The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	0	43627	5302502	holin,tail,transposase,terminase	Stx2-converting_phage(36.67%)	39	NA	NA
WP_000521508.1|0_552_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_071593530.1|698_878_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	94.9	5.0e-30
WP_001542463.1|840_1386_+	ash family protein	NA	Q8SBF3	Shigella_phage	98.9	4.0e-94
WP_000933947.1|1378_1615_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	96.2	1.9e-37
WP_044806531.1|1611_2418_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	7.9e-123
WP_000066918.1|2512_3166_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.5	3.3e-127
WP_062882411.1|3162_3558_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	96.0	9.1e-64
WP_001072673.1|3720_4536_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.9e-149
WP_062882412.1|4543_5533_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001577385.1|5550_5916_+	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	81.8	7.9e-54
WP_096851713.1|6000_6447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917723.1|6717_6921_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_062882414.1|7071_8130_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	4.9e-181
WP_001344632.1|9000_9132_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000411809.1|11861_12068_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731236.1|12072_12417_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|12467_13001_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_012578895.1|13516_13702_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000095749.1|14126_14354_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|14395_14761_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958416.1|15048_15612_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_101974172.1|15608_15872_+	hypothetical protein	NA	A0A0N7KZG0	Stx2-converting_phage	100.0	3.7e-45
WP_101975780.1|16841_19352_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.7	0.0e+00
WP_101975677.1|19418_20018_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.0e-110
WP_101975781.1|21166_21394_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	94.7	3.2e-37
WP_001101699.1|21395_21665_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_085949012.1|24574_25269_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_096851731.1|25304_28019_-	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	100.0	0.0e+00
WP_000235516.1|30363_31347_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|31429_32845_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_062881698.1|32897_33977_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	4.0e-29
WP_024225944.1|34229_35423_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_001226928.1|36548_37262_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_000270372.1|37372_37789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155657.1|37792_38149_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_062881699.1|38183_41006_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|41260_41797_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_001295689.1|41895_42177_-	membrane protein	NA	NA	NA	NA	NA
WP_085949012.1|42933_43627_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	165338	224749	5302502	tRNA,protease,transposase	Vibrio_phage(15.38%)	51	NA	NA
WP_101974166.1|165338_166612_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	4.9e-175
WP_024225892.1|169635_170211_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_062881561.1|170247_171945_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|171920_172259_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|172374_173676_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|173793_175230_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|175566_176043_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015871.1|176058_177315_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|177590_177884_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|177927_179574_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|179711_180065_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008071.1|180267_181137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881559.1|181531_182560_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|182601_183168_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|183219_183345_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|183455_183602_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|183783_184101_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|184097_184631_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_062881558.1|184719_185853_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|185915_186275_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_096851679.1|186285_186681_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829502.1|186691_187426_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192973.1|187418_189227_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|189551_190529_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_085949012.1|191541_192236_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_032204757.1|193174_196498_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934912.1|196519_197488_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|197584_198637_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|198731_199277_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|200141_200195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062882707.1|200177_201317_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001295189.1|201315_202863_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|202834_203296_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990262.1|203314_204649_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_062882708.1|204658_206506_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
WP_001280345.1|206498_207449_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|207534_207843_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_062882709.1|207919_209200_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|209285_210545_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|210547_211552_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|211633_211831_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|211934_213233_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|213437_213863_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_062882710.1|213901_216343_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	2.9e-67
WP_001293282.1|216523_217255_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|217381_217783_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_101974164.1|218120_219272_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_029785204.1|220506_220848_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_062882075.1|221497_222649_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.6	3.1e-80
WP_001299838.1|222731_224357_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_024225902.1|224473_224749_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 3
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	274409	381784	5302502	plate,protease,tRNA,integrase,transposase,tail	Stx2-converting_phage(26.32%)	93	309030:309089	381783:382549
