The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	1121116	1130372	5143533	tail	Enterobacteria_phage(44.44%)	9	NA	NA
WP_062881838.1|1121116_1122889_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	98.8	0.0e+00
WP_095585894.1|1124179_1124779_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	96.5	3.1e-108
WP_101974053.1|1124930_1126244_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.7	1.4e-76
WP_001101698.1|1126245_1126515_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_062882638.1|1126625_1127207_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	55.3	2.1e-48
WP_074434107.1|1127279_1127909_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	2.1e-78
WP_062882639.1|1127990_1128632_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	4.8e-107
WP_062882640.1|1128792_1129041_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
WP_000162571.1|1129889_1130372_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	1352279	1416513	5143533	protease,integrase,tRNA,holin,transposase,tail	Enterobacteria_phage(32.26%)	60	1391400:1391416	1418523:1418539
WP_000695657.1|1352279_1353695_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024226072.1|1353745_1354138_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000472021.1|1354139_1354499_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062881724.1|1355118_1357308_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_000376337.1|1357357_1358560_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_000186380.1|1358895_1360134_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_000490072.1|1360274_1360601_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_062881725.1|1360715_1361972_-	ion channel protein	NA	NA	NA	NA	NA
WP_062881726.1|1362175_1363141_+	glucokinase	NA	NA	NA	NA	NA
WP_000038456.1|1363360_1363687_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_062881727.1|1363708_1364956_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000173242.1|1364970_1366056_+	aminopeptidase	NA	NA	NA	NA	NA
WP_024226596.1|1366055_1367093_+	aminopeptidase	NA	NA	NA	NA	NA
WP_062881729.1|1367117_1369613_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_001295458.1|1370485_1371220_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_062881730.1|1371234_1372932_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000785931.1|1373308_1374547_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|1374611_1374683_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484404.1|1375038_1375959_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_000639883.1|1376311_1376554_+	YfdY family protein	NA	NA	NA	NA	NA
WP_000867637.1|1376630_1376906_-	colanic acid biosynthesis lipoprotein YpdI	NA	NA	NA	NA	NA
WP_000825599.1|1377201_1377834_+	YfdX family protein	NA	NA	NA	NA	NA
WP_000106759.1|1378346_1379597_+	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_062881731.1|1379650_1381345_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	4.7e-24
WP_000955028.1|1381414_1382359_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|1382432_1383578_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_074433971.1|1383633_1387227_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.3e-36
WP_000991370.1|1387231_1387846_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_024226601.1|1388261_1389425_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_001018714.1|1389424_1390963_+	multidrug efflux MFS transporter permease subunit EmrY	NA	NA	NA	NA	NA
WP_062881732.1|1391070_1392399_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
1391400:1391416	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001344440.1|1392865_1393861_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_024231033.1|1393868_1395302_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	9.1e-29
WP_064234920.1|1397845_1398547_+	Replication protein P	NA	A0A1U9AJJ8	Stx1_converting_phage	100.0	3.4e-130
WP_000145931.1|1398543_1398834_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1398904_1399183_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1399314_1399530_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1399540_1399777_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1399733_1400180_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153269.1|1400176_1400704_+	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	1.2e-100
WP_074433983.1|1400700_1400841_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	1.0e-14
WP_101974057.1|1400876_1401572_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.8	3.1e-131
WP_062882575.1|1401932_1402667_+	antirepressor	NA	A0A0N7C203	Escherichia_phage	99.6	5.5e-123
WP_001004008.1|1402741_1403464_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_001108006.1|1403463_1404069_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_000144764.1|1404065_1404260_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204862.1|1404252_1404687_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	99.3	1.8e-81
WP_001356551.1|1404935_1405088_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_101974058.1|1405798_1407736_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	96.4	0.0e+00
WP_000142777.1|1407872_1408052_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290217.1|1408092_1408365_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284506.1|1408441_1408657_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_101974059.1|1409043_1409775_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.6	4.2e-123
WP_069556620.1|1409841_1410441_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_101974060.1|1410505_1411819_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
WP_001101698.1|1411820_1412090_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_101974061.1|1412195_1413077_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.4	1.1e-144
WP_001247930.1|1413307_1414006_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_062881455.1|1414102_1415269_-|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	98.7	1.6e-220
WP_062881454.1|1415580_1416513_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
1418523:1418539	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	1436598	1465255	5143533	transposase,plate,tRNA,tail	Enterobacteria_phage(93.75%)	26	NA	NA
WP_062881447.1|1436598_1438605_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|1438763_1439984_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127772.1|1440292_1441471_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|1441467_1442463_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_001539236.1|1442731_1443625_-	type VI secretion-associated protein	NA	NA	NA	NA	NA
WP_001173929.1|1443629_1443962_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000078920.1|1444224_1444365_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_062881446.1|1444556_1444817_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_085952403.1|1446819_1448033_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000132789.1|1448181_1448505_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	100.0	1.1e-43
WP_000005431.1|1448662_1449847_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000290450.1|1449846_1450359_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|1450413_1450779_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_001391627.1|1450814_1450943_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_062881740.1|1450929_1453737_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.8	0.0e+00
WP_000979946.1|1453749_1454238_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954205.1|1454394_1454967_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144022.1|1455010_1455589_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
WP_000108515.1|1455588_1458051_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.2	8.1e-110
WP_000071702.1|1458053_1458584_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_001111955.1|1458576_1459473_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
WP_001435533.1|1459476_1459827_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.7e-59
WP_085952403.1|1459900_1461113_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_074434101.1|1462206_1463364_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	1.7e-22
WP_001289165.1|1463429_1464443_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024226472.1|1464442_1465255_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	1662953	1761724	5143533	protease,lysis,terminase,integrase,capsid,tRNA,head,holin,transposase,tail	Enterobacteria_phage(39.19%)	101	1679796:1679816	1736218:1736238
WP_000968208.1|1662953_1663649_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001295452.1|1663645_1664044_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_062882626.1|1664283_1665234_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|1665621_1665705_-	protein YohP	NA	NA	NA	NA	NA
WP_001078129.1|1665928_1667365_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079520.1|1667417_1668179_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001296821.1|1668308_1668887_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|1669056_1669644_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|1669817_1670750_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_062882579.1|1670787_1672503_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871510.1|1672698_1674996_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131274.1|1675247_1676165_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000220837.1|1676171_1677329_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_062882576.1|1677321_1678248_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1678252_1678984_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1678964_1679072_-	protein YohO	NA	NA	NA	NA	NA
WP_029208472.1|1679131_1679833_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
1679796:1679816	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063648.1|1679853_1681140_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1681173_1681428_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1681446_1681581_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1681584_1681827_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_095585854.1|1681914_1682175_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	82.3	1.5e-43
WP_021351746.1|1682665_1683436_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	98.8	6.2e-141
WP_000763383.1|1683432_1683654_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001443983.1|1683752_1684034_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|1684044_1684236_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|1684208_1684391_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|1684387_1685068_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|1685064_1685850_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1685855_1686152_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372941.1|1686227_1686371_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|1686339_1686504_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_072617038.1|1686576_1686945_-	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	100.0	2.0e-65
WP_001502698.1|1687095_1687566_-	hypothetical protein	NA	A0A1U9AJ69	Stx1_converting_phage	100.0	1.7e-88
WP_101974067.1|1687610_1688824_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_000198444.1|1688937_1689321_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_096851726.1|1689976_1691023_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	99.4	1.3e-205
WP_085949012.1|1691498_1692192_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_029793531.1|1692318_1692660_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	98.2	2.8e-61
WP_000250473.1|1692720_1693428_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1693506_1693734_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438542.1|1693872_1694169_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000185454.1|1694201_1695140_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_101974068.1|1695136_1695838_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	8.4e-129
