The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025582	Lacticaseibacillus paracasei strain HD1.7 chromosome, complete genome	3039280	475854	597602	3039280	holin,transposase,integrase	Lactobacillus_phage(41.38%)	104	475835:475894	526070:527122
475835:475894	attL	CCTAGATTGCAATAATAAAGTTACCACCTAGAAAGAGGCTTGCTCACTGCTTGAACTGGG	NA	NA	NA	NA
WP_003574021.1|475854_476775_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003573651.1|478217_478802_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	43.9	5.9e-35
WP_072671939.1|481781_482498_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003583345.1|482508_483513_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_045137083.1|483586_484663_+	class C sortase	NA	NA	NA	NA	NA
WP_003573657.1|484853_485588_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	6.1e-13
WP_003583347.1|485580_487197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003583352.1|488177_489293_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003583354.1|489395_490277_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.0	3.9e-22
WP_003583356.1|490273_491422_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003583358.1|491450_491990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511935.1|492179_498878_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_003583362.1|505353_507888_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.7	7.9e-68
WP_003583364.1|508471_509914_+	amino acid permease	NA	NA	NA	NA	NA
WP_003563498.1|510022_510526_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_003583367.1|510704_511598_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.3	2.0e-05
WP_003577882.1|511752_512619_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003563502.1|512635_513469_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_101511936.1|513565_514462_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003563507.1|514738_515956_+	MFS transporter	NA	NA	NA	NA	NA
WP_003573694.1|517317_518133_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003583378.1|518165_519095_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.4	3.9e-105
WP_003577841.1|519326_520571_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003577895.1|520754_521300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577897.1|521620_522790_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	97.9	4.3e-218
WP_003573997.1|522902_523163_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_016368286.1|523252_523873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572180.1|524284_524992_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003574021.1|525188_526109_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_101511937.1|526205_526628_-	hypothetical protein	NA	A0A0P0IJN5	Lactobacillus_phage	38.4	3.0e-20
WP_003572184.1|526620_526974_-	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_101511938.1|527217_527466_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	96.2	1.0e-36
526070:527122	attR	CCCAGTTCAAGCAGTGAGCAAGCCTCTTTCTAGGTGGTAACTTTATTATTGCAATCTAGGAATTAATGACTTTTCCAATTATACTGATATCATCTGCTTTTACCAGTTGGTTGCAAGCTAATTCAACAATGAACAGTCAGTAGTTTTCATAAAACCGTTCAATGCATTGAACGGCAGAATCCTCTAACCATTGCGGTATCGCTAAATCATTCATGAATTGGTCAATGTTTGCTGATTCTTCTGGAATGTCTGCGAAATACATTGGAACGATAATTGATAGCGCACGTTGGTTGGCTCCATTCTTTGTACGGCTTTTAGTGTATTGATTTGTGTATCGAAGCTTACCGTTATCCCCGTTGAGAATATGTGCACATTCATGAGCTGCTTGAAATGGCAACTCATTTGCATTCGGCCATTTGTTGTTAAGAATAATTAGGCGAGCTTCTGTATCAACCAAAGGGCCTTGGTCCTCGTGTAAGGGGATAGTCGAGCAGCCTATATTGTGATCCCAAGCATAGTCAATCACCTGATTCAACAAGTCCTCTATATGATCATTCATGACGATCACGCTTTTTGCTGCTATTATTGCGTCGTTCCAAAATAGCTTGAATGATTTCCCAATCGTCTTGGCGAACAGGCTGTCCTTGATAGGTAAAGATGTTTGTTCCTGACAGATCAACAGGTTTAGAACCTTCATTGTCAGGATTGGGGTTATCCGTATTGCCAAGTAAATAATCCACAGAAACTTGAAGAACATCAGCAACTTTCTGAACATTCTCGGTAGATGGGGTCATCTTTTTCCATCGATAGATGCTGTTAATGCCTATACCTGCTTTCAGAGCTAATTTTTGGAGTGACCACCCTCGATTTGAAGCTAGTGTTTTTATTCTGTCGTAAGTACTCATGAGACGAGTTCTCCCGGTCATGACGAATTATTTATCACAAGTGGTTTACAATTTATCACGTGTGGTTTACTATGAATTCATCAAGTAATTAAGCAAACATCAACAAGCTAATCCATCCATGTCTTTGGCGATAACGGTGGATAAGTAG	NA	NA	NA	NA
WP_101511939.1|527507_527708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572188.1|527678_528512_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
WP_016368112.1|528572_529331_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	48.9	7.1e-41
WP_003572196.1|529503_529755_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003572199.1|529820_530177_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_003572201.1|530261_530465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586921.1|530447_530993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661649.1|531173_531488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003589925.1|532240_533065_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.1	6.6e-117
