The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025586	Lactiplantibacillus plantarum strain KC3 chromosome, complete genome	3174864	59075	120347	3174864	tRNA,capsid,portal,integrase,protease,tail,terminase	Lactobacillus_phage(91.49%)	66	80589:80610	120406:120427
WP_011101383.1|59075_60764_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	1.2e-75
WP_011101382.1|61035_61482_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003643130.1|61870_62116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643131.1|62242_63634_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_102115940.1|63909_65685_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_003645241.1|66117_67857_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_102115491.1|68078_69035_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003645243.1|69024_69648_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.6	4.8e-27
WP_013355451.1|69650_70826_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.9	2.9e-49
WP_099739210.1|70803_72441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027822794.1|73329_75636_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011101376.1|75649_77506_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_102115492.1|77578_77938_+	YisL family protein	NA	NA	NA	NA	NA
WP_003643142.1|78038_78560_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003643143.1|78665_79679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825436.1|79843_80269_+	hypothetical protein	NA	NA	NA	NA	NA
80589:80610	attL	CCTGCCTGGGGCATAATTAGTC	NA	NA	NA	NA
WP_102115493.1|80831_81713_-	SH3 domain-containing protein	NA	A0A2P0ZLG2	Lactobacillus_phage	86.1	9.3e-117
WP_015380198.1|81712_81997_-	hypothetical protein	NA	A0A2P0ZLE8	Lactobacillus_phage	96.8	2.0e-41
WP_015380197.1|81996_82206_-	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	58.0	1.3e-08
WP_015380196.1|82211_82592_-	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	75.2	7.2e-50
WP_021357797.1|82608_83043_-	hypothetical protein	NA	A0A2P0ZLE9	Lactobacillus_phage	79.9	1.1e-57
WP_015380194.1|83044_83536_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	65.0	1.6e-49
WP_102115494.1|83564_87371_-	hypothetical protein	NA	A0A2P0ZLE1	Lactobacillus_phage	71.3	0.0e+00
WP_102115495.1|87390_88212_-|tail	phage tail protein	tail	A0A2P0ZLE2	Lactobacillus_phage	98.5	3.7e-152
WP_102115496.1|88215_92760_-|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	98.7	0.0e+00
WP_003643912.1|92778_93000_-	hypothetical protein	NA	A0A2P0ZLD9	Lactobacillus_phage	98.6	3.9e-32
WP_015380190.1|93023_93338_-	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	90.4	9.5e-48
WP_102115497.1|93430_94042_-|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	96.6	3.3e-105
WP_027822446.1|94056_94479_-	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	97.9	1.7e-71
WP_102115498.1|94475_94883_-	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	97.0	9.7e-69
WP_102115499.1|94879_95269_-	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	98.4	2.4e-69
WP_102115500.1|95692_96871_-|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	99.0	2.1e-217
WP_102115501.1|96891_97644_-|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	98.8	4.6e-133
WP_102115502.1|97630_98773_-|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	98.7	1.6e-214
WP_102115503.1|98791_100471_-|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	69.3	2.6e-229
WP_063722965.1|100467_100755_-|terminase	P27 family phage terminase small subunit	terminase	A0A2P0ZLC8	Lactobacillus_phage	67.4	7.6e-28
WP_015380179.1|100862_101114_-	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	91.6	3.9e-36
WP_015380178.1|101258_101501_-	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	82.5	9.5e-32
WP_102115504.1|101500_101839_-	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	92.0	3.4e-59
WP_015380177.1|101822_102038_-	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	87.3	1.4e-29
WP_015380176.1|102243_102813_-	YfbU family protein	NA	NA	NA	NA	NA
WP_015380175.1|102992_103682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380174.1|103757_104171_-	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	99.3	1.4e-70
WP_015380173.1|104182_104494_-	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	91.3	2.1e-47
WP_015380172.1|104630_105110_-	hypothetical protein	NA	A0A2P0ZL79	Lactobacillus_phage	93.2	2.7e-78
WP_015380170.1|105287_105620_-	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	95.5	3.7e-58
WP_015380169.1|105877_107152_-	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	97.4	4.8e-239
WP_015380168.1|107148_107943_-	bifunctional DNA primase/polymerase	NA	A0A2P0ZLB0	Lactobacillus_phage	85.6	7.1e-124
WP_015380167.1|108380_108935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102115505.1|108948_109572_-	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	98.4	1.6e-102
WP_102115506.1|109574_110291_-	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	98.6	7.8e-114
WP_043992724.1|110287_111664_-	DEAD/DEAH box helicase family protein	NA	A0A2P0ZLA5	Lactobacillus_phage	96.5	3.1e-236
WP_015380163.1|111663_112143_-	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	93.7	1.1e-79
WP_021730257.1|112245_112416_-	hypothetical protein	NA	A0A2P0ZLA6	Lactobacillus_phage	98.2	5.5e-26