WP_000145931.1|1695834_1696125_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736913.1|1696198_1696639_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_096851738.1|1696635_1697163_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	2.3e-99
WP_000335902.1|1697344_1698394_+	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_101974069.1|1698545_1699268_+	DNA-binding protein	NA	O48426	Enterobacteria_phage	96.7	3.6e-127
WP_101974070.1|1699267_1699873_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	99.0	8.1e-96
WP_001028864.1|1699869_1700541_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.9	1.6e-129
WP_096851751.1|1700531_1701020_+	antiterminator	NA	Q5TJL7	Enterobacteria_phage	99.4	7.7e-89
WP_101974071.1|1702097_1703948_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000411802.1|1704240_1704447_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_001135289.1|1704446_1704944_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|1704940_1705378_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|1705580_1706078_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1706074_1706332_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1706794_1707022_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279804.1|1707063_1707429_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
WP_000958372.1|1707718_1708282_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_101974072.1|1708278_1709940_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
WP_000173079.1|1710003_1711941_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001063025.1|1711985_1712207_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1714733_1715060_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|1715070_1715421_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_101974073.1|1715417_1715864_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	98.6	5.2e-76
WP_000133388.1|1715860_1716205_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275466.1|1716270_1716987_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.8e-127
WP_000710949.1|1717001_1717376_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1717471_1717681_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000807940.1|1720962_1721304_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_101974074.1|1721303_1722002_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	8.4e-129
WP_001302649.1|1722018_1722339_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1722446_1722620_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_101974075.1|1723627_1724365_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	92.2	1.1e-139
WP_122997399.1|1724310_1724943_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	3.5e-102
WP_101974076.1|1725178_1728655_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.6	0.0e+00
WP_001230412.1|1728721_1729321_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	100.0	1.0e-111
WP_101974175.1|1729385_1730699_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.3	2.0e-75
WP_001101698.1|1730700_1730970_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_096851743.1|1731080_1731662_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	60.0	4.3e-54
WP_096851744.1|1731993_1733238_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	91.1	2.0e-229
WP_072148138.1|1733890_1734301_-	secretion protein EspV	NA	Q6H9S1	Enterobacteria_phage	99.3	5.5e-72
WP_085949012.1|1735087_1735781_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062882067.1|1736506_1738192_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.3	8.1e-303
1736218:1736238	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|1738188_1738908_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_062882068.1|1738954_1739425_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.6e-81
WP_062882069.1|1739464_1739926_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_062882070.1|1740050_1741448_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	67.0	2.9e-237
WP_101974077.1|1741444_1742581_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.2e-162
WP_096851674.1|1742573_1744853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024226433.1|1744863_1745952_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636938.1|1746257_1746575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001343818.1|1750024_1750267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295427.1|1754211_1756245_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_062882073.1|1756376_1757486_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_024177741.1|1757748_1758030_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|1758321_1758864_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|1758944_1759619_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_085949012.1|1761029_1761724_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	1801539	1812371	5143533	terminase,tail	Escherichia_phage(36.36%)	16	NA	NA
WP_001097238.1|1801539_1802229_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_158638458.1|1802412_1803156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1803241_1803400_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_134792477.1|1803480_1803714_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	4.0e-11
WP_100224537.1|1804393_1804624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881662.1|1804782_1805316_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	2.4e-99
WP_001303555.1|1805471_1805654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1805666_1805798_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|1806025_1806211_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1806736_1807051_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|1807132_1807357_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_062881478.1|1807751_1808249_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.5	1.0e-11
WP_021351651.1|1809697_1810069_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_062881879.1|1810197_1810980_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.1	2.1e-144
WP_000950982.1|1811246_1812128_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_074433962.1|1812233_1812371_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	95.6	3.7e-17
>prophage 6
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	1853623	1861225	5143533		Enterobacteria_phage(33.33%)	7	NA	NA
WP_045903813.1|1853623_1855018_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	4.9e-19
WP_000183032.1|1855192_1856086_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_024226088.1|1856458_1857544_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.8	3.6e-102
WP_024226089.1|1857543_1858443_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_024226090.1|1858500_1859391_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	63.7	1.4e-104
WP_096851598.1|1859380_1860646_+	O177 family O-antigen flippase	NA	NA	NA	NA	NA
WP_024226092.1|1860658_1861225_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.8	1.9e-54
>prophage 7
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	1888287	2019924	5143533	protease,lysis,terminase,integrase,portal,plate,coat,head,holin,transposase,tail	Escherichia_phage(31.71%)	165	1946573:1946589	2029372:2029388
WP_001007947.1|1888287_1889466_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|1889446_1889638_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281190.1|1889717_1890062_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	1.5e-59
WP_101974176.1|1890446_1890779_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	98.7	2.8e-42
WP_001289918.1|1891281_1892052_-	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	99.6	1.9e-142
WP_000763383.1|1892048_1892270_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_077557169.1|1892368_1892650_-	cell division protein ZapA	NA	Q08J56	Stx2-converting_phage	98.9	2.5e-47
WP_000548528.1|1892660_1892852_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_101974082.1|1893002_1893683_-	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	99.6	1.3e-131
WP_101974083.1|1893679_1894465_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	5.3e-148
WP_000995449.1|1894470_1894767_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000372923.1|1894842_1894986_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|1894954_1895119_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_101974084.1|1895337_1895781_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	4.9e-82
WP_024177111.1|1895844_1896468_-	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	97.1	2.8e-107
WP_130078254.1|1896604_1896871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001595503.1|1896873_1897182_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	67.6	7.4e-29
WP_086557834.1|1897180_1897384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101974177.1|1897534_1898230_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_000067727.1|1898305_1898521_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_101974085.1|1898630_1898927_+	hypothetical protein	NA	G9L678	Escherichia_phage	95.9	3.7e-46
WP_023568658.1|1898949_1899222_+	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	3.0e-42
WP_101974086.1|1899224_1900172_+	replication protein	NA	A5VW95	Enterobacteria_phage	96.8	2.4e-150
WP_000806598.1|1900168_1901545_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.2e-253
WP_000103679.1|1902026_1902242_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1902252_1902489_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_101974087.1|1902445_1902892_+	recombination protein NinB	NA	A0A0P0ZEG6	Stx2-converting_phage	99.3	2.4e-81
WP_044697566.1|1902888_1903416_+	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	98.9	1.0e-99
WP_001254255.1|1903412_1903589_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_033810150.1|1903591_1903993_+	hypothetical protein	NA	G9L690	Escherichia_phage	96.2	6.6e-70
WP_077776196.1|1903952_1904162_+	protein ninF	NA	G9L691	Escherichia_phage	95.7	2.6e-30
WP_033810151.1|1904154_1904877_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.2	1.5e-128
WP_101974088.1|1904876_1905482_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	98.0	1.2e-96
WP_001028864.1|1905478_1906150_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.9	1.6e-129
WP_015973887.1|1906140_1906659_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	100.0	9.0e-96
WP_000783734.1|1907167_1907491_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_032204800.1|1907474_1907951_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	99.4	3.7e-88
WP_101974089.1|1907947_1908385_+|lysis	lysis protein	lysis	A0A220NRM0	Escherichia_phage	95.9	1.6e-69
WP_001543881.1|1908372_1908525_+	hypothetical protein	NA	C6ZR68	Salmonella_phage	100.0	1.2e-21
WP_000343115.1|1908603_1908891_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	1.8e-29
WP_158638455.1|1909177_1909336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807780.1|1909567_1909810_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	78.8	7.6e-29
WP_000179910.1|1909889_1910315_+	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_032204796.1|1910311_1911727_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	1.3e-277
WP_032204794.1|1911728_1913927_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.2	0.0e+00
WP_032204793.1|1914017_1914911_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	99.7	6.7e-131
WP_101974090.1|1914929_1916183_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	95.7	2.3e-225
WP_001389518.1|1916224_1916413_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_032204791.1|1916393_1916855_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	98.7	6.0e-83
WP_101974091.1|1916864_1918283_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	91.3	2.6e-254
WP_021514124.1|1918304_1918850_+	hypothetical protein	NA	A0A2H4FQU5	Salmonella_phage	54.4	1.5e-45