WP_003574016.1|533064_533583_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003597560.1|533629_534052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016368116.1|534053_534791_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	43.6	3.8e-47
WP_010493149.1|534802_535090_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	76.8	1.6e-38
WP_003574021.1|535285_536206_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_010493154.1|537113_537557_-	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
WP_032786488.1|538071_538404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|538412_539333_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003583407.1|539977_540976_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	2.0e-54
WP_003573729.1|541171_541390_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010493173.1|542922_543258_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
WP_076626284.1|543377_543710_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016370120.1|543739_544468_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.1	7.6e-32
WP_016383324.1|545387_546251_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	4.1e-24
WP_003582220.1|546932_547211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572355.1|547222_547489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572358.1|547507_547684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572360.1|547685_547913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582223.1|547955_549197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582225.1|549174_550725_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_003582226.1|550734_551154_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_003582228.1|551162_551741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582234.1|556282_556618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003583424.1|556601_557198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003583426.1|557178_559107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582241.1|560133_560778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003583429.1|560774_561182_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032800899.1|561171_561993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016383269.1|562595_562775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003593118.1|562815_563070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003593120.1|563059_563497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511940.1|563489_564734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072672198.1|564775_565021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511941.1|565007_567545_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_011674169.1|567885_567990_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003583466.1|568279_568534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003582061.1|568536_568680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101511942.1|568672_569122_-	nitroreductase	NA	NA	NA	NA	NA
WP_003582058.1|569135_569426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072672202.1|569435_569882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586154.1|572540_574475_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003586156.1|574474_574912_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003586158.1|574925_575246_+	PTS fructose IIB component	NA	NA	NA	NA	NA
WP_003586160.1|575259_576387_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_032787044.1|576389_578984_+	glycosyl hydrolase family 38	NA	NA	NA	NA	NA
WP_003586163.1|579103_579967_+	glucose uptake protein	NA	NA	NA	NA	NA
WP_003586165.1|580583_581294_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003586168.1|581307_581790_+	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_003586170.1|581790_582600_+	PTS N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_003586172.1|582589_583402_+	PTS N-acetylgalactosamine transporter subunit IID	NA	NA	NA	NA	NA
WP_003586174.1|583403_583832_+	N-acetylglucosamine/galactosamine PTS, EIIA	NA	NA	NA	NA	NA
WP_101511943.1|584621_585408_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002816607.1|586166_586850_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_072672305.1|587490_588063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016369712.1|588055_588505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016369713.1|588518_588809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032786516.1|589750_590650_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_016370188.1|591104_591776_+	class A sortase	NA	NA	NA	NA	NA
WP_003583502.1|591908_592139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512327.1|592559_594116_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_002816607.1|594696_595380_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_005688360.1|595651_596806_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_101511944.1|596814_597602_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP025582	Lacticaseibacillus paracasei strain HD1.7 chromosome, complete genome	3039280	605425	639907	3039280	transposase	Staphylococcus_phage(35.71%)	29	NA	NA
