The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013847	Clostridium botulinum strain Af650 chromosome, complete genome	4116856	1685572	1708298	4116856	protease,terminase,capsid,integrase,portal	Clostridium_phage(52.38%)	50	1681021:1681036	1692696:1692711
1681021:1681036	attL	GTAGCTAATAATTTTT	NA	NA	NA	NA
WP_012704184.1|1685572_1686622_-|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	62.6	3.2e-124
WP_012704567.1|1686608_1686830_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012704128.1|1687016_1687379_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012705054.1|1687824_1688025_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012704859.1|1688025_1688727_+	phage regulatory protein	NA	A0A0A7RVQ9	Clostridium_phage	68.9	3.3e-40
WP_012704391.1|1688727_1688889_+	hypothetical protein	NA	Q8SBM7	Clostridium_phage	62.7	1.4e-10
WP_012703859.1|1688901_1689042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705376.1|1689044_1689239_+	hypothetical protein	NA	A0A143FMG3	Bacillus_phage	56.9	8.5e-07
WP_012705140.1|1689254_1689452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704628.1|1689465_1689609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012703798.1|1689601_1689769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705491.1|1689771_1690029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704844.1|1690216_1690528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704008.1|1690527_1690749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705584.1|1690881_1691379_+	hypothetical protein	NA	A0A0A7S0G6	Clostridium_phage	51.5	8.8e-40
WP_012704670.1|1691378_1692008_+	ERF family protein	NA	A0A0F6N3I5	Staphylococcus_phage	39.1	5.7e-36
WP_012703716.1|1692009_1692294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705739.1|1692304_1693192_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A0A7RTL4	Clostridium_phage	65.1	4.3e-61
1692696:1692711	attR	AAAAATTATTAGCTAC	NA	NA	NA	NA
WP_164474722.1|1693328_1693892_+	ATP-binding protein	NA	M9Q1J4	Clostridium_phage	48.7	4.5e-40
WP_012704502.1|1693904_1694459_+	hypothetical protein	NA	Q332D2	Clostridium_botulinum_C_phage	48.4	3.1e-41
WP_012703931.1|1694461_1694650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705734.1|1694661_1694940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061322182.1|1694987_1695707_+	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	43.0	5.2e-49
WP_061322184.1|1695746_1696100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061322187.1|1696113_1696578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043002756.1|1696678_1696867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043002755.1|1696876_1697245_+	hypothetical protein	NA	A0A0A7RVR5	Clostridium_phage	41.2	3.4e-20
WP_061322191.1|1697254_1697656_+	hypothetical protein	NA	F8J189	Lactobacillus_virus	42.6	2.9e-17
WP_021106464.1|1697655_1697982_+	hypothetical protein	NA	A0A0A7RWJ7	Clostridium_phage	46.6	2.1e-18
WP_021106465.1|1697992_1698151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021106466.1|1698294_1698459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021106467.1|1698442_1698658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061322193.1|1698658_1699174_+	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	59.6	1.4e-48
WP_154219898.1|1699219_1699393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021106469.1|1699501_1699771_+	DUF1599 domain-containing protein	NA	A0A2H4J4N1	uncultured_Caudovirales_phage	75.0	8.1e-32
WP_021106470.1|1699770_1700154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021106471.1|1700176_1700473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154695007.1|1700889_1701054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021106473.1|1701066_1701516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021106474.1|1701526_1701712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021106475.1|1701726_1702011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021106476.1|1702028_1702319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021106477.1|1702330_1702534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021106478.1|1702733_1703120_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JAK7	uncultured_Caudovirales_phage	67.7	3.3e-42
WP_021106479.1|1703135_1704827_+|terminase	terminase large subunit	terminase	A0A2H4JAJ4	uncultured_Caudovirales_phage	57.3	1.3e-186
WP_154695008.1|1704823_1704997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080309901.1|1705067_1706234_+|portal	phage portal protein	portal	A6M949	Geobacillus_virus	47.5	3.1e-96
WP_033049484.1|1706223_1706907_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	55.9	7.1e-64
WP_021106482.1|1706947_1708132_+|capsid	phage major capsid protein	capsid	Q2I8F7	Bacillus_phage	43.2	1.0e-78
