.0e+00
WP_000332878.1|3592326_3592872_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_000568027.1|3592871_3593336_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
WP_102597198.1|3593335_3595807_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.8	0.0e+00
WP_000179261.1|3595806_3596412_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	100.0	2.1e-112
WP_077473226.1|3596411_3596735_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	96.3	1.7e-52
WP_000012377.1|3596785_3597121_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000627074.1|3597131_3597569_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	100.0	2.2e-74
WP_000268715.1|3597620_3598607_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_001048087.1|3598621_3599317_-	peptidase	NA	G9L6C4	Escherichia_phage	99.6	3.0e-94
WP_000133160.1|3599319_3599616_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_102597199.1|3599612_3601292_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.1	1.8e-302
WP_000335899.1|3601306_3601513_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_001280570.1|3602220_3602592_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	98.4	3.2e-63
WP_102597200.1|3602682_3604158_-|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.0	1.9e-295
WP_024166494.1|3604154_3604865_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	85.2	1.0e-105
WP_102597201.1|3604905_3605244_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	4.9e-58
WP_102597202.1|3605236_3605602_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	94.1	1.3e-61
WP_102597203.1|3605601_3606786_-	DUF551 domain-containing protein	NA	Q1MVF7	Enterobacteria_phage	69.8	3.4e-90
WP_102597204.1|3606789_3607320_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	53.2	3.6e-55
WP_102597205.1|3607321_3607621_-	hypothetical protein	NA	Q716F3	Shigella_phage	94.9	1.5e-55
WP_001231254.1|3608173_3608518_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	1.4e-60
WP_001680564.1|3608635_3609421_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	2.1e-152
WP_001559621.1|3609417_3610233_-	hypothetical protein	NA	Q286X4	Escherichia_phage	96.4	3.2e-119
WP_001282459.1|3610599_3610830_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|3610984_3611569_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_102597206.1|3611877_3612177_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	93.9	6.0e-44
WP_102597207.1|3612173_3612995_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	97.4	2.8e-160
WP_061089317.1|3612991_3613933_+	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	99.7	7.7e-178
WP_000675390.1|3613982_3614231_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001335975.1|3614388_3614640_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_102597208.1|3614632_3615283_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	99.5	1.5e-127
WP_001055436.1|3615279_3615939_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	3.3e-103
WP_102597209.1|3615941_3617198_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	99.3	2.8e-236
WP_000138270.1|3617390_3618968_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
3617389:3617405	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001299507.1|3619036_3620503_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 14
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	3813199	3856864	4918774	holin,transposase	Acinetobacter_phage(37.5%)	34	NA	NA
WP_000131044.1|3813199_3815233_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3815361_3815949_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3815962_3817435_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3817448_3819119_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3819331_3820000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3820242_3820938_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3820930_3822358_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3822368_3823088_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3823614_3824469_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|3824694_3826020_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3826128_3826365_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3826376_3826970_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_085949152.1|3827441_3828714_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000621009.1|3828895_3829747_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000020219.1|3829886_3834143_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3835257_3835359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3835722_3835986_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3835985_3836126_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3836160_3836388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|3836455_3837617_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001301257.1|3838472_3839015_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3839089_3839677_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3839733_3840402_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3840427_3842953_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001360105.1|3844554_3845265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|3845577_3845907_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3846154_3846769_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3847186_3847876_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_054623549.1|3847872_3848829_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_054623550.1|3848825_3851024_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3851033_3851990_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3851968_3852379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948316.1|3852981_3854255_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_085947771.1|3855701_3856864_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 15
NZ_CP025747	Escherichia coli strain ML35 chromosome, complete genome	4918774	4196053	4256492	4918774	transposase	Escherichia_phage(22.22%)	54	NA	NA
WP_000181180.1|4196053_4197010_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.0e-60
WP_071526289.1|4197006_4197219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045174857.1|4197476_4198709_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001037384.1|4198749_4200030_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001295741.1|4200145_4201297_+	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_001295740.1|4201306_4202074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042032858.1|4202070_4202328_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001317601.1|4202392_4203253_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001139961.1|4203320_4204499_+	MFS transporter	NA	NA	NA	NA	NA
WP_001151855.1|4204511_4205066_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
WP_001295597.1|4205315_4205999_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|4205995_4206457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045174863.1|4206469_4207642_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001422859.1|4207706_4208618_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986215.1|4208610_4209003_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|4208999_4209083_-	iraD leader peptide	NA	NA	NA	NA	NA
WP_085949152.1|4209621_4210894_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000062572.1|4211010_4211853_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000833694.1|4212758_4213532_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_045173783.1|4213746_4215207_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
WP_000438591.1|4215287_4216472_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_001774146.1|4216811_4218155_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_021532766.1|4218335_4219238_-	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000872005.1|4219257_4219761_-	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_001244823.1|4219773_4220304_-	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_000120922.1|4220313_4222950_-	fimbrial biogenesis usher protein FimD	NA	NA	NA	NA	NA
WP_000066581.1|4223016_4223742_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_042033154.1|4224381_4224930_-	fimbrial protein	NA	NA	NA	NA	NA
WP_102597218.1|4225411_4226008_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	1.1e-49
WP_000790583.1|4226485_4227088_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_001360088.1|4228543_4229260_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_001315214.1|4229279_4230386_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001295601.1|4230450_4231431_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	1.2e-101
WP_001037966.1|4231438_4232089_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000555378.1|4232840_4233974_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_000624722.1|4235681_4236032_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|4236028_4236454_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_094320579.1|4237158_4238372_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	7.9e-167
WP_045173055.1|4238434_4239775_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.5	3.7e-250
WP_000823243.1|4240013_4241372_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937736.1|4241750_4241942_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_000555341.1|4242104_4242362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4244112_4244634_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4244630_4245584_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188267.1|4245670_4247995_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|4248039_4248942_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|4248938_4249937_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4249933_4250890_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4250890_4251658_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4252215_4252473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4253524_4254676_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4254595_4254946_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4255046_4255619_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4255667_4256492_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