WP_108315962.1|605425_605704_+|transposase	transposase	transposase	Q6J1X3	Lactobacillus_phage	94.3	3.9e-29
WP_016374492.1|606826_607387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016374491.1|607650_607776_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.7	1.4e-15
WP_003582354.1|609096_610014_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003582352.1|610160_610769_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.4e-50
WP_003582350.1|610779_612048_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	48.2	2.2e-50
WP_003582348.1|612316_612745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582346.1|612872_613049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016386656.1|613918_614602_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.8e-59
WP_004563097.1|615572_615989_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	56.9	3.9e-33
WP_003582108.1|616011_616347_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_016368213.1|617720_619451_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_003582114.1|619502_619826_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	42.7	5.2e-17
WP_003582117.1|619948_620545_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	36.5	5.1e-26
WP_101511946.1|621041_621829_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003574021.1|622527_623448_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003581836.1|624647_625391_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	1.5e-27
WP_016366710.1|625368_626616_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003581839.1|626620_627292_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016386656.1|627383_628067_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.8e-59
WP_003581966.1|628620_628884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016368446.1|628844_629495_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	4.3e-18
WP_003581971.1|629491_630262_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003581973.1|630369_631692_-	MFS transporter	NA	NA	NA	NA	NA
WP_101511947.1|634054_634838_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081528680.1|635113_636646_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003567800.1|636645_637605_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.9	8.8e-28
WP_060417290.1|637610_638936_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003574021.1|638986_639907_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 3
NZ_CP025582	Lacticaseibacillus paracasei strain HD1.7 chromosome, complete genome	3039280	1140625	1213076	3039280	tail,head,holin,portal,transposase,capsid,integrase,terminase	Lactobacillus_phage(78.95%)	82	1137442:1137457	1209242:1209257
1137442:1137457	attL	AGAAAAAGCTGTTCAT	NA	NA	NA	NA
WP_101511971.1|1140625_1141870_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003569846.1|1142062_1143511_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_003569847.1|1143591_1145445_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003604899.1|1145531_1146362_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_101511972.1|1147027_1149691_-	YfhO family protein	NA	NA	NA	NA	NA
WP_003569858.1|1152090_1153020_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	48.1	6.0e-74
WP_003606991.1|1153106_1153745_-	YkyA family protein	NA	NA	NA	NA	NA
WP_101511973.1|1153872_1154838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003569868.1|1154901_1155114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003566521.1|1155797_1155998_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.2e-19
WP_003569870.1|1156239_1156722_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_178138314.1|1156721_1157363_+	glucosaminidase domain-containing protein	NA	A0A0A7RUS8	Clostridium_phage	47.0	2.5e-26
WP_003566514.1|1157553_1158132_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003566511.1|1158138_1159467_+	purine permease	NA	Q9KX94	Enterobacteria_phage	31.7	1.6e-35
WP_003569875.1|1159487_1160597_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003566506.1|1160666_1161962_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.8	4.2e-17
WP_003577841.1|1162187_1163432_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003566504.1|1163553_1164123_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003585070.1|1164132_1164879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569886.1|1164964_1167220_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.7	9.5e-158
WP_003569888.1|1167685_1168291_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003566496.1|1168462_1169320_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_003566494.1|1169533_1170874_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_101511974.1|1171000_1172185_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	9.6e-226