WP_154695009.1|1708142_1708298_+	hypothetical protein	NA	A0A0A7RUQ9	Clostridium_phage	56.8	9.8e-06
>prophage 2
NZ_CP013847	Clostridium botulinum strain Af650 chromosome, complete genome	4116856	1712736	1723376	4116856	bacteriocin,plate,tail	Clostridium_phage(62.5%)	16	NA	NA
WP_061332124.1|1712736_1715367_+|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	36.1	3.1e-35
WP_012705686.1|1715413_1715845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012703984.1|1715844_1716777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704547.1|1716787_1717105_+	DUF2577 family protein	NA	NA	NA	NA	NA
WP_012705449.1|1717116_1717554_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_012705663.1|1717565_1718675_+|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	33.5	9.8e-39
WP_012705196.1|1718686_1719217_+	DUF2313 domain-containing protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	22.0	7.5e-05
WP_012704076.1|1720049_1720355_+	hypothetical protein	NA	J9QEB9	Clostridium_phage	37.0	5.6e-05
WP_012705345.1|1720370_1720556_+	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	69.6	6.0e-10
WP_012704941.1|1720643_1720847_+|bacteriocin	bacteriocin UviB	bacteriocin	NA	NA	NA	NA
WP_012704333.1|1720848_1721022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704505.1|1721064_1721823_+	N-acetylmuramoyl-L-alanine amidase	NA	I1TJX3	Clostridium_phage	60.9	1.5e-51
WP_021106503.1|1721971_1722112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704407.1|1722286_1722469_+	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	63.2	2.9e-09
WP_012703802.1|1722479_1722725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705355.1|1722869_1723376_+	hypothetical protein	NA	A0A0A7S0D9	Clostridium_phage	63.1	4.2e-21
>prophage 3
NZ_CP013847	Clostridium botulinum strain Af650 chromosome, complete genome	4116856	1824993	1833194	4116856	protease	uncultured_phage(33.33%)	9	NA	NA
WP_012705299.1|1824993_1825938_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.1	3.2e-14
WP_012704832.1|1826552_1827548_+	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_012704794.1|1827664_1828426_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_011949100.1|1828443_1828875_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	32.4	4.0e-12
WP_011949101.1|1828876_1829542_+	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	44.1	1.7e-38
WP_003358544.1|1829545_1830136_+	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	54.5	9.8e-46
WP_012704981.1|1830319_1830979_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	51.2	2.3e-59
WP_012704400.1|1831272_1832091_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012099663.1|1832237_1833194_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	7.7e-16
>prophage 4
NZ_CP013847	Clostridium botulinum strain Af650 chromosome, complete genome	4116856	2061053	2145100	4116856	protease,capsid,terminase,head,integrase,portal,tail	Clostridium_phage(56.25%)	86	2102953:2103012	2145240:2145337
WP_101526862.1|2061053_2061512_-|protease	hydrogenase maturation protease	protease	NA	NA	NA	NA
WP_003359027.1|2061502_2062918_-	nickel-dependent hydrogenase large subunit	NA	NA	NA	NA	NA
WP_003358860.1|2063019_2063892_-	hydrogenase small subunit	NA	NA	NA	NA	NA
WP_012704847.1|2064159_2064861_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_162262983.1|2065287_2065449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012703727.1|2066124_2069331_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_012705483.1|2069358_2070408_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.3	2.3e-58
WP_162024668.1|2070929_2071091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003358863.1|2072558_2072759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705684.1|2072959_2074516_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.3e-52
WP_012705347.1|2074877_2076611_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_101526863.1|2076630_2078526_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_003359083.1|2078537_2079017_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_012705484.1|2079491_2080679_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003358887.1|2080938_2081817_-	ADP-ribosylglycohydrolase family protein	NA	G3M9X5	Bacillus_virus	40.6	2.7e-52
WP_003359094.1|2082056_2083151_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012704920.1|2083260_2084397_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	31.6	2.2e-22
WP_003358993.1|2084580_2085093_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_003358933.1|2085160_2085601_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_003358977.1|2085661_2086243_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	6.9e-20