WP_015380160.1|112387_112573_-	hypothetical protein	NA	A0A2P0ZLA3	Lactobacillus_phage	88.5	7.0e-27
WP_015380159.1|112565_112742_-	hypothetical protein	NA	A0A2P0ZLB1	Lactobacillus_phage	82.8	6.5e-22
WP_102115507.1|112722_113004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043993003.1|113118_113391_-	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	66.7	4.5e-30
WP_015380156.1|113456_113660_-	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	85.1	5.5e-25
WP_015380155.1|113663_113873_-	hypothetical protein	NA	A0A2P0ZL97	Lactobacillus_phage	98.6	1.6e-30
WP_015380154.1|114179_114569_+	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	97.6	1.5e-66
WP_003643876.1|114578_115010_+	hypothetical protein	NA	A0A2P0ZLA0	Lactobacillus_phage	100.0	7.6e-80
WP_015380153.1|115033_115474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115508.1|115561_116185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115509.1|116307_119046_+	SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	34.6	3.4e-141
WP_015380150.1|119216_120347_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	48.2	1.2e-92
120406:120427	attR	CCTGCCTGGGGCATAATTAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP025586	Lactiplantibacillus plantarum strain KC3 chromosome, complete genome	3174864	434836	477773	3174864	bacteriocin,tRNA,transposase	Lactobacillus_phage(50.0%)	35	NA	NA
WP_003641210.1|434836_435166_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003644074.1|435374_436043_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003644073.1|436174_436744_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011101234.1|436794_437559_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_027822805.1|437555_438806_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_013355322.1|438769_439771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641204.1|440190_440973_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641203.1|441307_441634_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003645740.1|441825_442707_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_016511043.1|442749_444558_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.1	1.0e-77
WP_003641200.1|444815_445013_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003644064.1|445232_445499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021355880.1|445549_446782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115567.1|446817_448224_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003641196.1|448676_449684_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.0	1.4e-63
WP_102115568.1|449722_451018_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	9.3e-57
WP_027822807.1|451187_451817_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_003641193.1|451925_452399_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021355876.1|452677_454567_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	8.9e-16
WP_003644058.1|454753_455680_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.1	1.9e-19
WP_003644057.1|455750_456302_-	helix-turn-helix domain-containing protein	NA	X2CXD8	Lactobacillus_phage	48.4	4.9e-07
WP_003644056.1|456401_457154_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003644055.1|457222_457717_-	kinase	NA	NA	NA	NA	NA
WP_003645748.1|457805_457925_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_015825257.1|462022_462553_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_027822811.1|463424_463943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072540428.1|464406_464955_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.3	9.1e-30
WP_077727009.1|464951_465161_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027822813.1|466529_469064_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.7	3.2e-69
WP_027822814.1|469186_471703_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_158649190.1|471785_472193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003561746.1|472300_473476_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_102115570.1|473589_475287_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_016385733.1|476625_477468_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.4e-157
WP_002816285.1|477521_477773_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
>prophage 3
NZ_CP025586	Lactiplantibacillus plantarum strain KC3 chromosome, complete genome	3174864	846991	903747	3174864	bacteriocin,tRNA,protease	uncultured_Mediterranean_phage(20.0%)	52	NA	NA
WP_003646511.1|846991_848263_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	4.5e-96
WP_003642042.1|848729_850343_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|850515_851124_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|851168_851609_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_015825146.1|851971_852904_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_187346395.1|852912_854271_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.5	6.8e-26