WP_101511975.1|1172318_1172504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511976.1|1172500_1173238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101511977.1|1173332_1173536_-	hypothetical protein	NA	A0A0P0IQK8	Lactobacillus_phage	91.0	4.4e-30
WP_003574518.1|1173559_1173985_-	pyridoxamine 5'-phosphate oxidase family protein	NA	A0A0P0I7K6	Lactobacillus_phage	86.5	2.7e-61
WP_101511978.1|1174319_1174910_-	DUF5067 domain-containing protein	NA	Q6SEF8	Lactobacillus_prophage	56.2	8.0e-40
WP_003605890.1|1174933_1175797_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_189260173.1|1175820_1176267_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_003605888.1|1176905_1177169_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003574526.1|1177165_1177477_+	hypothetical protein	NA	A0A1B0Y2Q8	Lactobacillus_phage	100.0	2.2e-52
WP_016373289.1|1177473_1177683_-	hypothetical protein	NA	A0A1B0Y3M6	Lactobacillus_phage	98.6	1.1e-31
WP_164886371.1|1177770_1177917_+	hypothetical protein	NA	A0A1B0YC03	Lactobacillus_phage	97.9	5.0e-20
WP_003582311.1|1177982_1178531_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	98.9	4.1e-99
WP_003582309.1|1178509_1178731_+	helix-turn-helix domain-containing protein	NA	A0A0P0ID64	Lactobacillus_phage	100.0	1.4e-37
WP_101512331.1|1178971_1179379_+	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	94.8	7.1e-72
WP_101511979.1|1179391_1180255_+	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	95.8	7.9e-153
WP_101511980.1|1180235_1181036_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	91.3	7.6e-142
WP_060417211.1|1181051_1181903_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	93.6	2.7e-105
WP_003585034.1|1181889_1182672_+	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	91.9	1.1e-132
WP_101511981.1|1182668_1183001_+	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	78.2	4.5e-40
WP_060417213.1|1182997_1183447_+	hypothetical protein	NA	A0A0P0ID70	Lactobacillus_phage	98.7	1.3e-71
WP_019892351.1|1183493_1183748_+	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	98.8	5.9e-40
WP_101511982.1|1183744_1184110_+	endodeoxyribonuclease	NA	A0A0P0HRU0	Lactobacillus_phage	99.2	5.3e-66
WP_101511983.1|1184123_1184975_+	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	72.5	3.8e-107
WP_101511984.1|1184967_1185684_+	N-6 DNA methylase	NA	A8YQM7	Lactobacillus_phage	95.7	1.2e-125
WP_101511985.1|1185670_1186594_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	43.4	6.4e-68
WP_101511986.1|1186604_1187183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511987.1|1187206_1187317_+	acetyltransferase	NA	A0A2D1GP93	Lactobacillus_phage	94.4	5.5e-11
WP_101511988.1|1187313_1187829_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	59.4	4.8e-49
WP_101511989.1|1188159_1188441_+	hypothetical protein	NA	A0A0A1EL18	Lactobacillus_phage	49.4	1.5e-15
WP_164886370.1|1188567_1188765_+	hypothetical protein	NA	A0A1B0Y850	Lactobacillus_phage	98.5	6.1e-29
WP_071253136.1|1188939_1189368_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_016375957.1|1189722_1190346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511991.1|1190806_1191955_+	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	97.4	7.6e-220
WP_101511992.1|1192340_1193030_+	helix-turn-helix domain-containing protein	NA	A0A1S5SAA7	Streptococcus_phage	48.9	8.2e-44
WP_052915997.1|1193013_1194267_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0P0I3B0	Lactobacillus_phage	99.0	1.1e-248
WP_101512333.1|1194271_1195699_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	93.3	2.2e-253
WP_101511993.1|1195664_1196663_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	95.7	2.4e-177
WP_101511994.1|1196672_1196999_+	hypothetical protein	NA	A0A0P0IJR5	Lactobacillus_phage	88.9	2.3e-49
WP_101511995.1|1196995_1197439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101511996.1|1197455_1197830_+	hypothetical protein	NA	A0A2D2W301	Escherichia_phage	55.3	1.1e-21
WP_101511997.1|1197947_1198586_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	93.4	2.4e-82
WP_063557949.1|1198598_1198913_+	hypothetical protein	NA	A0A0N7IR89	Lactobacillus_phage	93.3	1.8e-46
WP_101511998.1|1198926_1199946_+|capsid	major capsid protein	capsid	A0A0P0IZJ7	Lactobacillus_phage	98.8	4.7e-189
WP_101511999.1|1200173_1200548_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IV23	Lactobacillus_phage	87.9	9.5e-55
WP_101512000.1|1200552_1200855_+	hypothetical protein	NA	A0A0P0HRN0	Lactobacillus_phage	90.0	1.3e-46
WP_003584996.1|1200851_1201217_+	HK97 gp10 family phage protein	NA	A0A0P0IUZ3	Lactobacillus_phage	95.0	1.3e-56
WP_072671901.1|1201217_1201622_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	97.8	1.7e-70
