The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025590	Lactiplantibacillus plantarum strain K259 chromosome, complete genome	3312096	30939	142518	3312096	tRNA,bacteriocin,protease	Tupanvirus(18.18%)	107	NA	NA
WP_044428951.1|30939_31503_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_044428954.1|31696_32365_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_027821520.1|32522_34028_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_013355173.1|34292_34661_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|34773_35283_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003643764.1|35313_36510_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641934.1|36619_37090_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|37108_37564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641936.1|37667_38240_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_011100977.1|38405_39326_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_015379753.1|39462_40362_+	oxidoreductase	NA	NA	NA	NA	NA
WP_053566421.1|40801_42682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011679766.1|42853_43300_-	ribonuclease H	NA	NA	NA	NA	NA
WP_003641940.1|43537_45064_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_015825109.1|45064_46036_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_053566422.1|46113_47445_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|47910_49428_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003643774.1|49442_51272_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003643775.1|51286_52009_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_053566424.1|52591_56287_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_095587192.1|57839_58256_+	EndoU domain-containing protein	NA	NA	NA	NA	NA
WP_053566425.1|58295_58610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080373188.1|58671_58824_+	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_053566426.1|58834_59242_+	immunity 63 family protein	NA	NA	NA	NA	NA
WP_080373231.1|59742_60081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100991.1|60420_60699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063733875.1|60995_61913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526893.1|61919_62093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016511577.1|62637_63180_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011100988.1|63194_63458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643788.1|63574_63778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063204024.1|63902_64142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047672646.1|64159_64546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072534813.1|64995_65187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057136835.1|65578_65824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643792.1|66398_66818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102124376.1|67086_67572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379760.1|67907_68525_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_102124377.1|68528_69683_-	MFS transporter	NA	NA	NA	NA	NA
WP_011100993.1|69686_70478_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_102124378.1|70548_71421_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641966.1|71580_72396_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_063486820.1|72921_74298_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011100995.1|74342_75527_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003641969.1|75911_76115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641971.1|76526_77195_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641972.1|77191_77365_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641973.1|77395_77563_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641974.1|78424_78625_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641975.1|78752_78920_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641977.1|80266_81013_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641979.1|81890_82037_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_021356664.1|82227_83556_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_063486822.1|83556_84300_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_063204018.1|84418_85162_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015825123.1|85467_86241_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|86339_86498_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|86522_86693_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_063204064.1|86959_89110_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_057136851.1|89125_90502_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_063733768.1|90591_91281_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063204066.1|91348_92017_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_102124379.1|92103_92784_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821496.1|93691_93895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063204067.1|93989_96299_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021356643.1|96557_97334_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003643815.1|97773_98790_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003641997.1|99197_99908_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641998.1|99980_101342_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641999.1|101348_101537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642000.1|101526_101949_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003643816.1|102171_103527_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642002.1|103544_104981_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_003642003.1|105101_105998_+	ROK family protein	NA	NA	NA	NA	NA