WP_032204787.1|1918842_1919544_+|tail	tail protein	tail	A0A2D1GLK3	Escherichia_phage	98.7	7.9e-119
WP_000627632.1|1919543_1919999_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	100.0	1.8e-87
WP_032204785.1|1920001_1920691_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	94.3	1.8e-107
WP_032204784.1|1920700_1922077_+	DNA transfer protein	NA	I6RSG0	Salmonella_phage	74.6	4.9e-181
WP_032204783.1|1922076_1923999_+	hypothetical protein	NA	I6R973	Salmonella_phage	83.1	8.4e-288
WP_063610642.1|1924023_1924392_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	99.2	1.7e-64
WP_032204781.1|1924530_1924950_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.8	1.5e-72
WP_021557681.1|1925006_1925543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021562328.1|1925542_1925797_-	Arc family DNA-binding protein	NA	A0A2H4FVY6	Salmonella_phage	84.1	4.1e-33
WP_000677939.1|1925887_1926049_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_032204812.1|1926117_1926996_+	antirepressor	NA	I6R977	Salmonella_phage	73.2	4.0e-88
WP_101974092.1|1931182_1932334_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	5.2e-43
WP_001200891.1|1932824_1933883_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1934054_1934384_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_158638459.1|1934542_1935553_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_085952403.1|1935551_1936764_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000973176.1|1938744_1939290_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_024226617.1|1939286_1940030_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_024226619.1|1940041_1941121_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986346.1|1941182_1942118_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011483.1|1942574_1943492_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011017.1|1943593_1944544_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122985555.1|1944661_1946305_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
1946573:1946589	attL	TTTTTTGATTTCTGTGT	NA	NA	NA	NA
WP_000532912.1|1946933_1947650_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1947992_1949447_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_062882557.1|1949548_1950865_-	shikimate transporter	NA	NA	NA	NA	NA
WP_062882558.1|1951179_1952232_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_101974093.1|1955789_1957003_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	3.5e-167
WP_001515476.1|1961371_1962169_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000693883.1|1963108_1963534_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_101974178.1|1964682_1965429_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.8	1.8e-113
WP_000450617.1|1965450_1966167_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000603384.1|1966199_1966481_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|1966477_1966705_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|1966697_1967009_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_044809747.1|1967105_1967354_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	78.6	2.2e-23
WP_000104474.1|1967355_1967913_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1968146_1968359_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1968478_1968823_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_062882007.1|1968944_1969217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265233.1|1969218_1970268_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_001217447.1|1970280_1970640_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_062882008.1|1970648_1971203_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	6.8e-65
WP_101974095.1|1971427_1971625_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	95.4	7.5e-27
WP_000301785.1|1971759_1972473_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000528254.1|1973226_1973964_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_001444515.1|1973917_1974118_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|1974232_1974697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|1974735_1974981_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|1975016_1975199_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|1975345_1977385_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|1977484_1978045_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|1978266_1978470_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|1978549_1979071_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|1979105_1980017_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|1980016_1980577_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|1980567_1981650_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|1981649_1982087_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|1982079_1982694_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|1982683_1983808_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|1983791_1985141_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113523.1|1985127_1987203_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|1987329_1987806_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|1987820_1988186_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|1988194_1989697_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|1989693_1989939_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|1989939_1990500_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|1990496_1990916_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002053.1|1990912_1991323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|1991366_1992314_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850822.1|1992313_1993438_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_000094808.1|1993614_1994088_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000046901.1|1994209_1995541_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000532592.1|1995524_1997114_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_001057665.1|1997113_1998778_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360581.1|1998777_1999359_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279082.1|1999361_1999652_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|1999648_1999957_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342747.1|1999937_2000165_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|2000174_2000393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|2000376_2000805_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|2000839_2001340_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|2001411_2001837_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214366.1|2001906_2002416_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000378480.1|2002412_2002709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|2002698_2002896_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_001310453.1|2002888_2003221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|2003236_2003587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633440.1|2003601_2003913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973023.1|2003909_2004461_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|2004464_2004980_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000578573.1|2004979_2005513_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000323221.1|2005516_2006059_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_001129553.1|2006156_2006687_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049306.1|2006698_2006992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|2006996_2007269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2007265_2007547_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|2007548_2007803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257930.1|2007815_2008037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|2008039_2008972_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_001512118.1|2009043_2011134_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
WP_001310454.1|2011135_2011384_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001056416.1|2011551_2012136_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_074434003.1|2012412_2012667_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.8	1.0e-36
WP_101974096.1|2013144_2015082_+	DUF1737 domain-containing protein	NA	A0A0P0ZBP4	Stx2-converting_phage	96.9	0.0e+00
WP_000143462.1|2015217_2015397_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290230.1|2015437_2015683_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|2015760_2015976_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_062881865.1|2015980_2016514_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.7	1.3e-100
WP_001056883.1|2016788_2017358_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455406.1|2017357_2017507_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_129014757.1|2017734_2017920_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	4.9e-20
WP_001302717.1|2018445_2018760_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001079070.1|2019393_2019924_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	1.6e-55
2029372:2029388	attR	ACACAGAAATCAAAAAA	NA	NA	NA	NA
>prophage 8
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	2419695	2422873	5143533		Escherichia_phage(33.33%)	6	NA	NA
WP_000902693.1|2419695_2419908_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
WP_072184779.1|2420075_2420354_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_001265156.1|2420355_2421405_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_096851745.1|2421417_2421777_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.8e-34
WP_096851746.1|2421773_2422463_+	antiterminator	NA	I6PDF8	Cronobacter_phage	47.6	2.7e-55
WP_000917733.1|2422675_2422873_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
>prophage 9
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	2551299	2608232	5143533	capsid,head,holin,transposase,tail	Stx2-converting_phage(45.71%)	50	NA	NA
WP_032312347.1|2551299_2552436_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001774450.1|2552953_2553187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881864.1|2556999_2558658_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	8.3e-26
WP_085949012.1|2559237_2559932_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881819.1|2560156_2560369_-	YncH family protein	NA	NA	NA	NA	NA
WP_062881818.1|2560444_2561062_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_001295649.1|2561328_2562828_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_000550675.1|2562942_2564004_-	YncE family protein	NA	NA	NA	NA	NA
WP_062881817.1|2564245_2566348_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
WP_062881816.1|2566383_2567049_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085949012.1|2567588_2568283_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881602.1|2568348_2568819_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001364659.1|2568862_2570908_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|2571044_2571791_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|2571879_2572566_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|2572743_2572947_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_062881604.1|2575812_2576688_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.3	2.1e-161
WP_095585841.1|2576828_2577098_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	3.2e-44
WP_101974109.1|2577099_2578413_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
WP_101974110.1|2578477_2579077_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
WP_101974111.1|2579143_2582536_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	88.3	0.0e+00
WP_000649829.1|2582669_2583197_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122994999.1|2583384_2584017_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.0	2.6e-97
WP_101974112.1|2583962_2584706_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	94.7	5.4e-142
WP_101974113.1|2584716_2585415_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.1	1.9e-128