WP_101512001.1|1201633_1202236_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	88.6	1.2e-96
WP_101512002.1|1202321_1202654_+|tail	tail assembly chaperone	tail	A0A0P0IQQ6	Lactobacillus_phage	93.6	1.8e-49
WP_101512334.1|1202758_1203112_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	95.7	4.0e-55
WP_101512003.1|1203104_1206194_+	tape measure protein	NA	A0A0P0IJD2	Lactobacillus_phage	96.9	8.4e-298
WP_101512004.1|1206196_1208206_+|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	50.5	1.3e-166
WP_101512005.1|1208205_1210719_+|tail	phage tail protein	tail	B4XYQ5	Lactobacillus_phage	41.9	1.3e-155
1209242:1209257	attR	ATGAACAGCTTTTTCT	NA	NA	NA	NA
WP_101512006.1|1210730_1211003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032779081.1|1210999_1211131_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	60.5	4.0e-08
WP_003581984.1|1211186_1211462_+	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_071252206.1|1211476_1211890_+|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	99.3	8.9e-46
WP_164886369.1|1211900_1213076_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	92.1	2.3e-211
>prophage 4
NZ_CP025582	Lacticaseibacillus paracasei strain HD1.7 chromosome, complete genome	3039280	1896885	1993283	3039280	tRNA,tail,head,holin,protease,portal,transposase,capsid,integrase,terminase	Lactobacillus_phage(78.69%)	95	1928335:1928359	1998871:1998895
WP_101512054.1|1896885_1898130_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003575996.1|1898262_1899429_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003575994.1|1899412_1900693_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_101512055.1|1900704_1901886_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_003566056.1|1902230_1902530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003584872.1|1902530_1903361_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003584873.1|1903508_1904072_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_003584874.1|1904184_1905003_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_003566065.1|1905062_1906202_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_003566067.1|1906280_1906886_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003584875.1|1907524_1907989_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003566070.1|1907981_1908434_-	SprT family protein	NA	NA	NA	NA	NA
WP_003584876.1|1908575_1909328_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	1.9e-09
WP_003584877.1|1909320_1910220_-	permease component of an ABC superfamily transporter	NA	NA	NA	NA	NA
WP_003584878.1|1910216_1911212_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003566078.1|1911697_1912135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003584879.1|1912271_1914932_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.8	1.4e-75
WP_003584880.1|1915240_1916398_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003566083.1|1916663_1917491_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.6	2.7e-70
WP_003579778.1|1917493_1918687_-	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	27.0	1.2e-10
WP_003566087.1|1918690_1920154_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.7	2.6e-100
WP_003566099.1|1920598_1921300_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003579780.1|1921324_1922470_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003566103.1|1922576_1923374_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	38.3	6.2e-35
WP_003579793.1|1923386_1925363_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_003579795.1|1925691_1926519_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003579797.1|1926580_1928047_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.9	1.2e-71
1928335:1928359	attL	GGTCCTTATGTGTAGGTTTCTGGGC	NA	NA	NA	NA
WP_003579799.1|1928522_1930841_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	40.1	2.8e-35
WP_003566829.1|1931266_1931641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566828.1|1931780_1932203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003579803.1|1934289_1935426_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_003566825.1|1935534_1935852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566823.1|1937903_1938071_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_003579808.1|1938106_1940218_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_003579810.1|1940204_1940696_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_003579812.1|1940894_1941647_-	acyltransferase	NA	NA	NA	NA	NA
WP_101512056.1|1942129_1943419_-	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	88.2	4.4e-216
WP_071252206.1|1943429_1943843_-|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	99.3	8.9e-46
WP_003581984.1|1943857_1944133_-	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_032779081.1|1944188_1944320_-	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	60.5	4.0e-08