WP_003642004.1|106147_106894_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063204068.1|107006_108020_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_047672680.1|108474_109608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643820.1|109612_110407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642008.1|110575_111493_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003642009.1|111538_112813_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642010.1|112805_113765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646490.1|113786_114491_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642012.1|114490_115333_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_015825136.1|115936_116326_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003643823.1|116647_118699_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_003642016.1|118931_120116_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003642017.1|120238_121015_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_063204069.1|121001_121565_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_003642019.1|121561_122452_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003642020.1|122556_122808_+	Veg family protein	NA	NA	NA	NA	NA
WP_003643828.1|122940_123807_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642022.1|124116_125061_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003642023.1|125328_126027_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003646500.1|126019_126817_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642030.1|127172_128009_+	pur operon repressor	NA	NA	NA	NA	NA
WP_063204070.1|128077_129460_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_063204071.1|129695_130520_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003643830.1|130885_131866_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_003646506.1|132148_133171_+	YdcF family protein	NA	NA	NA	NA	NA
WP_003643831.1|133253_134240_+	lipoprotein	NA	NA	NA	NA	NA
WP_003646508.1|134409_135219_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_169484456.1|135238_136597_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_003643833.1|136605_137538_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003642040.1|137900_138341_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003642041.1|138385_138994_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642042.1|139166_140780_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003646511.1|141246_142518_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	4.5e-96
>prophage 2
NZ_CP025590	Lactiplantibacillus plantarum strain K259 chromosome, complete genome	3312096	154113	224816	3312096	tRNA,transposase,integrase,protease	unidentified_phage(10.53%)	52	211133:211157	226218:226242
WP_063486830.1|154113_155013_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003642056.1|155073_155862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486834.1|156083_157472_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003642058.1|157726_159313_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.0e-73
WP_013355194.1|159484_160747_-|transposase	ISL3-like element ISP1 family transposase	transposase	NA	NA	NA	NA
WP_003642061.1|161866_162229_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003642062.1|162228_163356_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	2.5e-29
WP_027821484.1|163764_164157_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	36.0	5.7e-10
WP_060684291.1|164448_166431_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	35.8	2.1e-68
WP_063733776.1|166537_169600_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_011101043.1|169592_170660_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_021357494.1|170928_171954_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_072535965.1|171984_173193_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_003642071.1|173208_173955_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_003642072.1|173951_175121_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.6	2.9e-17
WP_021356429.1|175113_176136_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_003642074.1|176244_176751_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.1	2.9e-06
WP_102124382.1|176950_178576_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003643849.1|180261_180900_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_022638510.1|181054_182449_-	peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
WP_102124383.1|182761_184423_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.4e-92
WP_003642078.1|184436_185399_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_021356688.1|185730_186288_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_063204265.1|186307_189835_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_013355210.1|190009_191614_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_003642082.1|191610_191898_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003642083.1|192018_192417_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003642084.1|192541_193081_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_003642085.1|193364_194711_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	23.8	2.6e-09
WP_003642086.1|194730_195273_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.0	1.5e-08
WP_003643854.1|195352_197590_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	47.8	6.0e-104