WP_015379810.1|854290_855100_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_015825144.1|855269_856256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379808.1|856338_857361_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|857649_858630_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_011101017.1|858995_859820_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003642031.1|860055_861438_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|861506_862343_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003646500.1|862698_863496_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|863488_864187_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_021356652.1|864453_865398_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027822749.1|865707_866574_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|866706_866958_-	Veg family protein	NA	NA	NA	NA	NA
WP_003642019.1|867062_867953_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011101014.1|867949_868513_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_102115613.1|868499_869276_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_015825140.1|869527_870016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102115614.1|870578_871469_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003643823.1|872918_874970_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_003646492.1|875291_875681_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_027822751.1|876275_877118_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_027822752.1|877117_877822_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_027821492.1|877843_878803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642009.1|878795_880070_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|880115_881033_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_102115615.1|881474_882488_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|882600_883347_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102115616.1|883496_884393_-	ROK family protein	NA	NA	NA	NA	NA
WP_003642002.1|884513_885950_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_003643816.1|885967_887323_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|887545_887968_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|887957_888146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102115617.1|888152_889514_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_027822756.1|889586_890297_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102115618.1|890702_891719_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015825133.1|892157_892934_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_015825132.1|893192_895502_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003646479.1|895791_896085_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	48.3	9.9e-07
WP_076630434.1|896096_896384_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_027822759.1|896534_897209_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_102115619.1|897302_897983_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027822761.1|898069_898738_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821500.1|898805_899495_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821501.1|899584_900961_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027821502.1|900977_903128_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	3.6e-45
WP_102115620.1|903393_903564_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_027822764.1|903588_903747_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
>prophage 4
NZ_CP025586	Lactiplantibacillus plantarum strain KC3 chromosome, complete genome	3174864	1526337	1534625	3174864	bacteriocin	Planktothrix_phage(16.67%)	7	NA	NA
WP_027822312.1|1526337_1527279_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.5	2.1e-18
WP_187346396.1|1527371_1528343_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.8e-137
WP_015381012.1|1528391_1529681_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	3.5e-72
WP_003645480.1|1529997_1531296_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_102115699.1|1531518_1531848_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_015381010.1|1532042_1533377_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	7.9e-27
WP_054519129.1|1533512_1534625_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	1.3e-35
>prophage 5
NZ_CP025586	Lactiplantibacillus plantarum strain KC3 chromosome, complete genome	3174864	2012715	2021226	3174864		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|2012715_2013198_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_102115770.1|2013181_2014312_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|2014314_2015046_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642588.1|2015047_2015302_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_015380736.1|2015301_2015982_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_021356102.1|2015974_2018194_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
WP_027822324.1|2018178_2019633_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.8	7.3e-50
WP_015380733.1|2019629_2020655_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
WP_003645867.1|2020647_2021226_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 6
NZ_CP025586	Lactiplantibacillus plantarum strain KC3 chromosome, complete genome	3174864	2183213	2275157	3174864	transposase,head,capsid,holin,portal,integrase,tail,terminase	Lactobacillus_phage(52.5%)	99	2215049:2215070	2273141:2273157