WP_000807964.1|2585414_2585756_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_101974114.1|2585748_2588991_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.0	0.0e+00
WP_001513217.1|2589038_2589248_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710952.1|2589343_2589718_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275466.1|2589732_2590449_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.8e-127
WP_000133388.1|2590514_2590859_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_101974073.1|2590855_2591302_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	98.6	5.2e-76
WP_001007905.1|2591298_2591649_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2591659_2591986_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2594512_2594734_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_101974115.1|2594778_2596716_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.2	0.0e+00
WP_001303046.1|2597736_2598102_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|2598143_2598371_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000736096.1|2598739_2598964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|2599049_2599235_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000992122.1|2599752_2600286_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|2600336_2600681_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411809.1|2600685_2600892_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_101974116.1|2601339_2603190_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000216644.1|2603504_2603672_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.6	1.2e-09
WP_000961821.1|2605303_2605516_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_096851637.1|2605593_2606962_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_001320773.1|2607062_2607212_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2607283_2607457_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2607701_2608232_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 10
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	2831450	2941900	5143533	protease,lysis,terminase,integrase,capsid,tRNA,head,holin,transposase,tail	Enterobacteria_phage(31.17%)	130	2835600:2835615	2954530:2954545
WP_101974122.1|2831450_2832144_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881475.1|2832308_2833220_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2833426_2833888_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284270.1|2833964_2834624_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001297679.1|2834695_2834989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881471.1|2835230_2835632_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
2835600:2835615	attL	AAAAAATATAACGTCG	NA	NA	NA	NA
WP_001056859.1|2835751_2836120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881472.1|2836642_2837338_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2837361_2838174_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2838177_2838444_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|2839193_2839313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328621.1|2839273_2839459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|2839559_2839733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000726974.1|2839734_2840079_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_001295611.1|2840088_2840418_+	YmgD family protein	NA	NA	NA	NA	NA
WP_077879182.1|2840474_2842796_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.3	1.8e-90
WP_062881474.1|2843522_2843741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065752.1|2845725_2845974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888772.1|2846086_2846353_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858002.1|2846381_2846654_-	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000554153.1|2846696_2846933_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_096851686.1|2847246_2848458_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332308.1|2848662_2849394_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2849614_2850019_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_062881502.1|2850071_2850182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062881503.1|2850714_2851035_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.7	1.1e-38
WP_000539892.1|2851102_2851255_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001298108.1|2851734_2852172_+	acetyltransferase	NA	NA	NA	NA	NA
WP_158638457.1|2852196_2852418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074433926.1|2852428_2852782_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001171554.1|2853064_2853445_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2853441_2853789_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_032205137.1|2855735_2856689_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_062881457.1|2856875_2858360_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937499.1|2858543_2858849_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239870.1|2858905_2859574_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|2860071_2860254_+	general stress protein	NA	NA	NA	NA	NA
WP_062881458.1|2860332_2860833_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101974124.1|2860869_2861376_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488336.1|2861394_2862285_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_062881460.1|2862404_2862986_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.5e-102
WP_095585866.1|2862985_2866057_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_095585867.1|2866121_2866643_-|tail	phage tail tape measure protein	tail	A0A291AWV3	Escherichia_phage	100.0	2.2e-41
WP_000198149.1|2868092_2868299_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_062881689.1|2868295_2870221_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453622.1|2870195_2870741_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	3.1e-94
WP_062881690.1|2871129_2871324_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	3.7e-26
WP_001031427.1|2871488_2871695_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|2871980_2872391_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|2872682_2872976_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_012738274.1|2873066_2873249_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_001180491.1|2873465_2873942_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.0e-85
WP_000544528.1|2873928_2874234_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_000088653.1|2875374_2875611_+	excisionase	NA	NA	NA	NA	NA
WP_062881691.1|2875600_2876743_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.4	1.2e-204
WP_062881692.1|2876856_2878107_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.9e-22
WP_001248692.1|2878278_2878932_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476089.1|2878941_2879403_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|2879456_2880563_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2880598_2881240_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_062881693.1|2881243_2882614_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	3.2e-108
WP_001265481.1|2882782_2883454_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_062881694.1|2883453_2884914_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|2884989_2886111_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|2886159_2887386_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|2887635_2888772_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_062881695.1|2888755_2889619_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.2	2.0e-10
WP_001144080.1|2890665_2891316_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|2891390_2892449_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|2892576_2893212_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|2893279_2893861_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_101974125.1|2893972_2894242_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	2.3e-42
WP_062882369.1|2895621_2896245_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.3e-69
WP_101974126.1|2896313_2899790_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.2	0.0e+00
WP_137534157.1|2900025_2900658_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.4	1.2e-97
WP_101974128.1|2900603_2901347_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.3e-147
WP_001335877.1|2901357_2902056_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|2902055_2902397_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001513217.1|2905677_2905887_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030060.1|2905982_2906357_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275471.1|2906362_2907079_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000133388.1|2907144_2907489_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2907485_2907932_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2907928_2908279_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2908288_2908615_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063025.1|2911140_2911362_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_058157541.1|2911406_2913344_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_101974129.1|2913407_2915069_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|2915065_2915629_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_101974130.1|2915919_2916285_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	4.2e-63
WP_001341372.1|2916326_2916512_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_000347013.1|2916641_2916782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2917194_2917380_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092872.1|2917898_2918432_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	6.2e-100
WP_001041949.1|2918943_2919735_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000411809.1|2919738_2919945_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000143031.1|2920235_2922086_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001359877.1|2922656_2923088_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
WP_000498122.1|2923266_2923488_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.0e-20
WP_000735807.1|2923540_2923765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000935559.1|2924144_2925203_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	91.8	1.6e-192
WP_001429230.1|2925353_2925551_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	4.0e-28
WP_001064890.1|2925769_2926453_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.9	1.2e-55
WP_000904126.1|2926449_2926809_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	1.7e-37
WP_016241288.1|2926821_2927871_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_024184173.1|2927872_2928151_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	6.3e-11
WP_072127062.1|2928091_2928289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818169.1|2928266_2928752_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119357.1|2928770_2928950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206829.1|2929281_2929626_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	92.1	9.7e-54
WP_000212748.1|2929629_2929917_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	95.8	2.5e-47
WP_001429226.1|2929919_2930279_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.6	1.3e-37
WP_001224669.1|2930444_2930627_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	1.0e-25
WP_016241289.1|2930774_2931080_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.0	1.5e-50
WP_000017336.1|2931076_2931394_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	71.6	3.0e-33
WP_000450619.1|2931390_2932107_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.0e-73
WP_000788764.1|2932128_2932875_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	8.1e-114
WP_000095674.1|2932881_2933850_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