WP_003358854.1|2086235_2086982_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.8	1.7e-07
WP_003359065.1|2087758_2088982_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.6	3.8e-36
WP_003358846.1|2089104_2089827_-	EcsC family protein	NA	NA	NA	NA	NA
WP_021107022.1|2089985_2091044_-	endonuclease/exonuclease/phosphatase	NA	NA	NA	NA	NA
WP_003359091.1|2091185_2091434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703822.1|2091540_2092845_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	56.1	1.2e-128
WP_003359005.1|2093130_2093946_-	purine-nucleoside phosphorylase	NA	Q5YFI9	Singapore_grouper_iridovirus	42.2	8.7e-61
WP_012705197.1|2093983_2094859_-	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	26.5	1.0e-14
WP_003359007.1|2094910_2095138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003358910.1|2095128_2095782_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003362492.1|2095988_2096525_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012705366.1|2097018_2098545_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_003359052.1|2099360_2100119_-	C40 family peptidase	NA	A0A0A7RU71	Clostridium_phage	72.3	3.8e-42
WP_003358823.1|2102153_2102732_-	hypothetical protein	NA	NA	NA	NA	NA
2102953:2103012	attL	CAAACCCTATTTTTTAACCTTAATTTATCAGCTACCATTGCAATAAACTCAGAATTTGTT	NA	NA	NA	NA
WP_012705293.1|2103410_2103998_-	DUF4352 domain-containing protein	NA	A0A0A7RUM7	Clostridium_phage	36.5	1.7e-10
WP_012705176.1|2104126_2104885_-	N-acetylmuramoyl-L-alanine amidase	NA	I1TJX3	Clostridium_phage	58.2	1.3e-50
WP_012705751.1|2104884_2105058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003360661.1|2105059_2105284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704217.1|2105495_2105975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704975.1|2106223_2106631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012705464.1|2106725_2106893_-	hypothetical protein	NA	A0A2H4J054	uncultured_Caudovirales_phage	77.4	2.3e-16
WP_012704570.1|2106894_2107221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704526.1|2107232_2108690_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	43.3	5.6e-50
WP_012704988.1|2108696_2109854_-	hypothetical protein	NA	A0A0C5AMZ5	Paenibacillus_phage	34.4	2.2e-65
WP_012705696.1|2109857_2110727_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	40.3	2.0e-47
WP_012705149.1|2110742_2114669_-|tail	phage tail tape measure protein	tail	M1PKM6	Streptococcus_phage	52.0	2.7e-91
WP_012703799.1|2114958_2115351_-	hypothetical protein	NA	A0A0A7RUF5	Clostridium_phage	64.8	5.5e-37
WP_012705635.1|2115408_2115990_-|tail	tail protein	tail	A0A0A7RUI3	Clostridium_phage	73.2	1.5e-78
WP_012705429.1|2116053_2116410_-	hypothetical protein	NA	A0A0A7S158	Clostridium_phage	81.9	1.3e-48
WP_012703894.1|2116425_2116785_-	hypothetical protein	NA	A0A0A7RUF1	Clostridium_phage	83.8	8.3e-48
WP_012704283.1|2116785_2117154_-|head	phage head closure protein	head	A0A0A7RUH8	Clostridium_phage	63.8	1.4e-34
WP_012704655.1|2117143_2117437_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7RWM0	Clostridium_phage	41.3	4.1e-13
WP_012705399.1|2117521_2118754_-|capsid	phage major capsid protein	capsid	Q0SPK4	Clostridium_phage	50.0	1.1e-94
WP_012705608.1|2118806_2119550_-|protease	Clp protease ClpP	protease	A0A0A7RUD3	Clostridium_phage	76.3	3.1e-97
WP_012705476.1|2119542_2120793_-|portal	phage portal protein	portal	A0A0A7RUE7	Clostridium_phage	80.1	4.9e-188
WP_041173655.1|2120836_2121019_-	hypothetical protein	NA	A0A0A7RUH2	Clostridium_phage	72.2	1.7e-12
WP_012704297.1|2121042_2122761_-|terminase	terminase large subunit	terminase	A0A0A7RWL3	Clostridium_phage	92.1	0.0e+00
WP_012703719.1|2122753_2123215_-|terminase	phage terminase small subunit P27 family	terminase	A0A0A7S147	Clostridium_phage	58.4	7.4e-41
WP_041173628.1|2123350_2123818_-	HNH endonuclease	NA	Q0SPJ9	Clostridium_phage	43.3	6.4e-24
WP_012705034.1|2123822_2123987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704565.1|2124064_2125396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704890.1|2125582_2126143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704566.1|2126312_2126534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703768.1|2126549_2127962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703990.1|2128003_2128213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705579.1|2128288_2128609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705522.1|2128659_2128914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704854.1|2128987_2129509_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012703712.1|2129903_2130341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705714.1|2130372_2131050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704962.1|2131352_2134247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