WP_102115792.1|2183213_2183989_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_102115793.1|2184202_2185393_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003642741.1|2185616_2185847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642742.1|2185872_2186094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380658.1|2186240_2186705_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015380657.1|2186926_2187820_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_015380656.1|2187886_2188750_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003642746.1|2189311_2189476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642747.1|2189534_2190278_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003642748.1|2190383_2191571_+	MFS transporter	NA	NA	NA	NA	NA
WP_003644671.1|2191784_2192102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642750.1|2192177_2192738_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_011101810.1|2193494_2194433_-	EamA family transporter	NA	NA	NA	NA	NA
WP_015380652.1|2194629_2194899_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_027822570.1|2194908_2196252_+	PFL family protein	NA	NA	NA	NA	NA
WP_003646617.1|2196624_2197353_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.1e-34
WP_003642756.1|2197349_2198873_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011101808.1|2199168_2200350_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	29.9	3.9e-46
WP_003642758.1|2200584_2201442_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_003642759.1|2201661_2203014_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003646619.1|2203439_2203631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642761.1|2204035_2206030_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
WP_102115794.1|2206047_2207625_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_054519139.1|2207596_2209360_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.9	6.2e-96
WP_003639252.1|2210300_2210444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101805.1|2210802_2210946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115796.1|2211500_2212676_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_102115797.1|2212681_2213638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642771.1|2213692_2214178_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015380646.1|2214226_2214499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642773.1|2214523_2214757_-	hypothetical protein	NA	NA	NA	NA	NA
2215049:2215070	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_027822564.1|2215247_2216405_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.5	2.3e-54
2215049:2215070	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_050480169.1|2216475_2217189_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027822563.1|2217335_2217515_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027823049.1|2217784_2218012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054519349.1|2218025_2218826_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_027823041.1|2220365_2220845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027823040.1|2220859_2221051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054519350.1|2221037_2221376_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	36.6	1.9e-09
WP_027822995.1|2221368_2221758_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	3.0e-19
WP_099746273.1|2222452_2222926_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_102115798.1|2222922_2224626_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.3	1.4e-121
WP_054519337.1|2224780_2225881_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.6	1.0e-48
WP_102115799.1|2225877_2227419_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.1	1.1e-45
WP_027823052.1|2227828_2228098_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_024971530.1|2228255_2228627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380645.1|2229431_2229638_+	hypothetical protein	NA	NA	NA	NA	NA
2229104:2229125	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_102115800.1|2229988_2231110_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.7	9.9e-47
2229104:2229125	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_063490409.1|2231229_2232057_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_102115801.1|2232059_2232854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080396925.1|2233213_2233390_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	9.1e-08
WP_102115802.1|2233578_2234505_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_080474029.1|2234604_2235030_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	46.8	6.2e-26
WP_063491280.1|2235026_2235374_-	helix-turn-helix domain-containing protein	NA	A8ASM2	Listeria_phage	38.7	1.7e-10
WP_097567578.1|2235531_2235735_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046811050.1|2235984_2236290_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_024971536.1|2236357_2236870_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	43.5	2.1e-28
WP_165836133.1|2236979_2237126_+	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	87.2	7.5e-16
WP_102115804.1|2237379_2237766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115805.1|2237762_2238662_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.7	7.9e-63
WP_187346398.1|2238693_2239446_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.2	5.6e-70