WP_000693888.1|2933872_2934298_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|2934281_2934563_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|2934663_2935083_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379562.1|2935348_2935501_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	7.8e-08
WP_000394548.1|2935512_2936151_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2936151_2936361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450219.1|2936928_2937117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199482.1|2937113_2937302_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032185406.1|2937394_2939938_+	exonuclease	NA	V5UQJ3	Shigella_phage	69.8	7.1e-234
WP_000003739.1|2939999_2940269_+	excisionase	NA	NA	NA	NA	NA
WP_101974131.1|2940237_2941356_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.7	3.5e-84
WP_001113310.1|2941432_2941900_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
2954530:2954545	attR	AAAAAATATAACGTCG	NA	NA	NA	NA
>prophage 11
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	3028697	3135648	5143533	protease,terminase,integrase,holin,transposase,tail	Escherichia_phage(23.81%)	111	3085906:3085965	3120503:3120567
WP_085949012.1|3028697_3029392_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_004015384.1|3029468_3029840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001061095.1|3029841_3030255_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000258765.1|3030304_3031369_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
WP_001199453.1|3031712_3032984_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154413.1|3032989_3034117_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001018495.1|3035673_3037182_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_085949012.1|3037540_3038234_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001365086.1|3038378_3042341_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004993148.1|3042380_3043019_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001352489.1|3043306_3044398_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307100.1|3044397_3045090_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_062882336.1|3045101_3045488_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307099.1|3045495_3046296_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001183.1|3046305_3046896_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028096.1|3046906_3047401_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_001365093.1|3047421_3048750_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	2.8e-234
WP_001273658.1|3048832_3049006_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_062882335.1|3049378_3049975_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3049995_3050223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044273.1|3050260_3051502_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_062882334.1|3051792_3053052_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420617.1|3053312_3054233_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_062882333.1|3054232_3054538_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209866.1|3054630_3055230_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_062882332.1|3055226_3057773_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.5	1.2e-71
WP_062882331.1|3057772_3058945_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3059074_3059767_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264919.1|3059739_3060768_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_074434056.1|3060850_3063595_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818470.1|3063666_3064740_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3064788_3064962_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_021292990.1|3064951_3065182_-	protein YmcE	NA	NA	NA	NA	NA
WP_101974132.1|3065156_3065360_-	cold-shock protein	NA	NA	NA	NA	NA
WP_001352368.1|3065356_3066565_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000066490.1|3066693_3066906_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3067191_3067404_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|3067845_3068151_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_062882329.1|3068257_3068902_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038079.1|3068898_3069645_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742345.1|3069644_3071741_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001343234.1|3071786_3072926_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3072913_3073360_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208650.1|3073379_3075560_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_024226935.1|3075674_3076973_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|3077052_3077145_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460803.1|3077157_3078294_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_062882328.1|3078305_3079850_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_062882327.1|3079983_3080841_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063978.1|3080837_3081236_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_062882326.1|3081232_3081820_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186423.1|3081816_3082524_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_062882325.1|3082542_3084336_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3084332_3085451_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
3085906:3085965	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_095585410.1|3086046_3086199_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_000938124.1|3086575_3087937_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023483.1|3088391_3088661_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_097481428.1|3088698_3090270_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	3.8e-169
WP_000624622.1|3090289_3090637_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3090636_3091314_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_032284669.1|3091369_3092683_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.4	9.7e-78
WP_001230428.1|3092747_3093347_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_101974133.1|3093413_3095180_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.3	0.0e+00
WP_001358663.1|3095911_3097108_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_000235436.1|3097370_3097880_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_032243757.1|3098282_3098507_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|3098588_3098903_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3099430_3099616_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3099837_3099951_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3100171_3100705_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3100864_3101137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|3101392_3101599_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_101974181.1|3103266_3104491_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.1e-176
WP_085952403.1|3105475_3106689_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_062881813.1|3107081_3107855_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|3108220_3108358_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|3108402_3108615_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_074433979.1|3108782_3109061_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|3109062_3110112_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|3110124_3110496_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|3110485_3110857_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|3111008_3111827_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|3112113_3112311_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000887453.1|3112936_3113209_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3113317_3113719_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3113746_3113938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3113937_3114225_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3114501_3114657_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_032205089.1|3114798_3115188_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	30.0	1.5e-05
WP_032205087.1|3115374_3115560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3116133_3116322_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3116318_3116510_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_009448824.1|3116603_3119054_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|3119121_3119364_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3119341_3120361_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_062882278.1|3120768_3121428_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.5	6.2e-41
3120503:3120567	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
WP_000904442.1|3121518_3121848_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000048252.1|3121844_3122123_-	acylphosphatase	NA	NA	NA	NA	NA
WP_062882280.1|3122217_3123408_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_001295356.1|3123465_3123783_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001343235.1|3123827_3124241_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_060616790.1|3124413_3125076_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424181.1|3125171_3125630_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420537.1|3125661_3127716_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_062882281.1|3127838_3128285_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_074434046.1|3128294_3130457_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_032186268.1|3130419_3131049_-	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000288710.1|3131267_3131777_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_062882317.1|3132133_3133174_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877161.1|3133249_3133702_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_062882282.1|3133887_3135648_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 12
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	3441968	3457363	5143533	transposase,integrase,holin,tail	Enterobacteria_phage(41.18%)	23	3443884:3443898	3457437:3457451
WP_024225839.1|3441968_3443258_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-18
WP_000767391.1|3443316_3443793_+	kinase inhibitor	NA	NA	NA	NA	NA
3443884:3443898	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_052915805.1|3444296_3444950_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_000354291.1|3444962_3445184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|3445267_3445648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881704.1|3445647_3445893_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.5	2.4e-30
WP_000284515.1|3446117_3446333_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_033816266.1|3446475_3446874_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3446954_3447113_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3447199_3447943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3448195_3448819_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_095585803.1|3448815_3449481_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	98.6	7.2e-130
WP_032205168.1|3449633_3449816_+	hypothetical protein	NA	A0A1I9LJN0	Stx_converting_phage	98.3	7.2e-24
WP_095585804.1|3449812_3450493_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.3	5.6e-130
WP_000682294.1|3450489_3450651_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|3450643_3451201_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|3451211_3451493_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_096851764.1|3451591_3451849_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.1	2.0e-32
WP_101974139.1|3451854_3453067_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.6	2.5e-168
WP_074433965.1|3454034_3454643_+	ead/Ea22-like family protein	NA	Q9MCR3	Enterobacteria_phage	96.4	5.0e-21
WP_000789829.1|3454773_3455472_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.9	1.5e-101