WP_001162171.1|274409_275762_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232246.1|275816_276203_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106233.1|276247_276712_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187776.1|276870_279009_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_062882091.1|279402_281058_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001297258.1|281107_282529_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|282647_283595_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|283779_283833_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_096851601.1|283973_286670_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|286875_287262_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|287334_287796_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|287808_288744_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|288747_288882_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|289162_289558_-	RidA family protein	NA	NA	NA	NA	NA
WP_062882093.1|289688_290402_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062882094.1|290472_291066_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096851600.1|291785_293414_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000012907.1|293486_294491_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|294652_295069_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_044867122.1|295114_295618_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062882095.1|295810_297007_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_062882096.1|297062_299918_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	7.9e-141
WP_122994985.1|299917_300400_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_062882097.1|300494_302006_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	1.0e-46
WP_000584117.1|302272_303373_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|303372_304455_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_014639402.1|306248_307268_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	2.4e-44
WP_024225922.1|307734_308997_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.2	1.7e-79
309030:309089	attL	TGGTGATGCCTCTAATTAGTTGAATCTGATGTATAATACGGGCTTTTGAGGTTATCTCAT	NA	NA	NA	NA
WP_085949012.1|309087_309781_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_106879271.1|311042_315134_+|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	9.0e-311
WP_085949012.1|315747_316442_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000135680.1|316535_316898_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081298.1|316963_317788_+	YfdQ family protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	100.0	2.7e-150
WP_000008181.1|317915_318452_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	100.0	9.7e-101
WP_001242742.1|318442_318793_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	100.0	7.0e-60
WP_000556583.1|319920_320055_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|320073_320328_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063646.1|320361_321648_+|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
WP_001146835.1|321795_322878_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301578.1|322868_323429_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_000469167.1|323428_324340_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	39.5	6.4e-28
WP_000420351.1|324374_324896_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|324975_325179_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_101975767.1|328077_328275_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000528254.1|328358_329096_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_001444515.1|329049_329250_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001114107.1|329859_330105_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_101975768.1|330245_330903_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	8.2e-126
WP_096851742.1|330942_331089_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	55.3	1.9e-06
WP_001171554.1|335808_336189_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_062881456.1|336287_336503_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	98.6	1.9e-31
WP_122993102.1|336874_337888_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|338102_338180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101700.1|338290_338560_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_101974170.1|338561_339875_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	3.6e-80
WP_101974156.1|339939_340539_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
WP_101974157.1|340605_344085_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.5	0.0e+00
WP_072141513.1|344321_344954_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.9	1.4e-98
WP_101974159.1|344899_345643_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	9.8e-144
WP_000807940.1|346350_346692_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_101975769.1|347600_348446_-	hypothetical protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	99.2	1.1e-117
WP_101975673.1|349964_350093_-|tail	phage tail protein	tail	H6WZM0	Escherichia_phage	100.0	2.5e-15
WP_085949012.1|350169_350864_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_096851663.1|351642_354279_+	fimbrial biogenesis usher protein FimD	NA	NA	NA	NA	NA
WP_001244822.1|354288_354819_+	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_000870589.1|354831_355335_+	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_096851664.1|355354_356257_+	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000558251.1|356429_357773_-	gluconate permease GntP	NA	NA	NA	NA	NA
WP_062881601.1|358112_359297_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_062881600.1|359377_360838_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.4	1.9e-50
WP_000833691.1|361052_361826_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_062881599.1|361966_362794_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_120795393.1|363386_363470_+	iraD leader peptide	NA	NA	NA	NA	NA
WP_001297236.1|363466_363859_+	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_000340758.1|363851_364763_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_096851662.1|364827_366000_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000211971.1|366012_366474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295597.1|366470_367154_-	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_062881598.1|367403_367958_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.0e-37
WP_001141195.1|367970_369149_-	MFS transporter	NA	NA	NA	NA	NA
WP_001298932.1|369216_370077_-	YjiK family protein	NA	NA	NA	NA	NA
WP_000657675.1|370141_370399_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_000222496.1|370395_371163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299707.1|371172_372324_-	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_062881597.1|372439_373720_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_062881596.1|373760_374993_-	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001380871.1|375250_375463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062881595.1|375459_376404_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	5.9e-61