WP_102115807.1|2239526_2240435_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_064578077.1|2240431_2240719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050339755.1|2240715_2241438_+	phage antirepressor KilAC domain-containing protein	NA	Q8SDM9	Staphylococcus_phage	45.6	2.8e-50
WP_102115808.1|2241442_2241961_+	hypothetical protein	NA	O03915	Lactobacillus_phage	52.0	4.7e-36
WP_046947681.1|2241957_2242338_+	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_003642805.1|2242549_2243011_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_024971547.1|2243772_2244642_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	51.4	8.9e-80
WP_064523284.1|2244657_2245929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115809.1|2246384_2246837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187346401.1|2246926_2247268_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	63.0	8.0e-08
WP_102115810.1|2247315_2247876_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	87.0	1.7e-60
WP_102115811.1|2247856_2249182_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	55.7	7.6e-139
WP_158649191.1|2249184_2250780_+|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	38.0	9.9e-85
WP_158649192.1|2250772_2251858_+	hypothetical protein	NA	A0A059T7W2	Listeria_phage	30.7	3.6e-38
WP_102115814.1|2251921_2252524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115815.1|2252537_2253485_+|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	59.1	3.3e-88
WP_074028508.1|2253573_2253834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115816.1|2253844_2254249_+	hypothetical protein	NA	A5GYM1	Lactococcus_phage	27.5	5.7e-05
WP_065980405.1|2254249_2254639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060684038.1|2254635_2255037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060684037.1|2255036_2255462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486493.1|2255479_2256097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115817.1|2256215_2256734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115818.1|2256730_2257372_+	hypothetical protein	NA	O03936	Lactobacillus_phage	25.9	7.4e-07
WP_102115819.1|2257387_2263018_+|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	24.4	1.6e-20
WP_063486497.1|2263018_2263837_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_102115820.1|2263848_2264976_+|tail	phage tail protein	tail	O03938	Lactobacillus_phage	41.9	1.4e-72
WP_102115821.1|2264968_2265214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187346382.1|2265191_2265482_+	hypothetical protein	NA	O03939	Lactobacillus_phage	68.8	2.7e-12
WP_187346383.1|2265482_2268035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115822.1|2268057_2269437_+	hypothetical protein	NA	A0A1I9KKB6	Lactobacillus_phage	52.3	1.7e-32
WP_102115823.1|2269426_2269672_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	76.9	7.9e-18
WP_102115824.1|2269683_2270886_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	84.5	7.8e-191
WP_102115825.1|2270886_2271183_+	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	70.4	4.6e-36
WP_102115826.1|2271169_2271544_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	72.5	2.2e-19
WP_102115827.1|2271672_2272647_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_102115828.1|2273344_2274196_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_086989537.1|2274382_2275157_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 7
NZ_CP025586	Lactiplantibacillus plantarum strain KC3 chromosome, complete genome	3174864	2560864	2632390	3174864	tRNA,transposase,head,capsid,holin,portal,integrase,protease,tail,terminase	Lactobacillus_phage(75.51%)	83	2553917:2553934	2625360:2625377
2553917:2553934	attL	ATGGAAAAAGCCGTTGAC	NA	NA	NA	NA
WP_027822544.1|2560864_2562028_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.7	3.2e-56
WP_027822546.1|2563075_2563258_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	66.7	8.8e-14
WP_003641358.1|2563563_2563764_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_027822547.1|2563778_2564657_-	HIRAN domain-containing protein	NA	A0A2H4J549	uncultured_Caudovirales_phage	34.8	2.3e-06
WP_102115950.1|2564719_2565109_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	53.5	1.3e-35
WP_003641361.1|2565139_2565466_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	44.1	6.9e-17
WP_003644552.1|2565722_2565938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027823017.1|2566808_2567060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187346385.1|2567125_2567833_+	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	59.1	3.6e-63
WP_102115951.1|2567863_2568049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027823020.1|2568014_2568458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027823021.1|2568516_2568777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016058357.1|2568919_2569099_+	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	100.0	2.2e-25
WP_033608473.1|2569132_2569372_+	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	83.5	4.5e-34
WP_102115852.1|2569383_2569608_+	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	87.7	2.0e-28
WP_182995434.1|2569656_2569827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027823029.1|2569926_2570337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027823028.1|2570339_2570987_+	ERF family protein	NA	D6PSU1	Lactobacillus_phage	57.7	3.3e-63