WP_001303965.1|3455708_3456008_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000533642.1|3456292_3457363_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3457437:3457451	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	3905655	3943160	5143533	transposase,integrase	Stx2-converting_phage(33.33%)	41	3908932:3908945	3915584:3915597
WP_085949012.1|3905655_3906350_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000150119.1|3906861_3907497_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3907554_3908223_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
3908932:3908945	attL	TCCAGTTGTTTCAT	NA	NA	NA	NA
WP_000772643.1|3908941_3910156_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000144685.1|3910532_3911852_+|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.4	5.6e-17
WP_001280444.1|3911944_3912793_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000875212.1|3913075_3914095_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000839232.1|3914308_3914506_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761703.1|3914517_3915006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094440.1|3915002_3915380_-	toxin	NA	NA	NA	NA	NA
WP_024166067.1|3915426_3915804_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
3915584:3915597	attR	TCCAGTTGTTTCAT	NA	NA	NA	NA
WP_000692350.1|3915878_3916100_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001367144.1|3916186_3916663_-	RadC family protein	NA	NA	NA	NA	NA
WP_001449312.1|3916678_3917158_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.6	1.2e-12
WP_000680583.1|3917251_3917497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234621.1|3917496_3918315_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000846706.1|3918535_3918946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775504.1|3918961_3919645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102618.1|3919778_3920849_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203548.1|3920845_3921751_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000544649.1|3921747_3924132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000521941.1|3925517_3926105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000721150.1|3926436_3927063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422746.1|3927519_3927945_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	1.3e-47
WP_000624720.1|3927941_3928292_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	6.2e-40
WP_001171554.1|3929702_3930083_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3930079_3930427_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998072.1|3930476_3932015_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	2.7e-297
WP_000333617.1|3932520_3932748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000885242.1|3932782_3933286_-	CdiI family contact-dependent growth inhibition immunity protein	NA	NA	NA	NA	NA
WP_000017595.1|3934453_3934975_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000767171.1|3935238_3935514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410312.1|3935482_3936091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000792318.1|3936321_3936576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000501573.1|3936565_3936814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|3938438_3939254_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|3939340_3939643_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|3939536_3939788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|3940026_3940863_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|3940862_3941666_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001303003.1|3941951_3943160_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	2.0e-234
>prophage 14
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	4008537	4084314	5143533	transposase,protease,plate,tRNA	uncultured_Caudovirales_phage(12.5%)	58	NA	NA
WP_085949012.1|4008537_4009231_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001230983.1|4009489_4010290_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016005.1|4010293_4010917_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_101974149.1|4010965_4012324_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	1.3e-08
WP_001052727.1|4012395_4013151_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|4013184_4013907_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4013903_4014371_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|4014435_4015167_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086140.1|4015705_4016491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062882465.1|4016627_4017107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|4017116_4018031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|4018074_4018557_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_158638461.1|4019943_4023378_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_062882459.1|4023486_4024899_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_101974151.1|4024903_4025647_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_062882456.1|4028674_4030525_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|4030528_4030942_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_062882455.1|4030948_4032424_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123966.1|4032474_4032699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062882454.1|4032733_4033234_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_085949012.1|4036380_4037075_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001140188.1|4042831_4043407_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_096851513.1|4043594_4044626_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	1.2e-35
WP_001294600.1|4044618_4045272_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4045311_4046127_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4046244_4046649_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_032178897.1|4046645_4047353_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260711.1|4047463_4049182_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062881393.1|4050212_4050923_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|4050936_4051359_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000417058.1|4051786_4051987_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4051973_4052234_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_062881392.1|4052282_4053581_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4053645_4054035_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021017.1|4054091_4056233_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4056331_4057291_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_062881391.1|4057303_4060786_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.1e-208
WP_000569419.1|4060822_4061419_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_062881390.1|4061415_4062564_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565967.1|4062563_4063352_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4063355_4063811_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|4063915_4064941_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4064944_4065430_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4065551_4067984_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4068013_4069366_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_000922436.1|4069377_4070235_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295562.1|4070247_4071006_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000811923.1|4071194_4072391_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000622418.1|4072482_4073040_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000224573.1|4073331_4074057_-	UMP kinase	NA	NA	NA	NA	NA
WP_000818114.1|4074203_4075055_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_000246884.1|4075311_4076037_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_001018194.1|4076404_4077199_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_062881389.1|4077260_4079933_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_062881388.1|4079963_4080788_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_000272188.1|4081102_4081489_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_000929439.1|4081577_4082735_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000753946.1|4082889_4084314_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 15
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	4265292	4306478	5143533	tRNA,tail	Enterobacteria_phage(23.53%)	40	NA	NA
WP_001223181.1|4265292_4265979_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4266378_4266519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4266614_4267331_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_062881915.1|4267390_4268743_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_062881916.1|4268800_4270225_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	3.6e-09
WP_001188659.1|4270224_4270914_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4270926_4271400_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4271610_4272480_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_062881918.1|4272476_4273124_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_024177800.1|4273175_4273688_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4273834_4274161_-	trp operon repressor	NA	NA	NA	NA	NA
WP_062881919.1|4274250_4276188_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.7	2.3e-11
WP_000046749.1|4276398_4278066_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093813.1|4278372_4279605_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029692.1|4279625_4281008_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|4281056_4282025_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_062881920.1|4282130_4282775_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105843.1|4282802_4283819_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_101974154.1|4283819_4285151_-	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000224877.1|4285317_4286037_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4286093_4287317_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_062881922.1|4287368_4288691_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	6.8e-79
WP_062881923.1|4288857_4289637_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_062881924.1|4289895_4291446_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_077879197.1|4291417_4291570_+	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_062881925.1|4291576_4292281_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_062881926.1|4292393_4293176_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299187.1|4293172_4294246_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4294367_4294529_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295410.1|4294655_4295261_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|4295653_4297240_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|4297459_4297708_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001023420.1|4298076_4298346_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_101974155.1|4298347_4299661_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	3.2e-81
WP_101974156.1|4299725_4300325_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
WP_101974157.1|4300391_4303871_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.5	0.0e+00
WP_158638462.1|4304106_4304739_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	9.0e-106
WP_101974159.1|4304684_4305428_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	9.8e-144
WP_001152185.1|4305438_4306137_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_000807964.1|4306136_4306478_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
>prophage 16
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	4309759	4354836	5143533	lysis,terminase,integrase,capsid,head,holin,transposase,tail	Escherichia_phage(43.75%)	60	4325920:4325979	4354086:4354852