WP_101512006.1|1944316_1944589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512057.1|1948043_1949978_-|tail	phage tail family protein	tail	B4XYQ4	Lactobacillus_phage	46.7	4.8e-150
WP_101512058.1|1949978_1954841_-|tail	phage tail tape measure protein	tail	U5U708	Lactobacillus_phage	94.7	0.0e+00
WP_101512059.1|1954963_1955377_-	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_101512060.1|1955475_1956093_-|tail	phage tail protein	tail	U5U3Z7	Lactobacillus_phage	97.6	7.0e-111
WP_101512061.1|1956126_1956513_-|tail	phage tail protein	tail	U5U3W4	Lactobacillus_phage	96.9	1.1e-69
WP_101512062.1|1956512_1956899_-	HK97 gp10 family phage protein	NA	B4XYP9	Lactobacillus_phage	96.9	2.5e-66
WP_101512063.1|1956898_1957228_-|head,tail	head-tail adaptor protein	head,tail	A0A2D1GPN9	Lactobacillus_phage	99.1	2.1e-58
WP_101512064.1|1957217_1957577_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	97.5	2.5e-60
WP_101512065.1|1957587_1957827_-	Ig-like domain-containing protein	NA	A0A2D1GPN4	Lactobacillus_phage	94.9	6.1e-31
WP_101512066.1|1957844_1959047_-|capsid	phage major capsid protein	capsid	U5U3Z5	Lactobacillus_phage	97.5	3.2e-213
WP_101512067.1|1959087_1959717_-|head,protease	HK97 family phage prohead protease	head,protease	Q8LTC1	Lactobacillus_phage	95.7	4.2e-111
WP_101512068.1|1959670_1960924_-|portal	phage portal protein	portal	Q8LTC2	Lactobacillus_phage	99.0	7.5e-237
WP_003661399.1|1960929_1961121_-	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
WP_101512069.1|1961132_1962845_-|terminase	terminase large subunit	terminase	Q8LTC3	Lactobacillus_phage	98.4	0.0e+00
WP_003661401.1|1962866_1963322_-|terminase	P27 family phage terminase small subunit	terminase	U5U3Z1	Lactobacillus_phage	99.3	4.7e-80
WP_101512070.1|1963520_1964315_-	HNH endonuclease	NA	U5U440	Lactobacillus_phage	99.2	2.2e-149
WP_101512071.1|1964304_1964886_-	hypothetical protein	NA	Q96200	Lactobacillus_phage	87.6	2.3e-92
WP_101512072.1|1964898_1965222_-	hypothetical protein	NA	Q8LT99	Lactobacillus_phage	86.0	3.8e-44
WP_101512073.1|1965224_1965554_-	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	84.0	9.9e-48
WP_101512074.1|1965540_1966758_-	hypothetical protein	NA	A0A2D1GPQ9	Lactobacillus_phage	96.8	1.0e-235
WP_101512075.1|1967128_1967560_-	DUF1492 domain-containing protein	NA	A0A2D1GPD7	Lactobacillus_phage	72.1	2.1e-53
WP_101512076.1|1967628_1967847_-	helix-turn-helix transcriptional regulator	NA	U5U738	Lactobacillus_phage	83.3	7.5e-28
WP_101512077.1|1967917_1968100_-	hypothetical protein	NA	U5U7A2	Lactobacillus_phage	60.7	9.4e-08
WP_101512078.1|1968083_1968320_-	hypothetical protein	NA	U5U734	Lactobacillus_phage	83.3	1.6e-31
WP_101512079.1|1968306_1968747_-	hypothetical protein	NA	U5U4M8	Lactobacillus_phage	63.9	9.2e-41
WP_101512080.1|1968937_1969318_-	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	64.1	1.4e-37
WP_189260170.1|1969626_1969803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512082.1|1969792_1970344_-	hypothetical protein	NA	C1KFT3	Lactobacillus_virus	50.5	7.7e-37
WP_101512083.1|1970306_1970450_-	acetyltransferase	NA	A0A2D1GP93	Lactobacillus_phage	100.0	1.4e-11
WP_101512084.1|1970462_1971071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512085.1|1971990_1972701_-	N-6 DNA methylase	NA	A8YQM7	Lactobacillus_phage	94.7	2.9e-121
WP_101512086.1|1972697_1972940_-	hypothetical protein	NA	A8YQM8	Lactobacillus_phage	50.0	1.7e-12
WP_101512088.1|1973199_1973583_-	DUF1064 domain-containing protein	NA	A0A0P0IJU5	Lactobacillus_phage	96.1	1.2e-65
WP_101512089.1|1973585_1974035_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	91.9	2.4e-68
WP_003579409.1|1974047_1974392_-	hypothetical protein	NA	U5U420	Lactobacillus_phage	100.0	1.3e-61
WP_101512090.1|1974393_1975656_-	DNA helicase	NA	U5U3Y9	Lactobacillus_phage	98.1	1.2e-234
WP_101512091.1|1975652_1976483_-	helix-turn-helix domain-containing protein	NA	U5U793	Lactobacillus_phage	77.7	4.8e-115
WP_101512092.1|1976499_1976937_-	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	95.2	4.1e-73
WP_101512338.1|1976951_1977620_-	hypothetical protein	NA	U5U4M2	Lactobacillus_phage	96.4	2.4e-125
WP_101512093.1|1977622_1978378_-	ERF family protein	NA	U5U416	Lactobacillus_phage	95.6	3.7e-130
WP_101512094.1|1978388_1978880_-	siphovirus Gp157 family protein	NA	Q9T0Y7	Lactobacillus_phage	66.3	2.7e-49
WP_101512095.1|1978897_1979101_-	hypothetical protein	NA	U5U788	Lactobacillus_phage	86.6	7.0e-28
WP_189284857.1|1979105_1979258_-	hypothetical protein	NA	A0A0P0HRK6	Lactobacillus_phage	90.0	3.8e-18
WP_101512097.1|1979339_1979663_-	DUF771 domain-containing protein	NA	A0A0P0IJJ0	Lactobacillus_phage	82.4	6.2e-10
WP_101512098.1|1979713_1979971_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101512099.1|1979971_1980739_-	phage antirepressor KilAC domain-containing protein	NA	Q6SEF4	Lactobacillus_prophage	62.3	1.3e-82