705325.1|2134365_2134530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704884.1|2134887_2136024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704284.1|2136068_2137022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041173656.1|2137092_2137518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703708.1|2137949_2138108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705501.1|2138497_2138716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704862.1|2138836_2139493_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003362255.1|2139624_2139783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703958.1|2139775_2140105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003362257.1|2140384_2140588_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012703833.1|2140711_2142133_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012705553.1|2142213_2142438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705233.1|2142488_2143172_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_012705705.1|2143619_2144108_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012705291.1|2144107_2145100_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	26.8	4.5e-11
2145240:2145337	attR	CAAACCCTATTTTTTAACCTTAATTTATCAGCTACCATTGCAATAAACTCAGAATTTGTTGGTTTTCCCTTCCCATTATTTATAGTATACCCAAATAT	NA	NA	NA	NA
>prophage 5
NZ_CP013847	Clostridium botulinum strain Af650 chromosome, complete genome	4116856	2565788	2614259	4116856	tail,capsid,terminase,integrase,portal,plate	Clostridium_phage(37.74%)	81	2589925:2589942	2611340:2611357
WP_041173633.1|2565788_2566337_-	hypothetical protein	NA	A0A0A7RVQ5	Clostridium_phage	39.2	7.2e-19
WP_012705094.1|2566348_2567338_-	hypothetical protein	NA	A0A0A7S0A3	Clostridium_phage	38.2	4.2e-33
WP_012704593.1|2567585_2568347_-	N-acetylmuramoyl-L-alanine amidase	NA	I1TJX3	Clostridium_phage	56.8	3.4e-51
WP_012705426.1|2568384_2568579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705558.1|2568595_2568850_-	hemolysin XhlA family protein	NA	A0A0A7RTX0	Clostridium_phage	68.4	4.1e-25
WP_012704381.1|2568956_2569118_-	hypothetical protein	NA	A0A0A8WJT8	Clostridium_phage	60.0	3.1e-10
WP_012703739.1|2569117_2569414_-	hypothetical protein	NA	J9QEB9	Clostridium_phage	46.5	1.3e-14
WP_012705275.1|2569429_2570596_-|tail	phage tail protein	tail	A0A0A7RTQ0	Clostridium_phage	55.8	3.0e-62
WP_012705217.1|2570598_2571234_-	YmfQ family protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	65.6	5.0e-72
WP_012704534.1|2571230_2572361_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J7K8	uncultured_Caudovirales_phage	63.6	5.9e-124
WP_012703968.1|2572366_2572819_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	76.3	1.6e-64
WP_012704540.1|2572811_2573144_-	hypothetical protein	NA	A0A2H4J746	uncultured_Caudovirales_phage	68.9	1.3e-34
WP_012703953.1|2573127_2574096_-	hypothetical protein	NA	A0A2H4J063	uncultured_Caudovirales_phage	65.3	9.5e-115
WP_025775143.1|2574095_2574749_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J045	uncultured_Caudovirales_phage	68.3	2.2e-59
WP_012704756.1|2574815_2575328_-	hypothetical protein	NA	A0A2H4J333	uncultured_Caudovirales_phage	56.0	1.2e-28
WP_012704001.1|2575381_2578360_-|tail	phage tail tape measure protein	tail	A0A2H4J055	uncultured_Caudovirales_phage	51.2	1.0e-215
WP_003385475.1|2578542_2578977_-	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	74.8	1.1e-54
WP_003385476.1|2579000_2579411_-|tail	phage tail tube protein	tail	A0A2H4J032	uncultured_Caudovirales_phage	86.5	8.8e-62
WP_012704871.1|2579423_2580830_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4J1N7	uncultured_Caudovirales_phage	80.3	1.1e-225
WP_012705505.1|2580829_2581021_-	hypothetical protein	NA	A0A2H4J7J8	uncultured_Caudovirales_phage	72.6	5.2e-17
WP_003385479.1|2581031_2581853_-	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	74.7	4.9e-120
WP_012704241.1|2581855_2582263_-	hypothetical protein	NA	A0A2H4J736	uncultured_Caudovirales_phage	70.1	2.4e-51
WP_012704063.1|2582264_2582651_-	hypothetical protein	NA	A0A2H4J057	uncultured_Caudovirales_phage	65.4	1.9e-42
WP_012704263.1|2582651_2582972_-	hypothetical protein	NA	A0A2H4J040	uncultured_Caudovirales_phage	57.4	3.9e-25
WP_003385482.1|2582974_2583166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705425.1|2583222_2584275_-|capsid	major capsid protein	capsid	D9ZND6	Clostridium_phage	50.6	1.8e-87
WP_012704375.1|2584288_2584681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704542.1|2584701_2585316_-	phage scaffold protein	NA	A0A0A7RW68	Clostridium_phage	35.8	3.8e-24
WP_003385486.1|2585382_2585526_-	hypothetical protein	NA	A0A2H4J726	uncultured_Caudovirales_phage	79.5	3.8e-12
WP_012705730.1|2585531_2587190_-	exonuclease SbcC	NA	A0A2H4J048	uncultured_Caudovirales_phage	64.7	1.0e-193