WP_063204266.1|197738_198626_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003642089.1|198625_199633_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_072533499.1|199736_201236_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	1.3e-89
WP_044429853.1|201449_201914_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.2	8.8e-18
WP_063487734.1|208547_210020_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.3	2.7e-68
WP_072540382.1|210074_210917_+	metallophosphoesterase	NA	NA	NA	NA	NA
211133:211157	attL	CTGGTTCGAACCCAGCTAGCCCAAT	NA	NA	NA	NA
WP_050340432.1|211309_212473_-|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	31.7	4.0e-43
WP_046947797.1|212504_212921_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046947796.1|213043_213238_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046947795.1|213250_213937_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	30.9	9.1e-11
WP_046040869.1|213963_214257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046947794.1|214569_214992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046947793.1|214984_215206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046947792.1|215218_215998_+	bifunctional DNA primase/polymerase	NA	A0A060ADS5	Enterococcus_phage	31.3	1.3e-21
WP_046947791.1|216009_217428_+	virulence protein	NA	A0A0A7RTG3	Clostridium_phage	36.1	1.2e-73
WP_050340426.1|218038_218413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046040767.1|218414_218828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027822219.1|219870_220197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004271307.1|220675_221599_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_015474755.1|221806_223405_-	APC family permease	NA	NA	NA	NA	NA
WP_050339279.1|223772_224816_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	34.3	7.5e-33
226218:226242	attR	CTGGTTCGAACCCAGCTAGCCCAAT	NA	NA	NA	NA
>prophage 3
NZ_CP025590	Lactiplantibacillus plantarum strain K259 chromosome, complete genome	3312096	266734	360792	3312096	capsid,portal,terminase,integrase,tRNA,holin,protease,tail,head	Lactobacillus_phage(27.45%)	104	262654:262669	312775:312790
262654:262669	attL	CCAAGGACGTTTTTTG	NA	NA	NA	NA
WP_003640924.1|266734_267427_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003643927.1|267616_268948_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	5.4e-68
WP_003640926.1|269023_269707_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003640927.1|269715_270012_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640928.1|270150_270687_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	45.8	2.4e-35
WP_003643928.1|271723_273103_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003640931.1|273118_274294_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003640932.1|274619_276110_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024521299.1|276387_277800_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	29.8	8.9e-45
WP_003640934.1|277801_278212_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_003640935.1|278183_278969_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003644974.1|278970_279519_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_063204088.1|280025_280628_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003637768.1|280689_280839_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003640939.1|280850_281036_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003643932.1|281140_281689_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_003640941.1|281716_282604_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003640942.1|282705_283131_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003640943.1|283231_283921_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003643933.1|284119_284623_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003637775.1|284684_285053_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_102124386.1|285204_286407_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A126GGK4	Streptococcus_phage	29.5	1.2e-37
WP_003642778.1|286615_286792_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	2.6e-10
WP_063721905.1|287078_287642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063721904.1|287668_288748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102124387.1|289229_289565_-	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	53.9	3.7e-26
WP_102124388.1|289672_289927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102124389.1|289936_290728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644968.1|290750_291164_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
WP_011101778.1|291175_291538_-	helix-turn-helix domain-containing protein	NA	A0A2R2ZGJ3	Clostridioides_phage	48.4	1.7e-08
WP_063964081.1|291666_291894_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158649082.1|292015_292186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102124390.1|292244_292493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102124391.1|292522_292726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063722756.1|292803_292986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102124392.1|293046_293601_+	hypothetical protein	NA	O03909	Lactobacillus_phage	96.7	6.3e-95
WP_102124393.1|293606_293894_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_164971152.1|294003_294150_+	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	89.4	3.4e-16
WP_102124395.1|294403_294790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102124396.1|294786_295674_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	53.3	5.4e-64
WP_187345425.1|295705_296458_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	53.0	2.6e-75