WP_000199311.1|376646_378059_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000394278.1|378235_378400_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_062881594.1|378497_380591_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000132623.1|380637_380979_-	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_085949012.1|381089_381784_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
381783:382549	attR	ATGAGATAACCTCAAAAGCCCGTATTATACATCAGATTCAACTAATTAGAGGCATCACCATCAGTAAATACAGGGAAAGTCCAGCTAAAAATAGAAAATAATAGAAACGTTACTGGAAAGATCTGGAAGAGAAATTAATGTTAATTCAGAATGGCCGGATAACAAAGTGTATCCGGCCTTCATAATTAATTTAAAGCACTCATATGATGTTCTTTAAAATTCTCTGCCTGTGCCAGCACACCCATATAAACATCATCATTCGCTACTGGCGGGAACTTATGCTTGTGTAGAAGAAGAATAAGTTCAACTTTCAGTTTCGCTTTAATATCATCGCGTTTACTCCAGTCAGGATATTTCGATGTGTTGTCAACCACGCTTTTCATCTCTTTTGCCAGTGACAGCATTTTTTCATCGTCATAGGTGAACTGATATTTATCGCGCATATGAGCAAGAATGTCGAAAAAGGCTTTTTCTTCAATATCAATACCTAAATCGGCCCAGGTGCCCATTTCGGTTTTAATATCATAGATAATATCGGTCATTTCCTGACTGAATGTATCGAATTCTTCACCGTTGAGTACATCATCTTCTCGCCGCTCATTATAACGATCTATAATCGCCTGGAAGCGGCGGGTGAAGTTAATCCCTTGCAACTGGTTCACTTTCTTGAAGTCGCTGATCGCTTTTTCCAGTAATTTTTGTAATAACTGGATCTTTGTTGCCGGAAGTTTGATCTTGTTAATTCGCGCCAGATAATCTTCGTCAAA	NA	NA	NA	NA
>prophage 4
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	405706	445057	5302502	terminase,integrase,capsid,holin,transposase,lysis	Escherichia_phage(50.0%)	52	405494:405509	439510:439525
405494:405509	attL	AAGGGATATCAGTTAA	NA	NA	NA	NA
WP_085949012.1|405706_406401_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_047082098.1|406561_407287_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001300509.1|407244_407922_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_062881368.1|407958_408747_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001558501.1|408887_409124_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_062881369.1|409684_410716_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204018.1|410818_411232_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092461.1|411200_411647_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870712.1|411661_412339_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_001218294.1|412724_413948_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
WP_024201788.1|414119_415025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096851707.1|416092_416425_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	100.0	1.5e-43
WP_101974162.1|416927_417614_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	87.1	3.7e-121
WP_000763383.1|417610_417832_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001447493.1|417930_418212_-	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
WP_000548531.1|418222_418414_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_074434105.1|418391_418568_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	1.3e-22
WP_044804878.1|418564_419245_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	98.2	1.9e-130
WP_062882635.1|419241_420192_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	96.8	2.0e-173
WP_000995345.1|420208_420490_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|420510_420792_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000917252.1|420803_421016_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_071526579.1|421086_421986_-	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	96.2	1.4e-139
WP_001064714.1|422489_423443_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939560.1|423439_424909_-	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.6	1.9e-284
WP_001056250.1|425003_425717_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240875.1|425812_426016_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
WP_001302923.1|426186_426381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271434.1|426547_426925_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	98.4	7.6e-60
WP_021500588.1|426918_428439_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	99.8	8.3e-307
WP_001694414.1|428428_429400_+	toprim domain protein	NA	A0A0H4IPK0	Shigella_phage	100.0	1.9e-195
WP_000402092.1|429399_429849_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|429856_430420_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_044164955.1|430416_430611_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	98.4	1.4e-30
WP_001204859.1|430603_431038_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001356551.1|431286_431439_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_062881835.1|431827_432787_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	99.7	9.6e-176
WP_000738080.1|432798_433068_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|433364_433688_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_085949012.1|433875_434570_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_101974160.1|434705_436643_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.1	0.0e+00
WP_000143458.1|436779_436959_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|436999_437272_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|437348_437564_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001135289.1|437563_438061_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|438057_438495_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|438697_439195_+	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|439191_439449_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|439911_440139_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
439510:439525	attR	TTAACTGATATCCCTT	NA	NA	NA	NA
WP_000279804.1|440180_440546_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
WP_000958416.1|440835_441399_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_053904683.1|443119_445057_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.5	0.0e+00
>prophage 5
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	457630	466167	5302502	tail	Enterobacteria_phage(33.33%)	7	NA	NA
WP_101975771.1|457630_460144_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.8	0.0e+00
WP_101974156.1|460210_460810_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
WP_001023420.1|462188_462458_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_001217539.1|462826_463075_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202564.1|463294_464881_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295410.1|465273_465879_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|466005_466167_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 6
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	676218	753424	5302502	tRNA,protease,transposase,plate	uncultured_Mediterranean_phage(12.5%)	58	NA	NA
WP_000753946.1|676218_677643_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