WP_012705544.1|2587189_2588716_-|portal	phage portal protein	portal	D9ZNC8	Clostridium_phage	53.1	7.9e-140
WP_012704181.1|2588715_2590071_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	64.5	2.4e-156
2589925:2589942	attL	TTTTTCTTCTAATAGTTT	NA	NA	NA	NA
WP_012704107.1|2590070_2590778_-	hypothetical protein	NA	A0A0A8WFS6	Clostridium_phage	51.1	7.1e-51
WP_012705283.1|2590873_2591113_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012704091.1|2591228_2591447_-	hypothetical protein	NA	A0A0A7RTM8	Clostridium_phage	57.1	1.9e-10
WP_012704331.1|2591538_2592774_-	Ig-like domain-containing protein	NA	A0A0K2FHC7	Achromobacter_phage	41.7	1.3e-07
WP_012704734.1|2593187_2593625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526870.1|2593635_2593902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041173634.1|2593870_2594275_-	hypothetical protein	NA	A0A0E3Y4X1	Fusobacterium_phage	36.8	3.5e-10
WP_012705130.1|2594552_2594780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705752.1|2594800_2595628_-	DNA adenine methylase	NA	A7YGL3	Campylobacter_phage	35.4	8.6e-32
WP_012705144.1|2595642_2595858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704946.1|2595874_2596870_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	24.5	4.9e-05
WP_012705432.1|2596941_2597109_-	hypothetical protein	NA	I1TJZ5	Clostridium_phage	69.1	6.6e-16
WP_012100913.1|2597203_2597350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705511.1|2597383_2597554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703725.1|2597586_2597976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704295.1|2598109_2598292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705729.1|2598352_2598658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704168.1|2598691_2598844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704509.1|2598875_2599064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704856.1|2599109_2599283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526883.1|2599334_2599526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704046.1|2599576_2599924_-	hypothetical protein	NA	A0A0A7RTL9	Clostridium_phage	57.0	1.4e-28
WP_012705681.1|2599926_2600331_-	DUF1064 domain-containing protein	NA	D0R7I5	Paenibacillus_phage	42.1	4.8e-12
WP_012705188.1|2600327_2600492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704186.1|2600481_2600847_-	hypothetical protein	NA	A0A0A7RVR5	Clostridium_phage	46.2	3.8e-24
WP_012703755.1|2600923_2601637_-	hypothetical protein	NA	A0A0A7RWW3	Clostridium_phage	62.3	5.1e-73
WP_012705518.1|2601663_2602056_-	hypothetical protein	NA	A0A0A7RUF3	Clostridium_phage	58.5	2.6e-34
WP_012705543.1|2602153_2602534_-	nucleotide pyrophosphohydrolase	NA	R4T830	Halovirus	55.4	5.6e-10
WP_012705051.1|2602533_2602773_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	60.3	1.7e-20
WP_012705546.1|2602775_2603096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705435.1|2603097_2603976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025775360.1|2603987_2604221_-	hypothetical protein	NA	A0A0A7RTQ4	Clostridium_phage	41.0	2.4e-11
WP_012704252.1|2604243_2605047_-	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	35.1	1.6e-35
WP_012703960.1|2605006_2605879_-	phage replisome organizer N-terminal domain-containing protein	NA	Q7Y4K5	Streptococcus_phage	40.8	4.5e-39
WP_012705759.1|2605901_2606201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704389.1|2606294_2606471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704559.1|2606486_2606633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705442.1|2606635_2607496_-	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	47.1	3.1e-56
WP_012704723.1|2607507_2607993_-	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	44.7	2.4e-26
WP_012704459.1|2608124_2608289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003392444.1|2608297_2608456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705266.1|2608508_2608661_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003392449.1|2608681_2608891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704315.1|2608902_2609691_-	phage antirepressor KilAC domain-containing protein	NA	A0A0E3T9K5	Staphylococcus_phage	64.1	2.4e-87
WP_012703750.1|2609744_2609966_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012705201.1|2610098_2610557_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	31.1	2.2e-05
WP_012704586.1|2610603_2611038_+	ImmA/IrrE family metallo-endopeptidase	NA	D6R412	Bacillus_phage	47.1	4.8e-26
WP_012703858.1|2611180_2612542_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	57.8	2.0e-70
2611340:2611357	attR	AAACTATTAGAAGAAAAA	NA	NA	NA	NA
WP_012705666.1|2612636_2614259_+	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	37.2	3.5e-93