WP_102124398.1|297352_298195_+	ATP-binding protein	NA	O03914	Lactobacillus_phage	96.1	1.1e-151
WP_102124399.1|298351_298870_+	hypothetical protein	NA	O03915	Lactobacillus_phage	54.2	4.6e-39
WP_011101765.1|298866_299247_+	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_003642805.1|299457_299919_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_154104195.1|300290_300437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102124400.1|300449_300719_-	DUF3892 domain-containing protein	NA	A0A059NT53	Lactococcus_phage	62.7	7.2e-12
WP_015380624.1|301088_301286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033607691.1|301413_301683_+	DUF2829 domain-containing protein	NA	A0A0K2FLC4	Brevibacillus_phage	43.2	2.7e-11
WP_102124401.1|301723_302605_+|terminase	terminase small subunit	terminase	V5URT8	Oenococcus_phage	50.7	4.8e-57
WP_063488225.1|302594_303833_+|terminase	PBSX family phage terminase large subunit	terminase	X2CYF4	Lactobacillus_phage	57.4	1.0e-137
WP_102124402.1|303844_305353_+|portal	phage portal protein	portal	V5US18	Oenococcus_phage	51.2	3.4e-135
WP_003642812.1|305282_305579_+|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	6.7e-11
WP_102124403.1|307123_307801_+	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	31.2	3.0e-14
WP_102124404.1|307815_308166_+	hypothetical protein	NA	V5UTH9	Oenococcus_phage	62.9	3.4e-30
WP_003642819.1|308185_309208_+|capsid	major capsid protein	capsid	V5US24	Oenococcus_phage	62.5	3.7e-117
WP_003642820.1|309220_309397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355731.1|309408_309741_+|head,tail	phage head-tail connector protein	head,tail	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_102124405.1|309740_310088_+	hypothetical protein	NA	V5US85	Oenococcus_phage	61.4	2.0e-35
WP_044431353.1|310089_310641_+	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.3	8.8e-65
WP_013355729.1|310640_311006_+	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
WP_099447638.1|311107_311491_+|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	58.4	1.8e-37
WP_033608825.1|311590_311989_+	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.0	6.6e-46
WP_102124607.1|312096_312360_+	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	1.4e-23
WP_102124406.1|312375_318207_+|tail	phage tail protein	tail	V5URV5	Oenococcus_phage	40.9	3.0e-227
312775:312790	attR	CAAAAAACGTCCTTGG	NA	NA	NA	NA
WP_099739626.1|318250_318583_+	hypothetical protein	NA	V5UQS8	Oenococcus_phage	73.4	2.2e-42
WP_102124407.1|318597_322848_+	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.4	1.3e-144
WP_003642831.1|322854_323304_+	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	40.5	6.1e-24
WP_003642832.1|323306_323741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050431034.1|323919_325035_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	77.4	2.3e-32
WP_102124408.1|325035_325332_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	75.5	1.4e-37
WP_102124409.1|325318_325690_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	84.6	4.9e-27
WP_052470491.1|325976_327500_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_027821466.1|328282_329260_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_027821465.1|329272_329941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640948.1|330244_332848_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003640949.1|333022_333598_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	41.7	6.4e-26
WP_003640950.1|333679_334690_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	60.5	3.1e-108
WP_003643938.1|334717_336883_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.5	5.7e-269
WP_003640952.1|337021_337252_-	redoxin NrdH	NA	X2KRY7	Enterococcus_phage	40.0	2.8e-09
WP_044429285.1|337474_338083_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003640954.1|338085_338592_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003643940.1|339117_340815_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|340836_341145_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|341160_341760_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|341774_342026_+	YaaL family protein	NA	NA	NA	NA	NA
WP_016510978.1|342411_343077_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|343073_343403_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003640966.1|343419_344439_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|344463_344811_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_044429290.1|344909_345806_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	7.5e-82
WP_003640969.1|345809_346595_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355240.1|346733_347729_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
WP_003640973.1|349806_350661_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003640974.1|350657_351461_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003640975.1|351450_352221_-	phosphonate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.8	4.9e-13
WP_003640976.1|352258_353311_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_003640977.1|353590_354316_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011101142.1|354299_354878_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640979.1|354870_355326_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_072534972.1|355330_356377_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.4	1.0e-61
WP_003643947.1|357154_359137_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.7	2.0e-50