WP_001513217.1|4309759_4309969_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030063.1|4310064_4310439_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275479.1|4310444_4311161_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133388.1|4311226_4311571_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|4311567_4312014_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000125984.1|4312369_4312696_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|4315221_4315443_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_053904683.1|4315487_4317425_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
WP_096957675.1|4317488_4319150_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958416.1|4319146_4319710_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_101974130.1|4320000_4320366_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	4.2e-63
WP_000095736.1|4320407_4320635_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001283921.1|4321097_4321355_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|4321351_4321849_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092313.1|4322051_4322489_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001135289.1|4322485_4322983_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000284515.1|4322982_4323198_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|4323274_4323547_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|4323587_4323767_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_101974160.1|4323903_4325841_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.1	0.0e+00
4325920:4325979	attL	GGTGATGCCTCTAATTAGTTGAATCTGATGTATAATACGGGCTTTTGAGGTTATCTCATG	NA	NA	NA	NA
WP_085949012.1|4325976_4326670_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001303568.1|4326858_4327182_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|4327478_4327748_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_062881835.1|4327759_4328719_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	99.7	9.6e-176
WP_001356551.1|4329107_4329260_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|4329508_4329943_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_044164955.1|4329935_4330130_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	98.4	1.4e-30
WP_000813671.1|4330126_4330690_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|4330697_4331147_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001694414.1|4331146_4332118_-	toprim domain protein	NA	A0A0H4IPK0	Shigella_phage	100.0	1.9e-195
WP_021500588.1|4332107_4333628_-	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	99.8	8.3e-307
WP_001271434.1|4333621_4333999_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	98.4	7.6e-60
WP_001302923.1|4334165_4334360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240875.1|4334530_4334734_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
WP_001056250.1|4334829_4335543_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939560.1|4335637_4337107_+	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.6	1.9e-284
WP_001064714.1|4337103_4338057_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_101974161.1|4338560_4339460_+	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	95.8	3.9e-139
WP_000917252.1|4339530_4339743_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934197.1|4339754_4340036_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|4340056_4340338_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_062882635.1|4340354_4341305_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	96.8	2.0e-173
WP_044804878.1|4341301_4341982_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	98.2	1.9e-130
WP_074434105.1|4341978_4342155_+	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	1.3e-22
WP_000548531.1|4342132_4342324_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001447493.1|4342334_4342616_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
WP_000763383.1|4342714_4342936_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_101974162.1|4342932_4343619_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	87.1	3.7e-121
WP_096851707.1|4344121_4344454_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	100.0	1.5e-43
WP_024201788.1|4345521_4346427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218294.1|4346598_4347822_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
WP_000870712.1|4348204_4348882_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_001092461.1|4348896_4349343_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000204018.1|4349311_4349725_-	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_062881369.1|4349827_4350859_+	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_001558501.1|4351419_4351656_-	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_062881368.1|4351796_4352585_+	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001300509.1|4352621_4353299_-	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_047082098.1|4353256_4353982_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_085949012.1|4354142_4354836_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
4354086:4354852	attR	GGTGATGCCTCTAATTAGTTGAATCTGATGTATAATACGGGCTTTTGAGGTTATCTCATGGCCAGCGTTAATATTCATTGTCCCCGTTGTCAGTCAGCTCAGGTTTACCGCCATGGTCAGAACCCTAAAGGCCGTGACAGATTTCGCTGCCGTGACTGCCACCGTGTGTTTCAGCTCACTTATACTTATCAAGCACGTAAGCCGGGTATGAAAGAGCTGATAACTGAAATGGCCTTTAATGGTGCCGGGGTTCGCGATACCGCCAGGACACTGAAAATTGGTATTAACACCGTCATCCGGACTTTAAAAAACTCGCGCCAAAGCGAATAACGTCTTCGCCTGTTGCCCATGCTGATGTGGCGCTTATCTGCGAGCTTGATGAGCAATGGAGCTACGTTGGCAGTAAAGCCCGGCAACACTGGCTCTGGTACGCGTACAACACCAAAACAGGCGGTGTACTGGCCTACACTTTTGGTCCCCGAACCGATCAAACGTGCCGGGAGCTACTGGCACTGCTTACACCCTTCAACATCGGCATGCTGACCAGCGATGACTGGGGCAGCTATGGCCGGGAGGTGCCGAAGAATAAGCATCTGACCGGCAAAATATTCACCCAACGCATTGAGCGTAATAATCTGACGCTACGCACCCGCATTAAGCGGTTGGCTCGTAAAACAATCTGCTTCTCACGCTCAGTTGAGATCCACGAAAAAGTGATCGGAGCGTTTATCGAAAAACACATGTTCTACTAATTGGATGCACTACCA	NA	NA	NA	NA
>prophage 17
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	4378759	4428736	5143533	transposase,protease,integrase,tRNA	Sodalis_phage(12.5%)	40	4414266:4414281	4427799:4427814
WP_085949012.1|4378759_4379453_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000132623.1|4379564_4379906_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_062881594.1|4379952_4382046_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000394278.1|4382143_4382308_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_000199311.1|4382484_4383897_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_062881595.1|4384139_4385084_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	5.9e-61
WP_001380871.1|4385080_4385293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881596.1|4385550_4386783_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_062881597.1|4386823_4388104_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001299707.1|4388219_4389371_+	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_000222496.1|4389380_4390148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657675.1|4390144_4390402_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_001298932.1|4390466_4391327_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001141195.1|4391394_4392573_+	MFS transporter	NA	NA	NA	NA	NA
WP_062881598.1|4392585_4393140_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.0e-37
WP_001295597.1|4393389_4394073_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|4394069_4394531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096851662.1|4394543_4395716_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340758.1|4395780_4396692_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_001297236.1|4396684_4397077_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|4397073_4397157_-	iraD leader peptide	NA	NA	NA	NA	NA
WP_062881599.1|4397749_4398577_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000833691.1|4398717_4399491_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_062881600.1|4399705_4401166_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.9e-50
WP_062881601.1|4401246_4402431_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_000558251.1|4402770_4404114_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_096851664.1|4404286_4405189_-	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000870589.1|4405208_4405712_-	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_001244822.1|4405724_4406255_-	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_096851663.1|4406264_4408901_-	fimbrial biogenesis usher protein FimD	NA	NA	NA	NA	NA
WP_085949012.1|4409356_4410050_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_106879271.1|4410664_4414756_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	9.0e-311
4414266:4414281	attL	ACTTCTGTAACAAGCT	NA	NA	NA	NA
WP_085949012.1|4416016_4416711_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_024225922.1|4416801_4418064_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.2	1.7e-79
WP_014639402.1|4418530_4419550_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	2.4e-44
WP_001295681.1|4421343_4422426_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584117.1|4422425_4423526_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_062882097.1|4423792_4425304_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	1.0e-46
WP_122994985.1|4425398_4425881_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_062882096.1|4425880_4428736_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	7.9e-141
4427799:4427814	attR	ACTTCTGTAACAAGCT	NA	NA	NA	NA
>prophage 18
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	4488807	4534258	5143533	transposase,protease,tRNA	Ralstonia_phage(12.5%)	46	NA	NA
WP_085949012.1|4488807_4489501_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_106879272.1|4489506_4490121_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4490191_4490641_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4490682_4490910_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4490914_4491229_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4491235_4491631_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_062882078.1|4491957_4492233_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_096851693.1|4492307_4492859_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_001170827.1|4492955_4493642_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000949540.1|4493641_4494496_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000056760.1|4494505_4495156_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_096851694.1|4495169_4495634_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218360.1|4495643_4495949_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001350568.1|4495964_4497362_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001301370.1|4497716_4498781_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4498888_4499644_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569726.1|4499640_4500390_-	esterase	NA	NA	NA	NA	NA
WP_000254642.1|4500571_4500901_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_024225902.1|4501049_4501325_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|4501441_4503067_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_062882075.1|4503149_4504301_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.6	3.1e-80
WP_000101670.1|4504303_4504942_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_029785204.1|4504951_4505293_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_101974164.1|4506527_4507679_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000220137.1|4508016_4508418_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4508545_4509277_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_062882710.1|4509457_4511899_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	2.9e-67