WP_027823027.1|2570983_2571388_+	single-stranded DNA-binding protein	NA	D6PSU2	Lactobacillus_phage	64.2	3.1e-43
WP_102115853.1|2571402_2572095_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	88.3	1.2e-116
WP_050480189.1|2572118_2572676_+	HNH endonuclease	NA	X2KXT0	Enterococcus_phage	50.5	1.4e-22
WP_102115854.1|2573453_2574239_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	89.7	5.0e-130
WP_102115855.1|2574374_2574683_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	87.3	4.8e-44
WP_027822853.1|2574736_2574892_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	81.1	8.0e-08
WP_022638818.1|2575073_2575499_+	phage transcriptional activator RinA	NA	E9LUP5	Lactobacillus_phage	81.6	3.1e-62
WP_102115857.1|2576408_2577590_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_158649193.1|2577706_2578057_+	DUF4145 domain-containing protein	NA	Q20DE2	Lactobacillus_phage	53.9	1.8e-31
WP_102115859.1|2578128_2578443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187326329.1|2578426_2578582_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	95.7	1.7e-18
WP_027822818.1|2578565_2579108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027822819.1|2579110_2579623_+	HNH endonuclease	NA	A8YQN7	Lactobacillus_phage	55.0	2.4e-48
WP_033617798.1|2580020_2580488_+|terminase	phage terminase small subunit P27 family	terminase	Q6J1Y7	Lactobacillus_phage	48.7	4.5e-38
WP_102115861.1|2580474_2582361_+|terminase	terminase large subunit	terminase	Q6J1Y6	Lactobacillus_phage	69.7	6.1e-267
WP_027822822.1|2582375_2582561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027822823.1|2582567_2583716_+|portal	phage portal protein	portal	Q6J1Y4	Lactobacillus_phage	65.7	1.2e-145
WP_129142208.1|2583675_2584401_+|protease	Clp protease ClpP	protease	Q6J1Y3	Lactobacillus_phage	60.8	1.4e-70
WP_102115862.1|2584403_2585546_+|capsid	phage major capsid protein	capsid	Q6J1Y2	Lactobacillus_phage	61.1	1.9e-117
WP_027822826.1|2585680_2586043_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6J1Y1	Lactobacillus_phage	53.2	5.5e-23
WP_158649194.1|2586005_2586347_+|head	phage head closure protein	head	Q9AZM0	Lactococcus_phage	39.6	2.8e-13
WP_027822828.1|2586352_2586739_+	HK97 gp10 family phage protein	NA	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	38.3	2.6e-15
WP_027822829.1|2586740_2587115_+	DUF806 family protein	NA	Q8LTK5	Lactococcus_phage	41.4	4.6e-17
WP_027822830.1|2587129_2587798_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	66.0	2.8e-73
WP_027822831.1|2587870_2588251_+	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	41.2	1.8e-13
WP_027822832.1|2588268_2588478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102115864.1|2588505_2593911_+|tail	phage tail tape measure protein	tail	A0A2H4PBB0	Lactobacillus_phage	33.9	3.5e-121
WP_102115865.1|2593986_2595759_+|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	92.4	3.2e-310
WP_102115866.1|2595824_2598239_+|tail	phage tail protein	tail	A0A2P0ZLF8	Lactobacillus_phage	92.9	0.0e+00
WP_027822923.1|2598255_2600757_+	hypothetical protein	NA	E9LUR4	Lactobacillus_phage	69.8	5.3e-250
WP_027822926.1|2600749_2600992_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	91.2	5.2e-30
WP_187326334.1|2600995_2601157_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	90.6	5.7e-17
WP_027822927.1|2601140_2602172_+	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	87.1	7.6e-62
WP_027822928.1|2602168_2602414_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	70.5	1.8e-17
WP_102115867.1|2602425_2603598_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	88.7	5.4e-197
WP_003644510.1|2603597_2603861_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_064578172.1|2603873_2604251_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	63.8	3.7e-14
WP_102115868.1|2605494_2606706_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_102115869.1|2607184_2608927_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003645638.1|2608945_2609737_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
WP_003644505.1|2609717_2610902_+	LCP family protein	NA	NA	NA	NA	NA
WP_013356280.1|2611125_2612352_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.3	1.1e-88
WP_003645636.1|2612711_2613284_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003645635.1|2613983_2614925_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	48.7	3.1e-78
WP_015640487.1|2615370_2615763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003645633.1|2615926_2616319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578176.1|2616354_2617524_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003645631.1|2617573_2618203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197934.1|2618506_2618737_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003640747.1|2618826_2619459_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_003644501.1|2619610_2619850_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640745.1|2619947_2620184_+	YneF family protein	NA	NA	NA	NA	NA