WP_003640983.1|359305_359983_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003640984.1|360147_360792_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP025590	Lactiplantibacillus plantarum strain K259 chromosome, complete genome	3312096	1017135	1029913	3312096		Lactobacillus_phage(70.0%)	11	NA	NA
WP_013355467.1|1017135_1018374_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	98.7	2.4e-219
WP_013355468.1|1018464_1019436_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	3.5e-181
WP_003643099.1|1019621_1020569_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1020911_1021526_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_022638021.1|1021528_1023967_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
WP_013355469.1|1024054_1024615_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	98.4	6.5e-100
WP_013355470.1|1024685_1025126_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	97.9	1.2e-75
WP_022638019.1|1025516_1026884_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	3.4e-25
WP_021356352.1|1026876_1027569_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
WP_013355473.1|1028278_1028944_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_013355474.1|1028968_1029913_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.5	2.0e-72
>prophage 5
NZ_CP025590	Lactiplantibacillus plantarum strain K259 chromosome, complete genome	3312096	1513766	1599089	3312096	capsid,portal,terminase,integrase,tRNA,holin,protease,tail,head,transposase	Lactobacillus_phage(74.47%)	92	1539348:1539365	1605950:1605967
WP_072533795.1|1513766_1514690_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003640717.1|1515174_1515696_-	shikimate kinase	NA	NA	NA	NA	NA
WP_003645966.1|1515698_1516796_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_063733656.1|1516798_1518097_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003644492.1|1518110_1518638_-	amino acid biosynthesis protein	NA	NA	NA	NA	NA
WP_063730294.1|1518646_1519816_-	chorismate synthase	NA	NA	NA	NA	NA
WP_061871736.1|1519808_1521263_-	MFS transporter	NA	NA	NA	NA	NA
WP_003640723.1|1521911_1522265_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_022637968.1|1522287_1524864_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_003640725.1|1524878_1525184_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003640726.1|1525173_1525473_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003640727.1|1525517_1526735_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_102124469.1|1526755_1527232_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003640729.1|1527527_1531841_-	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640732.1|1532334_1534044_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640733.1|1534083_1535361_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640734.1|1535398_1536184_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640735.1|1536199_1536979_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640736.1|1537098_1537662_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003644498.1|1538585_1539464_-	elongation factor Ts	NA	NA	NA	NA	NA
1539348:1539365	attL	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
WP_044430935.1|1539566_1540370_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003640740.1|1540594_1541317_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640741.1|1541605_1542604_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_003640742.1|1542688_1542994_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003644499.1|1542977_1543736_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003645630.1|1543847_1544483_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003640745.1|1544539_1544776_-	YneF family protein	NA	NA	NA	NA	NA
WP_003644501.1|1544873_1545113_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640747.1|1545264_1545897_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_157262971.1|1545985_1546078_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003644502.1|1546451_1547081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640749.1|1547130_1548300_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003640750.1|1548335_1548728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644503.1|1548891_1549284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644504.1|1549728_1550670_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	49.0	2.4e-78
WP_044430944.1|1551420_1551993_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080333756.1|1552144_1553329_-	LCP family protein	NA	NA	NA	NA	NA
WP_044430948.1|1553309_1554101_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	7.0e-31
WP_046810958.1|1554119_1555862_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_044430952.1|1556339_1557551_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_072557939.1|1558787_1559318_-|holin	holin	holin	E9LUS0	Lactobacillus_phage	98.9	2.5e-40
WP_003644510.1|1559330_1559594_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_072557940.1|1559593_1560766_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	99.7	1.5e-215
WP_063487082.1|1560781_1561666_-	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	99.7	1.7e-139
WP_016058341.1|1561649_1561811_-	hypothetical protein	NA	E9LUR6	Lactobacillus_phage	100.0	1.2e-19
WP_016058340.1|1561814_1562069_-	hypothetical protein	NA	E9LUR5	Lactobacillus_phage	100.0	1.4e-30
WP_072557941.1|1562061_1564869_-|tail	phage tail protein	tail	E9LUR4	Lactobacillus_phage	87.8	1.0e-311
WP_072557942.1|1564886_1567256_-|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	99.9	0.0e+00
WP_102124470.1|1567325_1569098_-|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	98.5	0.0e+00