WP_001177639.1|4511937_4512363_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4512567_4513866_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4513969_4514167_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4514248_4515253_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4515255_4516515_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_062882709.1|4516600_4517881_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4517957_4518266_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|4518351_4519302_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_062882708.1|4519294_4521142_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_000990262.1|4521151_4522486_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4522504_4522966_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001295189.1|4522937_4524485_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_062882707.1|4524483_4525623_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4525605_4525659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4526523_4527069_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4527163_4528216_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934912.1|4528312_4529281_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_032204757.1|4529302_4532626_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_085949012.1|4533564_4534258_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP023673	Escherichia coli strain SMN013SH2 chromosome, complete genome	5143533	4682133	4753157	5143533	terminase,integrase,tRNA,plate,holin,transposase,tail	Stx2-converting_phage(30.16%)	78	4685435:4685452	4712042:4712059
WP_085949012.1|4682133_4682828_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001295689.1|4683584_4683866_+	membrane protein	NA	NA	NA	NA	NA
WP_000168305.1|4683964_4684501_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_062881699.1|4684755_4687578_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
4685435:4685452	attL	TTTCCGGTGGTACAGCGG	NA	NA	NA	NA
WP_000155657.1|4687612_4687969_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270372.1|4687972_4688389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001226928.1|4688499_4689213_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_024225944.1|4690338_4691532_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_062881698.1|4691784_4692864_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	4.0e-29
WP_000918363.1|4692916_4694332_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235516.1|4694414_4695398_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001142084.1|4697742_4701129_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	100.0	0.0e+00
WP_085949012.1|4701673_4702368_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000135680.1|4702461_4702824_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081298.1|4702889_4703714_+	YfdQ family protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	100.0	2.7e-150
WP_000008181.1|4703841_4704378_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	100.0	9.7e-101
WP_001242742.1|4704368_4704719_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	100.0	7.0e-60
WP_000556583.1|4705846_4705981_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|4705999_4706254_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063646.1|4706287_4707574_+|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
WP_001146835.1|4707721_4708804_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301578.1|4708794_4709355_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_000469167.1|4709354_4710266_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	39.5	6.4e-28
WP_000420351.1|4710300_4710822_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|4710901_4711105_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|4711326_4711887_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_000543828.1|4712813_4713851_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
4712042:4712059	attR	TTTCCGGTGGTACAGCGG	NA	NA	NA	NA
WP_000528254.1|4714304_4715042_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_001444515.1|4714995_4715196_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001114107.1|4715810_4716056_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000221106.1|4716091_4716271_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	55.3	6.0e-07
WP_101974168.1|4716328_4717843_-	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	60.1	1.2e-164
WP_101974169.1|4719086_4720625_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_000612591.1|4720674_4721022_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4721018_4721399_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_062881456.1|4721497_4721713_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	98.6	1.9e-31
WP_122993102.1|4722084_4723098_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|4723312_4723390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101700.1|4723500_4723770_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_101974170.1|4723771_4725085_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	3.6e-80
WP_101974156.1|4725149_4725749_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
WP_101974171.1|4725815_4729295_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.5	0.0e+00
WP_101974172.1|4729299_4729563_-	hypothetical protein	NA	A0A0N7KZG0	Stx2-converting_phage	100.0	3.7e-45
WP_000958416.1|4729559_4730123_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001303046.1|4730410_4730776_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|4730817_4731045_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_012578895.1|4731469_4731655_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000992122.1|4732172_4732706_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|4732756_4733101_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411809.1|4733105_4733312_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_101974173.1|4733759_4735610_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001344632.1|4736052_4736184_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_062882414.1|4737054_4738113_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	4.9e-181
WP_000917723.1|4738263_4738467_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_096851713.1|4738737_4739184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001577385.1|4739268_4739634_-	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	81.8	7.9e-54
WP_062882412.1|4739651_4740641_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001072673.1|4740648_4741464_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.9e-149
WP_062882411.1|4741626_4742022_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	96.0	9.1e-64
WP_000066918.1|4742018_4742672_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_044806531.1|4742766_4743573_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	7.9e-123
WP_024185668.1|4743569_4743794_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	8.5e-35
WP_001542463.1|4743798_4744344_-	ash family protein	NA	Q8SBF3	Shigella_phage	98.9	4.0e-94
WP_071593530.1|4744306_4744486_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	94.9	5.0e-30
WP_000521508.1|4744632_4745184_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|4745227_4745428_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_062881953.1|4745518_4746193_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.1	8.6e-131
WP_000135680.1|4746861_4747224_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|4747288_4748113_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008232.1|4748240_4748777_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_062881955.1|4748767_4749130_+	hypothetical protein	NA	S5MC15	Escherichia_phage	99.2	2.1e-67
WP_062881956.1|4749126_4749330_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	5.2e-31
WP_000476212.1|4749322_4749562_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
WP_040092683.1|4749558_4750113_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	99.5	4.1e-102
WP_001014289.1|4750114_4750306_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	1.6e-26
WP_001061345.1|4751315_4751888_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
WP_001093917.1|4751924_4752206_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_062881958.1|4752623_4753157_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	99.4	5.3e-99
>prophage 1
NZ_CP023674	Escherichia coli strain SMN013SH2 plasmid pO177A2, complete sequence	87524	1461	57937	87524	integrase,transposase,tRNA,protease	Stx2-converting_phage(44.44%)	48	829:843	16441:16455
829:843	attL	AAGAATATTTATCTG	NA	NA	NA	NA
WP_062882567.1|1461_2202_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361612.1|2486_3464_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_000772446.1|4795_5962_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|5961_6933_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_096851684.1|7584_8487_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_062881562.1|8490_8796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085939.1|8872_9556_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_010891293.1|11344_11647_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|11693_12116_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|12112_12304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101974182.1|12422_12809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062881567.1|13049_13337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074433935.1|13747_15139_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000864318.1|15165_15423_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_062881569.1|15415_16159_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_001287908.1|16174_16522_+	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
16441:16455	attR	AAGAATATTTATCTG	NA	NA	NA	NA
WP_062881570.1|16879_17164_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_000059833.1|17150_17696_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_074433933.1|17625_17967_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_074433934.1|17920_18346_+	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_062881573.1|18332_19706_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_096851683.1|19702_22480_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_096851682.1|22493_23656_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000850423.1|24178_24910_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_101974067.1|25544_26757_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_001014904.1|27706_27949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302199.1|28215_29037_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_064769442.1|29036_30143_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|30232_31954_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|32027_33026_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_101974169.1|33619_35158_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_000612591.1|35207_35555_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|35551_35932_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_032205206.1|36165_36531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789660.1|36541_36733_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	3.5e-05
WP_101974183.1|37037_40940_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.3	1.6e-237
WP_101974169.1|41382_42921_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_000612591.1|42970_43318_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|43577_43958_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|43954_44302_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_101974169.1|44351_45890_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	6.5e-299
WP_062882354.1|45947_46361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000864811.1|47317_47671_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_032204690.1|48073_49513_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987096.1|49516_51637_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_062882355.1|51686_54683_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|54684_55200_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000911317.1|57538_57937_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