WP_015992507.1|1980735_1980981_-	helix-turn-helix transcriptional regulator	NA	B4XYR7	Lactobacillus_phage	100.0	8.2e-39
WP_101512100.1|1981142_1981817_+	LexA family transcriptional regulator	NA	O64370	Lactobacillus_phage	97.3	8.1e-121
WP_101512101.1|1981876_1982554_+	transcriptional regulator	NA	A0A2D1GPN7	Lactobacillus_phage	98.2	9.1e-88
WP_101512102.1|1982728_1983898_+|integrase	site-specific integrase	integrase	A0A2D1GPE8	Lactobacillus_phage	97.9	1.5e-218
WP_003579813.1|1984347_1984986_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003579815.1|1985024_1985537_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003566817.1|1985689_1986214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003579820.1|1991999_1993283_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.6	3.6e-85
1998871:1998895	attR	GCCCAGAAACCTACACATAAGGACC	NA	NA	NA	NA
>prophage 5
NZ_CP025582	Lacticaseibacillus paracasei strain HD1.7 chromosome, complete genome	3039280	2432560	2497843	3039280	protease,tRNA,bacteriocin	Bacillus_phage(27.27%)	58	NA	NA
WP_076653085.1|2432560_2434054_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016384793.1|2434201_2435182_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_101512214.1|2435297_2435969_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_016384791.1|2436152_2436983_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063558272.1|2437128_2437968_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003567242.1|2439002_2439377_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101512215.1|2439541_2440813_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_063558274.1|2441130_2441907_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016385157.1|2441924_2442812_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	6.9e-35
WP_101512216.1|2443114_2444230_-	PIN domain nuclease	NA	NA	NA	NA	NA
WP_101512217.1|2445631_2446174_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	1.4e-38
WP_003567258.1|2446394_2446685_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003567260.1|2446789_2447167_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_101512218.1|2447411_2448731_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.2	5.9e-59
WP_003571383.1|2449052_2450399_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003588720.1|2450626_2451727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164886379.1|2451723_2452920_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003576231.1|2452982_2453861_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003567271.1|2454022_2456077_+	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.5e-64
WP_101512220.1|2456233_2458864_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.2	8.4e-89
WP_003576237.1|2459025_2459649_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_101512221.1|2460148_2460820_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_013246020.1|2460917_2461157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512222.1|2461331_2462453_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|2462466_2462751_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003588738.1|2462941_2464057_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|2464244_2464451_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2464583_2464841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2464911_2465118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246021.1|2465342_2465594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567292.1|2465921_2467154_+	MFS transporter	NA	NA	NA	NA	NA
WP_003576247.1|2467232_2468489_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	7.3e-99
WP_003588744.1|2468577_2469411_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	9.6e-47
WP_101512224.1|2470174_2470711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512225.1|2470899_2472123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013246026.1|2472712_2473540_-	class C sortase	NA	NA	NA	NA	NA
WP_101512226.1|2473546_2475106_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_016385140.1|2475102_2476425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016385138.1|2479708_2480266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567314.1|2480360_2481557_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_101512227.1|2483070_2483700_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.6e-06
WP_003596042.1|2483835_2484165_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003576280.1|2484161_2484950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512228.1|2485002_2485791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2485835_2486114_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003580845.1|2486137_2486422_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_101512229.1|2486614_2486911_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2487011_2488367_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2488672_2488984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567340.1|2489056_2489407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512230.1|2489580_2490960_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_101512231.1|2490970_2493163_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	8.1e-37