WP_102124471.1|1569170_1574393_-|tail	phage tail protein	tail	E9LUR1	Lactobacillus_phage	77.8	0.0e+00
WP_016058335.1|1574405_1574597_-	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_046947715.1|1574593_1574977_-	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	98.4	1.3e-62
WP_016058333.1|1575178_1575817_-|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	100.0	8.8e-117
WP_046947716.1|1575817_1576201_-	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	97.6	6.1e-65
WP_046947717.1|1576197_1576638_-	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	97.9	1.2e-77
WP_046947718.1|1576627_1576990_-|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	96.7	2.9e-64
WP_046947719.1|1576973_1577312_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	91.1	2.0e-51
WP_052751295.1|1577384_1578626_-|capsid	phage major capsid protein	capsid	A0A286QSM8	Streptococcus_phage	42.4	4.4e-72
WP_102124472.1|1578645_1579347_-|protease	Clp protease ClpP	protease	Q9T1F7	Lactobacillus_phage	47.7	4.1e-51
WP_046947721.1|1579327_1580524_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	61.1	5.3e-131
WP_046947722.1|1580523_1580724_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_046947723.1|1580710_1582600_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	93.1	0.0e+00
WP_046947724.1|1582602_1583061_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.0	2.0e-78
WP_102124473.1|1583279_1583750_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	93.6	4.7e-83
WP_013355638.1|1583760_1583931_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	96.4	3.3e-23
WP_063488409.1|1583942_1584176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102124474.1|1584244_1585126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016058320.1|1585421_1585853_-	phage transcriptional activator RinA	NA	E9LUP5	Lactobacillus_phage	100.0	1.9e-78
WP_102124475.1|1585833_1586004_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	92.9	1.3e-19
WP_072540025.1|1586121_1586319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072540026.1|1586391_1586820_-	hypothetical protein	NA	Q5ULU9	Lactobacillus_virus	56.8	2.6e-40
WP_158649083.1|1586849_1587017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638754.1|1587019_1587178_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	92.3	3.9e-18
WP_102124476.1|1587170_1587479_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	96.1	4.9e-49
WP_102124477.1|1587614_1588400_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	91.6	2.2e-133
WP_102124478.1|1588399_1589116_-	helix-turn-helix domain-containing protein	NA	A0A0P0I7Q1	Lactobacillus_phage	39.3	6.1e-34
WP_102124479.1|1589157_1589850_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	82.6	2.1e-108
WP_102124480.1|1589869_1590175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164883040.1|1590175_1590346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821290.1|1590388_1590619_-	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	87.7	3.2e-29
WP_102124481.1|1590630_1590831_-	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	87.9	2.9e-26
WP_063722546.1|1590833_1591088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641367.1|1591230_1591491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380501.1|1591548_1591875_+	hypothetical protein	NA	E9LUT2	Lactobacillus_phage	98.1	2.7e-53
WP_102124482.1|1591990_1592200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164883041.1|1592211_1592919_-	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	59.5	2.5e-64
WP_057138664.1|1592934_1593183_-	transcriptional regulator	NA	A0A0P0IX93	Lactobacillus_phage	61.4	4.0e-17
WP_057138663.1|1593351_1594026_+	LexA family transcriptional regulator	NA	D7RWL5	Brochothrix_phage	44.6	8.0e-52
WP_053267125.1|1594155_1595031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053338954.1|1596215_1596524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102124485.1|1596630_1597406_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_053338955.1|1597925_1599089_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.5	1.2e-55
1605950:1605967	attR	GTCAACGGCTTTTTCCAT	NA	NA	NA	NA
>prophage 6
NZ_CP025590	Lactiplantibacillus plantarum strain K259 chromosome, complete genome	3312096	1903274	1947214	3312096	capsid,portal,terminase,lysis,integrase,tail,head	Lactobacillus_phage(48.65%)	50	1911431:1911446	1947081:1947096
WP_003642761.1|1903274_1905269_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
WP_003646619.1|1905673_1905865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158649084.1|1906647_1907562_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_102124495.1|1907707_1908778_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P0ZLG2	Lactobacillus_phage	90.7	2.4e-114
WP_089178211.1|1908777_1909068_-|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	59.4	4.8e-22
WP_089178210.1|1909064_1909265_-	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	88.9	8.2e-21
WP_058906830.1|1909267_1909651_-	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	92.9	2.3e-64
1911431:1911446	attL	GAACTTGCCATTAACG	NA	NA	NA	NA
WP_102124496.1|1911662_1913876_-|tail	phage tail protein	tail	Q597U4	Lactobacillus_virus	77.4	0.0e+00
WP_102124497.1|1913890_1915150_-|tail	phage tail family protein	tail	A0A2P0ZL23	Lactobacillus_phage	52.0	8.9e-121
WP_102124498.1|1915162_1918603_-|tail	phage tail tape measure protein	tail	A0A2P0ZL32	Lactobacillus_phage	53.6	8.6e-17
WP_158649085.1|1918606_1918858_-	hypothetical protein	NA	A0A2P0ZL20	Lactobacillus_phage	45.0	4.8e-10
WP_058906825.1|1918923_1919337_-	hypothetical protein	NA	A0A2K9VBY8	Lactobacillus_phage	59.9	6.2e-39