>prophage 6
NZ_CP013847	Clostridium botulinum strain Af650 chromosome, complete genome	4116856	2658514	2698278	4116856	tail,capsid,terminase,head,portal,plate	Clostridium_phage(85.71%)	51	NA	NA
WP_012705552.1|2658514_2658769_-	hemolysin XhlA family protein	NA	A0A0A7RTX0	Clostridium_phage	69.6	1.8e-25
WP_012705470.1|2658872_2659583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704845.1|2659806_2660274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704282.1|2660938_2661328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705342.1|2661449_2661659_-	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	68.9	1.3e-08
WP_012704076.1|2661674_2661980_-	hypothetical protein	NA	J9QEB9	Clostridium_phage	37.0	5.6e-05
WP_012704615.1|2661995_2663240_-|tail	phage tail protein	tail	A0A2H4J039	uncultured_Caudovirales_phage	62.2	9.8e-72
WP_012704050.1|2663243_2663870_-	DUF2313 domain-containing protein	NA	A0A0A7RVP9	Clostridium_phage	75.1	2.1e-86
WP_012703970.1|2663850_2664945_-|plate	baseplate J/gp47 family protein	plate	A0A0A7S096	Clostridium_phage	76.4	2.1e-158
WP_012705610.1|2664945_2665353_-	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	77.7	9.1e-51
WP_012704685.1|2665355_2665700_-	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	75.4	1.0e-39
WP_012705011.1|2665709_2666684_-	hypothetical protein	NA	A0A0A7RTZ4	Clostridium_phage	84.9	1.0e-156
WP_012705378.1|2666695_2667376_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	74.8	3.2e-93
WP_012704075.1|2667375_2669535_-	hypothetical protein	NA	A0A0A7S0K9	Clostridium_phage	54.9	5.4e-134
WP_012703789.1|2669620_2670199_-	hypothetical protein	NA	A0A0A7RTT9	Clostridium_phage	56.1	2.3e-55
WP_012704247.1|2670439_2670853_-	hypothetical protein	NA	A0A0A7RTN3	Clostridium_phage	74.1	6.4e-52
WP_012704883.1|2670868_2671333_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	80.5	6.0e-67
WP_012705498.1|2671336_2672647_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7S087	Clostridium_phage	84.9	1.0e-212
WP_003357153.1|2672648_2672819_-	hypothetical protein	NA	A0A0A7RTV4	Clostridium_phage	73.1	1.8e-13
WP_012705220.1|2672808_2673240_-	hypothetical protein	NA	A0A0A7RTI2	Clostridium_phage	73.8	2.3e-52
WP_012704653.1|2673241_2673733_-	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	74.1	2.6e-60
WP_012047644.1|2673732_2674116_-	hypothetical protein	NA	A0A0A7S083	Clostridium_phage	84.3	5.7e-55
WP_012705337.1|2674117_2674462_-|head,tail	phage head-tail connector protein	head,tail	A0A0A7RTX9	Clostridium_phage	87.7	5.0e-50
WP_012704110.1|2674475_2675441_-	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	78.2	2.7e-141
WP_012704393.1|2675460_2676066_-	scaffold protein	NA	A0A0A7RTM5	Clostridium_phage	45.8	1.4e-23
WP_101526871.1|2676088_2676445_-	ABC transporter ATPase	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	68.7	1.5e-36
WP_012704995.1|2676488_2676683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526872.1|2676715_2678506_-|capsid	minor capsid protein	capsid	A0A0A7RVY7	Clostridium_phage	75.1	6.9e-151
WP_012704985.1|2678495_2679947_-|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	89.1	6.6e-237
WP_012705413.1|2679959_2681198_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0A7RTE7	Clostridium_phage	91.5	4.2e-224
WP_012704115.1|2681187_2681757_-|terminase	terminase small subunit	terminase	U5PZD3	Bacillus_phage	35.8	1.1e-17
WP_003358039.1|2682328_2682808_-	hypothetical protein	NA	I2E8Y5	Clostridium_phage	43.7	2.7e-25
WP_012705294.1|2682809_2684180_-	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	60.0	4.7e-160
WP_012703762.1|2684182_2684350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041173637.1|2684342_2684624_-	VRR-NUC domain-containing protein	NA	A0A0A7RTE1	Clostridium_phage	81.7	1.2e-20
WP_169989753.1|2684889_2687280_-	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	88.3	0.0e+00
WP_012703959.1|2687358_2688384_-	nucleoid-associated protein	NA	A0A090D855	Clostridium_phage	33.8	2.2e-45
WP_012704591.1|2688421_2688652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012703855.1|2688690_2690658_-	DNA polymerase	NA	A0A0A7RTL3	Clostridium_phage	87.6	0.0e+00
WP_041173672.1|2690663_2691218_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	91.8	8.2e-95
WP_012704721.1|2691295_2692441_-	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	88.5	8.4e-195
WP_012704353.1|2692440_2692890_-	hypothetical protein	NA	A0A0A7RTD8	Clostridium_phage	49.7	8.6e-10
WP_012703807.1|2692923_2693178_-	hypothetical protein	NA	A0A0A7RTF9	Clostridium_phage	73.3	1.7e-26
WP_012705687.1|2693177_2693429_-	hypothetical protein	NA	A0A0A7RTK9	Clostridium_phage	65.4	4.0e-25
WP_012705088.1|2693447_2693801_-	hypothetical protein	NA	A0A0A7RVM0	Clostridium_phage	69.8	1.1e-36