WP_003571414.1|2493628_2493766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045603255.1|2493955_2495254_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003567351.1|2495258_2496065_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042753684.1|2496426_2496624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101512232.1|2497170_2497410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032675994.1|2497669_2497843_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 6
NZ_CP025582	Lacticaseibacillus paracasei strain HD1.7 chromosome, complete genome	3039280	2664691	2678245	3039280		Streptococcus_phage(77.78%)	11	NA	NA
WP_101512270.1|2664691_2667235_-	recombinase RecF	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.5	2.5e-05
WP_010491198.1|2667614_2668805_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	43.7	7.9e-95
WP_010491196.1|2668794_2669121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003606383.1|2670084_2670306_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	1.7e-27
WP_101512271.1|2670309_2670807_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	44.6	6.5e-35
WP_010491186.1|2670868_2671261_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	73.6	6.5e-46
WP_101512272.1|2671244_2673710_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	64.5	0.0e+00
WP_101512273.1|2673696_2675790_+	conjugal transfer protein	NA	A0A1S5SF30	Streptococcus_phage	52.1	2.3e-145
WP_005691161.1|2675786_2676782_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	60.0	1.6e-109
WP_101512274.1|2676791_2677325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005691157.1|2677321_2678245_+	conjugal transfer protein	NA	A0A2K5B2A4	Erysipelothrix_phage	39.7	6.3e-07
>prophage 7
NZ_CP025582	Lacticaseibacillus paracasei strain HD1.7 chromosome, complete genome	3039280	2970772	2998289	3039280	tail,head,portal,transposase,capsid,integrase,terminase	Lactobacillus_phage(27.27%)	28	2985617:2985636	2999361:2999380
WP_003577841.1|2970772_2972017_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003586051.1|2972316_2973144_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003586053.1|2973430_2973940_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_003574021.1|2975444_2976365_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003586056.1|2977144_2978962_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003586058.1|2979287_2979686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016368092.1|2979876_2981175_+	amino acid permease	NA	NA	NA	NA	NA
WP_101512307.1|2982244_2983675_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003586065.1|2983731_2984211_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_016366759.1|2984384_2985239_-	PRD domain-containing protein	NA	NA	NA	NA	NA
2985617:2985636	attL	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
WP_101512308.1|2985733_2986891_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.2	1.3e-46
WP_101512309.1|2986985_2987639_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101512310.1|2987768_2988047_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014570224.1|2988136_2988358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512311.1|2988468_2988660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512312.1|2988704_2988980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003604804.1|2988976_2989165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512313.1|2989148_2989976_+	bifunctional DNA primase/polymerase	NA	A0A221SAP5	Ralstonia_phage	31.3	4.0e-13
WP_101512314.1|2989968_2991393_+	virulence protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.6	8.6e-64
WP_016370389.1|2991656_2991998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_189260175.1|2992080_2992455_+	HNH endonuclease	NA	D2JLE2	Staphylococcus_phage	40.7	2.2e-11
WP_013245611.1|2992579_2993050_+|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	29.3	1.6e-06
WP_101512315.1|2993046_2994750_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	39.7	2.5e-118
WP_101512316.1|2994715_2994895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101512317.1|2994899_2996084_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	35.2	2.8e-60
WP_101512318.1|2996070_2997612_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.6	1.5e-40
WP_003577144.1|2997673_2997964_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_101512319.1|2997947_2998289_+|head	phage head closure protein	head	A0A249XUQ2	Enterococcus_phage	38.4	4.7e-08
2999361:2999380	attR	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