WP_003645630.1|2620240_2620876_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_102115870.1|2620987_2621746_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003645628.1|2621729_2622035_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003640741.1|2622119_2623118_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_003640740.1|2623407_2624130_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640739.1|2624354_2625158_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003644498.1|2625260_2626139_+	elongation factor Ts	NA	NA	NA	NA	NA
2625360:2625377	attR	ATGGAAAAAGCCGTTGAC	NA	NA	NA	NA
WP_003640737.1|2626338_2627061_+	UMP kinase	NA	NA	NA	NA	NA
WP_003640736.1|2627062_2627626_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640735.1|2627745_2628525_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640734.1|2628540_2629326_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640733.1|2629363_2630641_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640732.1|2630680_2632390_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP025588	Lactiplantibacillus plantarum strain KC3 plasmid unnamed2, complete sequence	27858	18608	26485	27858	transposase	Enterobacteria_phage(50.0%)	9	NA	NA
WP_102115989.1|18608_19556_-	SDR family NAD(P)-dependent oxidoreductase	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	35.5	8.9e-41
WP_102115990.1|19573_20347_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_102115991.1|20333_21062_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_102115992.1|21072_21843_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_057785044.1|22042_22879_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.8	5.5e-34
WP_102115993.1|22911_23940_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.8	1.2e-70
WP_003644155.1|23949_24531_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.1	4.3e-38
WP_021730701.1|24534_25404_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	59.7	1.7e-99
WP_102115994.1|25555_26485_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	5.5e-51
>prophage 1
NZ_CP025589	Lactiplantibacillus plantarum strain KC3 plasmid unnamed3, complete sequence	55784	6912	20215	55784	tail,holin	Lactobacillus_phage(88.89%)	10	NA	NA
WP_102115998.1|6912_8685_+|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	96.1	0.0e+00
WP_102115999.1|8750_11165_+	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	92.3	0.0e+00
WP_102116000.1|11182_14305_+	hypothetical protein	NA	A0A2P0ZLG5	Lactobacillus_phage	80.9	1.9e-26
WP_102116001.1|14297_14549_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	95.8	5.4e-30
WP_003641410.1|14552_14714_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	4.7e-19
WP_102116002.1|15209_15719_+	hypothetical protein	NA	A0A0A7NQU6	Lactobacillus_phage	66.4	1.6e-44
WP_102116003.1|16731_16995_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	88.5	1.3e-34
WP_102116004.1|17006_17345_+|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	78.3	1.9e-30
WP_102116005.1|18106_18580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054719880.1|19426_20215_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	36.6	4.7e-35
>prophage 2
NZ_CP025589	Lactiplantibacillus plantarum strain KC3 plasmid unnamed3, complete sequence	55784	27905	54222	55784	portal,tail,terminase,holin,head,capsid	Lactobacillus_phage(85.0%)	23	NA	NA
WP_102116016.1|27905_28349_+|terminase	phage terminase small subunit P27 family	terminase	A0A0M7REI3	Lactobacillus_phage	40.0	3.5e-24
WP_102116017.1|28338_30258_+|terminase	terminase large subunit	terminase	A0A2I6QQZ9	Streptococcus_phage	39.8	1.5e-116
WP_102116018.1|30280_30466_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_102116027.1|30504_31629_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	42.9	4.9e-70
WP_102116019.1|31594_33442_+|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	90.9	5.3e-255
WP_102116020.1|33571_33862_+	hypothetical protein	NA	A0A2P0ZLF2	Lactobacillus_phage	84.4	1.5e-39
WP_102116021.1|33862_34210_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	96.5	1.2e-56
WP_102116022.1|34212_34620_+	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	93.2	5.9e-66
WP_102116023.1|34619_35000_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	92.1	3.4e-60
WP_102116024.1|35015_35666_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	91.9	1.4e-106
WP_102115996.1|35740_36115_+|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	92.7	7.8e-57
WP_102115997.1|36159_36345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102116025.1|36385_40843_+	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	73.3	0.0e+00
WP_102115998.1|40919_42692_+|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	96.1	0.0e+00
WP_102115999.1|42757_45172_+	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	92.3	0.0e+00
WP_102116000.1|45189_48312_+	hypothetical protein	NA	A0A2P0ZLG5	Lactobacillus_phage	80.9	1.9e-26
WP_102116001.1|48304_48556_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	95.8	5.4e-30
WP_003641410.1|48559_48721_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	4.7e-19
WP_102116002.1|49216_49726_+	hypothetical protein	NA	A0A0A7NQU6	Lactobacillus_phage	66.4	1.6e-44
WP_102116003.1|50738_51002_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	88.5	1.3e-34
WP_102116004.1|51013_51352_+|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	78.3	1.9e-30
WP_102116005.1|52113_52587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054719880.1|53433_54222_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	36.6	4.7e-35