WP_012703683.1|2693864_2694416_-	sigma-70 family RNA polymerase sigma factor	NA	M9Q2I8	Clostridium_phage	34.2	4.3e-19
WP_012704163.1|2694620_2694779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705064.1|2695625_2695769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704948.1|2695869_2696070_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012704245.1|2696361_2696736_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J076	uncultured_Caudovirales_phage	50.8	5.8e-20
WP_012705549.1|2696739_2698278_+	recombinase family protein	NA	M9Q2G2	Clostridium_phage	33.8	2.1e-68
>prophage 7
NZ_CP013847	Clostridium botulinum strain Af650 chromosome, complete genome	4116856	3254740	3264161	4116856		Synechococcus_phage(42.86%)	7	NA	NA
WP_012705771.1|3254740_3256240_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.6	7.2e-69
WP_012705191.1|3256453_3257071_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.6	2.6e-25
WP_012099415.1|3257197_3258193_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	43.7	9.9e-67
WP_003357998.1|3258253_3259696_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	7.2e-58
WP_012047943.1|3259793_3260498_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.1	6.0e-42
WP_012705495.1|3260497_3260977_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.4	2.8e-27
WP_012704621.1|3261605_3264161_-	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	32.4	1.3e-09
>prophage 8
NZ_CP013847	Clostridium botulinum strain Af650 chromosome, complete genome	4116856	3413683	3436543	4116856		Clostridium_phage(81.82%)	28	NA	NA
WP_012705457.1|3413683_3414466_-	hypothetical protein	NA	A0A218M352	Acidovorax_phage	34.1	2.2e-05
WP_012704814.1|3414556_3415642_-	hypothetical protein	NA	A0A0A7RU66	Clostridium_phage	69.5	1.9e-140
WP_012705721.1|3415653_3416652_-	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	72.6	1.8e-140
WP_003360052.1|3416663_3416918_-	hypothetical protein	NA	A0A0A7S0T0	Clostridium_phage	81.0	1.1e-33
WP_012704958.1|3416923_3418819_-	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	49.1	2.3e-104
WP_012703961.1|3418833_3420069_-	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	83.2	1.6e-202
WP_012703835.1|3420091_3421069_-	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	60.5	3.5e-109
WP_012704658.1|3421070_3422420_-	caspase family protein	NA	A0A0A7RW86	Clostridium_phage	74.1	2.7e-75
WP_012705004.1|3422434_3422776_-	hypothetical protein	NA	A0A0A7S0S4	Clostridium_phage	55.7	2.1e-16
WP_012705384.1|3422788_3423874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704056.1|3423860_3424295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012705047.1|3424307_3425849_-	membrane protein	NA	A0A0A7RU22	Clostridium_phage	42.4	5.8e-05
WP_162266843.1|3426033_3426276_-	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	66.2	9.9e-21
WP_003357967.1|3426235_3426652_-	hypothetical protein	NA	A0A0A7S0S0	Clostridium_phage	71.2	9.0e-46
WP_012704139.1|3426666_3427554_-	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	74.8	2.4e-120
WP_012704829.1|3427558_3427978_-	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	73.4	7.1e-59
WP_012704384.1|3427983_3428331_-	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	60.7	1.5e-33
WP_003357709.1|3428335_3428701_-	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	57.9	1.2e-33
WP_003357791.1|3428700_3428985_-	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	59.2	3.0e-24
WP_012704555.1|3429651_3430173_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	50.0	1.1e-35
WP_012704130.1|3430285_3430606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012704131.1|3430662_3431463_-	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	34.4	1.1e-31
WP_012705580.1|3431452_3432358_-	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	39.5	9.4e-40
WP_012704458.1|3432451_3432664_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012704308.1|3432725_3432935_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003360073.1|3433126_3433537_+	helix-turn-helix domain-containing protein	NA	A0A0A7RUJ5	Clostridium_phage	56.2	1.0e-09
WP_012705276.1|3433838_3433988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012704213.1|3435055_3436543_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	38.1	2.1e-65
>prophage 1
NZ_CP013848	Clostridium botulinum strain Af650 plasmid pRSJ14_1, complete sequence	42784	0	8940	42784		Clostridium_phage(42.86%)	18	NA	NA
WP_169989762.1|148_322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526907.1|507_867_-	DUF1599 domain-containing protein	NA	A0A2H4J4N1	uncultured_Caudovirales_phage	69.5	1.3e-32