WP_000929439.1|677797_678955_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000272188.1|679043_679430_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_062881388.1|679744_680569_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_062881389.1|680599_683272_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|683333_684128_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246884.1|684495_685221_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|685478_686330_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|686476_687202_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|687493_688051_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811923.1|688142_689339_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|689527_690286_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922436.1|690298_691156_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295561.1|691167_692520_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|692549_694982_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|695103_695589_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|695592_696618_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|696722_697178_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565967.1|697181_697970_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_062881390.1|697969_699118_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|699114_699711_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_062881391.1|699747_703230_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.1e-208
WP_000055741.1|703242_704202_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_096851512.1|704300_706442_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|706498_706888_+	VOC family protein	NA	NA	NA	NA	NA
WP_062881392.1|706952_708251_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|708299_708560_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|708546_708747_-	YaeP family protein	NA	NA	NA	NA	NA
WP_000635545.1|709174_709597_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_062881393.1|709610_710321_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260711.1|711351_713070_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032178897.1|713180_713888_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|713884_714289_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|714406_715222_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|715261_715915_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_096851513.1|715907_716939_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	1.2e-35
WP_001140187.1|717126_717702_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_085949012.1|723578_724272_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001230983.1|724530_725331_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016005.1|725334_725958_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_062882466.1|726006_727365_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	1.3e-08
WP_001052727.1|727436_728192_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|728225_728948_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|728944_729412_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|729476_730208_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086140.1|730746_731532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096851690.1|731668_732148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|732157_733072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|733115_733598_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_122994993.1|734984_738419_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_062882459.1|738527_739940_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_062882458.1|739944_740688_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_062882456.1|745023_746874_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|746877_747291_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_062882455.1|747297_748773_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123966.1|748823_749048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062882454.1|749082_749583_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_085949012.1|752729_753424_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	1231764	1247159	5302502	integrase,transposase,holin,tail	Enterobacteria_phage(41.18%)	23	1231677:1231691	1245230:1245244
1231677:1231691	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000533642.1|1231764_1232835_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303965.1|1233119_1233419_-	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000789829.1|1233655_1234354_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.9	1.5e-101
WP_074433965.1|1234484_1235093_-	ead/Ea22-like family protein	NA	Q9MCR3	Enterobacteria_phage	96.4	5.0e-21
WP_101974067.1|1236059_1237273_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_096851764.1|1237278_1237536_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.1	2.0e-32
WP_001386642.1|1237634_1237916_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000129285.1|1237926_1238484_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682294.1|1238476_1238638_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_095585804.1|1238634_1239315_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.3	5.6e-130
WP_032205168.1|1239311_1239494_-	hypothetical protein	NA	A0A1I9LJN0	Stx_converting_phage	98.3	7.2e-24
WP_095585803.1|1239646_1240312_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	98.6	7.2e-130
WP_001235472.1|1240308_1240932_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1241184_1241928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1242014_1242173_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_033816266.1|1242253_1242652_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284515.1|1242794_1243010_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_062881704.1|1243234_1243480_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.5	2.4e-30
WP_001002868.1|1243479_1243860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354291.1|1243943_1244165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052915805.1|1244177_1244831_-	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_000767391.1|1245334_1245811_-	kinase inhibitor	NA	NA	NA	NA	NA
1245230:1245244	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_024225839.1|1245869_1247159_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-18
>prophage 8
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	1361377	1397163	5302502	protease,transposase	Stx2-converting_phage(30.0%)	31	NA	NA
WP_000520781.1|1361377_1361698_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1361728_1364005_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_085949012.1|1364201_1364896_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_074433978.1|1364955_1365312_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1365466_1367827_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_001171554.1|1370515_1370896_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_028913479.1|1372287_1372893_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_062882370.1|1372940_1373192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|1373215_1373506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101974067.1|1373915_1375129_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_000024297.1|1375504_1375864_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591995.1|1375956_1377576_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000886249.1|1378455_1379235_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|1379244_1379547_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|1379555_1379876_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|1379868_1381572_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|1381581_1382046_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_062882318.1|1382046_1382721_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|1382732_1383350_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|1384561_1384825_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|1385126_1385267_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000397130.1|1386137_1386809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435663.1|1389146_1389572_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|1389568_1389919_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_095585846.1|1389949_1391563_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.2	2.0e-165