WP_102124500.1|1919357_1920146_-|tail	phage major tail protein, TP901-1 family	tail	Q597U9	Lactobacillus_virus	92.1	2.3e-98
WP_102124501.1|1920165_1920519_-	hypothetical protein	NA	K4I072	Lactobacillus_virus	72.6	3.9e-42
WP_058906822.1|1920518_1920893_-	HK97 gp10 family phage protein	NA	G8FUY4	Pediococcus_virus	62.9	4.0e-37
WP_102124502.1|1920885_1921164_-	hypothetical protein	NA	G8FUY5	Pediococcus_virus	73.9	1.1e-31
WP_058906820.1|1921160_1921499_-|head,tail	phage head-tail connector protein	head,tail	K4I470	Lactobacillus_virus	78.6	3.3e-46
WP_102124610.1|1921558_1921813_-	Ig-like domain-containing protein	NA	G8FUY7	Pediococcus_virus	63.5	1.3e-15
WP_102124503.1|1921833_1922694_-|capsid	phage capsid protein	capsid	K4I067	Lactobacillus_virus	90.9	3.0e-144
WP_102124504.1|1922713_1923304_-	DUF4355 domain-containing protein	NA	Q597V6	Lactobacillus_virus	45.3	4.1e-20
WP_102124505.1|1923462_1924269_-|capsid	minor capsid protein	capsid	G8FUZ0	Pediococcus_virus	66.4	1.9e-100
WP_102124611.1|1924186_1925725_-|portal	phage portal protein	portal	G8FUZ1	Pediococcus_virus	66.2	7.6e-191
WP_102124506.1|1925751_1927041_-|terminase	PBSX family phage terminase large subunit	terminase	G8FUZ2	Pediococcus_virus	79.9	4.1e-206
WP_102124507.1|1927650_1928061_-	DUF2829 domain-containing protein	NA	A0A0S2MVC6	Bacillus_phage	48.2	1.5e-16
WP_102124508.1|1928100_1928856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102124509.1|1928931_1929549_-	DUF4145 domain-containing protein	NA	Q20DE2	Lactobacillus_phage	49.0	2.3e-53
WP_102124510.1|1930266_1930725_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	1.1e-39
WP_102124511.1|1931106_1931520_-	DUF1642 domain-containing protein	NA	A0A2K9V535	Lactobacillus_phage	66.4	2.1e-47
WP_102124512.1|1931530_1931782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102124513.1|1931924_1932305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102124514.1|1932301_1932820_-	hypothetical protein	NA	O03915	Lactobacillus_phage	65.8	2.3e-51
WP_102124515.1|1932824_1933547_-	phage antirepressor KilAC domain-containing protein	NA	Q8SDM9	Staphylococcus_phage	45.6	2.1e-50
WP_102124516.1|1933561_1933831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102124517.1|1933827_1934736_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_187345427.1|1934816_1935569_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	53.0	2.4e-73
WP_102124519.1|1935600_1936488_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.7	7.8e-63
WP_102124520.1|1936484_1936871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380632.1|1937003_1937141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056988483.1|1937231_1937477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024623923.1|1937489_1938005_-	hypothetical protein	NA	D6PST4	Lactobacillus_phage	38.6	1.7e-25
WP_011101083.1|1938251_1938482_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101082.1|1938654_1939017_+	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	2.6e-09
WP_102124521.1|1939028_1939442_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
WP_102124522.1|1939467_1940814_+	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	52.7	5.1e-82
WP_089178289.1|1940863_1941424_+	DUF5067 domain-containing protein	NA	Q6SEF8	Lactobacillus_prophage	65.9	4.6e-45
WP_102124523.1|1941478_1941814_+	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	52.2	2.4e-25
WP_102124524.1|1941986_1943255_+|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	42.2	1.1e-89
WP_063722960.1|1943367_1944720_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003642758.1|1944940_1945798_-	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_011101808.1|1946032_1947214_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	29.9	3.9e-46
1947081:1947096	attR	GAACTTGCCATTAACG	NA	NA	NA	NA
>prophage 7
NZ_CP025590	Lactiplantibacillus plantarum strain K259 chromosome, complete genome	3312096	2130303	2138814	3312096		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2130303_2130882_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_024002687.1|2130874_2131900_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	40.7	4.2e-60
WP_102124536.1|2131896_2133351_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.8	2.1e-49
WP_003645864.1|2133335_2135555_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_011101895.1|2135547_2136228_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2136227_2136482_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2136483_2137215_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642586.1|2137217_2138348_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2138331_2138814_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 8
NZ_CP025590	Lactiplantibacillus plantarum strain K259 chromosome, complete genome	3312096	2609064	2618115	3312096	transposase,bacteriocin	Streptococcus_phage(14.29%)	8	NA	NA
WP_046811086.1|2609064_2610177_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	3.0e-35
WP_044432279.1|2610312_2611647_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	1.8e-26
WP_063204300.1|2611841_2612171_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003642490.1|2612392_2613691_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_003643473.1|2614007_2615297_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	3.5e-72
WP_024272289.1|2615345_2616317_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.4e-137
WP_044429853.1|2616457_2616922_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.2	8.8e-18
WP_063204301.1|2617173_2618115_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.5	7.3e-19