WP_101526908.1|1027_1414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061316892.1|1480_1801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053338055.1|1833_1965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169989764.1|1991_2138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526886.1|2170_2626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526909.1|2658_3318_-	DNA modification methylase	NA	A0A1S5S9L2	Streptococcus_phage	67.1	4.0e-88
WP_101526887.1|3359_3788_-	phage N-6-adenine-methyltransferase	NA	A0A0A7RUD1	Clostridium_phage	88.6	3.2e-70
WP_101526888.1|3829_4549_-	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	42.8	1.5e-48
WP_101526889.1|4655_4955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526890.1|4967_5285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526891.1|5275_5677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526892.1|5654_6080_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_101526893.1|6096_7377_-	replicative DNA helicase	NA	Q1MVI0	Enterobacteria_phage	36.0	3.0e-68
WP_101526910.1|7393_7954_-	conserved phage C-terminal domain-containing protein	NA	Q8SBM0	Clostridium_phage	54.1	1.0e-23
WP_154695592.1|8260_8422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061322252.1|8580_8940_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WF83	Clostridium_phage	51.9	2.7e-22
>prophage 2
NZ_CP013848	Clostridium botulinum strain Af650 plasmid pRSJ14_1, complete sequence	42784	15362	42512	42784	plate,capsid,portal,terminase,holin,protease,integrase,tail	Bacteriophage(30.43%)	36	21196:21211	41746:41761
WP_101526900.1|15362_15557_-	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	82.1	9.1e-17
WP_101526901.1|17428_17845_-|holin	phage holin family protein	holin	M9Q253	Clostridium_phage	56.6	1.4e-35
WP_043002082.1|17858_18617_-	DNA adenine methylase	NA	Q0SPG6	Clostridium_phage	75.4	5.5e-110
WP_024933450.1|18730_18946_-	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	67.4	1.0e-08
WP_012704076.1|18961_19267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061329275.1|20484_21141_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	35.3	3.3e-26
WP_061329299.1|21140_22295_-|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	38.3	1.4e-64
21196:21211	attL	TCTTTTATATCTATAA	NA	NA	NA	NA
WP_061329300.1|22296_22596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061322260.1|22614_23031_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_061322258.1|23035_23236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061329276.1|23236_24151_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_061329277.1|24155_24368_-	hypothetical protein	NA	A0A2K9V2S8	Faecalibacterium_phage	44.8	1.5e-09
WP_061329278.1|24360_26526_-	hypothetical protein	NA	A0A1U9WQS5	Geobacillus_phage	46.7	6.1e-37
WP_061329279.1|26744_27053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061329280.1|27096_27618_-|tail	phage tail protein	tail	A0A2K9V428	Faecalibacterium_phage	25.9	5.5e-08
WP_061329281.1|27614_29069_-	hypothetical protein	NA	A0A2K9V2R6	Faecalibacterium_phage	33.7	2.2e-78
WP_101526903.1|29081_29609_-	hypothetical protein	NA	A0A0C5AN06	Bacteriophage	28.4	9.4e-08
WP_061329283.1|29609_30203_-|tail	phage tail protein	tail	A0A067ZG41	Vibrio_phage	30.1	5.6e-09
WP_061329284.1|30208_30523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101526904.1|30515_30740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061329286.1|30855_31902_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	47.5	1.1e-87
WP_061329287.1|31919_32258_-	hypothetical protein	NA	A0A0C5AN05	Bacteriophage	30.8	5.1e-07
WP_061329288.1|32261_33422_-|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	39.6	4.6e-55
WP_061329289.1|33369_34938_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	61.2	9.8e-178
WP_061329290.1|34955_35189_-	hypothetical protein	NA	A0A0C5AEE0	Bacteriophage	39.7	4.3e-05
WP_154695590.1|35236_35404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061329291.1|35417_37253_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	52.9	3.5e-174
WP_061329292.1|37209_37803_-	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	37.4	2.2e-21
WP_061329293.1|37961_38204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061329294.1|38419_38674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061329295.1|38851_39409_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	56.1	4.1e-46
WP_061322282.1|39473_39812_-	DUF898 family protein	NA	S5MNN8	Brevibacillus_phage	71.2	1.2e-24
WP_061322241.1|40166_40361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061322243.1|40389_40605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061329296.1|40855_41299_-	hypothetical protein	NA	A0A090EUN5	Clostridium_phage	35.8	1.1e-12
WP_101526906.1|41474_42512_-	nucleoid-associated protein	NA	A0A090D855	Clostridium_phage	29.6	1.6e-38
41746:41761	attR	TCTTTTATATCTATAA	NA	NA	NA	NA