WP_000957249.1|1392466_1392847_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|1392833_1393163_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|1393423_1393891_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|1393908_1395117_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|1395127_1396084_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|1396083_1397163_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
>prophage 9
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	1545229	1585374	5302502	protease,terminase,integrase,holin,transposase	Escherichia_phage(33.33%)	49	1553717:1553732	1571213:1571228
WP_062882282.1|1545229_1546990_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1547175_1547628_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_062882317.1|1547703_1548744_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1549100_1549610_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_032186268.1|1549828_1550458_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_074434046.1|1550420_1552583_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_062882281.1|1552592_1553039_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420537.1|1553161_1555216_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1553717:1553732	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1555247_1555706_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_060616790.1|1555801_1556464_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001343235.1|1556636_1557050_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1557094_1557412_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_062882280.1|1557469_1558660_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1558754_1559033_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1559029_1559359_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_062882278.1|1559449_1560109_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.5	6.2e-41
WP_001299351.1|1560516_1561536_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1561513_1561756_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_101975670.1|1561823_1564259_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	6.4e-59
WP_001098307.1|1564352_1564544_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1564540_1564729_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_032205087.1|1565302_1565488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032205089.1|1565674_1566064_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	30.0	1.5e-05
WP_000379575.1|1566205_1566361_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1566637_1566925_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1566924_1567116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1567143_1567545_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1567653_1567926_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000917737.1|1568551_1568749_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|1569035_1569854_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|1570005_1570377_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|1570366_1570738_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|1570750_1571800_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
1571213:1571228	attR	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_074433979.1|1571801_1572080_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013642.1|1572247_1572460_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_000955173.1|1572504_1572642_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_062881813.1|1573007_1573781_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_158639000.1|1574784_1575081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101974181.1|1575055_1576281_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.1e-176
WP_000411814.1|1577948_1578155_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|1578410_1578683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1578842_1579376_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1579596_1579710_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1579931_1580117_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1580644_1580959_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032243757.1|1581040_1581265_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_000235436.1|1581667_1582177_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_101975669.1|1582999_1584682_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.8	7.0e-307
WP_062882369.1|1584750_1585374_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.3e-69
>prophage 10
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	1731072	1864707	5302502	terminase,tRNA,head,tail,integrase,capsid,holin,transposase,lysis	Stx2-converting_phage(26.89%)	152	1794753:1794768	1859882:1859897
WP_096851754.1|1731072_1731417_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.5	4.3e-09
WP_101975666.1|1731493_1732612_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	2.9e-83
WP_000003742.1|1732580_1732850_-	excisionase	NA	NA	NA	NA	NA
WP_000048280.1|1732911_1735383_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001365098.1|1735476_1735668_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001358566.1|1735664_1735853_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000379610.1|1736342_1736495_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000948454.1|1736813_1737290_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1737414_1737738_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693928.1|1737721_1738147_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262372.1|1738218_1739289_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	66.2	4.5e-65
WP_000788759.1|1739295_1740042_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	1.4e-113
WP_096948413.1|1740063_1740780_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.0	1.6e-71
WP_096851728.1|1740812_1741094_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	3.6e-30
WP_000699809.1|1741090_1741318_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|1741310_1741622_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_096848963.1|1741749_1741968_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	70.8	3.1e-21
WP_000104474.1|1741969_1742527_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_101975665.1|1742759_1742972_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	98.6	8.6e-29
WP_101975772.1|1743089_1743431_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	92.1	7.1e-49
WP_000191872.1|1743552_1743825_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_101975663.1|1744888_1745263_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.3e-32
WP_000762928.1|1745259_1746081_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001359877.1|1746646_1747078_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
WP_101975662.1|1747645_1749496_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000411811.1|1749939_1750146_+|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000731236.1|1750150_1750495_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992168.1|1750545_1751079_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	99.4	4.3e-101
WP_101975661.1|1751349_1751901_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	96.3	2.3e-97
WP_000539792.1|1751900_1752047_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1752274_1752460_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1752889_1753117_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|1753158_1753524_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|1753815_1754379_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001457603.1|1754375_1756037_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_101975660.1|1756100_1758038_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.2	0.0e+00
WP_001063096.1|1758082_1758304_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|1760824_1761151_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1761160_1761511_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1761507_1761954_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1761950_1762295_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275508.1|1762353_1763070_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030048.1|1763075_1763450_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	2.3e-64
WP_001453698.1|1763545_1763755_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_158639001.1|1763806_1764622_+	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	98.9	1.9e-132
WP_101975657.1|1767034_1767376_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	96.5	2.0e-59
WP_001298836.1|1767375_1768074_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.7e-129
WP_053921656.1|1768084_1768828_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.6	9.2e-150
WP_130069576.1|1768773_1769406_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.9	2.6e-97
WP_101975655.1|1769652_1773129_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.4	0.0e+00
WP_025404308.1|1773195_1773795_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.0	2.0e-110
WP_101975654.1|1773859_1775173_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	2.0e-78
WP_001023356.1|1775174_1775444_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_115801847.1|1775550_1775640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096851723.1|1775659_1778008_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_085949012.1|1780655_1781350_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_122994997.1|1782942_1783518_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001301834.1|1783540_1783666_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1783745_1784021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1784081_1785443_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000824186.1|1786124_1786328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001113310.1|1786305_1786773_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_101974131.1|1786849_1787968_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.7	3.5e-84
WP_000003739.1|1787936_1788206_-	excisionase	NA	NA	NA	NA	NA
WP_032185406.1|1788267_1790811_-	exonuclease	NA	V5UQJ3	Shigella_phage	69.8	7.1e-234
WP_000199482.1|1790903_1791092_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450219.1|1791088_1791277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379549.1|1791666_1791819_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000444609.1|1792092_1792737_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	4.7e-09
WP_001261756.1|1792836_1793064_+	cell division protein	NA	NA	NA	NA	NA
WP_000693817.1|1793060_1793486_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_064717445.1|1793508_1794477_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.4	9.0e-73
WP_000788764.1|1794483_1795230_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	8.1e-114
1794753:1794768	attL	AAAATCCATCGCTGAC	NA	NA	NA	NA
WP_000450619.1|1795251_1795968_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.0e-73
WP_000017336.1|1795964_1796282_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	71.6	3.0e-33
WP_016241289.1|1796278_1796584_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.0	1.5e-50
WP_001224669.1|1796731_1796914_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	1.0e-25
WP_001429226.1|1797079_1797439_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.6	1.3e-37
WP_000212748.1|1797441_1797729_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	95.8	2.5e-47
WP_000206829.1|1797732_1798077_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	92.1	9.7e-54
WP_000119357.1|1798408_1798588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818169.1|1798606_1799092_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_072127062.1|1799069_1799267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184173.1|1799207_1799486_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	6.3e-11
WP_016241288.1|1799487_1800537_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_000904126.1|1800549_1800909_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	1.7e-37
WP_001064890.1|1800905_1801589_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.9	1.2e-55
WP_001429230.1|1801807_1802005_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	4.0e-28
WP_096851733.1|1802155_1803214_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	91.5	1.2e-192
WP_000735807.1|1803593_1803818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498122.1|1803870_1804092_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.0e-20
WP_001359877.1|1804270_1804702_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
WP_101975773.1|1805272_1807123_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000411804.1|1807413_1807620_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000138558.1|1807875_1808148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|1808307_1808841_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001443546.1|1808918_1809110_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
WP_001208682.1|1809487_1809694_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1809758_1809983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1810339_1810480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001341372.1|1810609_1810795_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_000279816.1|1810836_1811202_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	7.8e-62
WP_000958380.1|1811492_1812056_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_101975782.1|1812061_1813777_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_101975651.1|1815753_1815975_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	2.9e-35
WP_000126029.1|1818501_1818828_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	2.0e-53
WP_001007905.1|1818838_1819189_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_101974073.1|1819185_1819632_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	98.6	5.2e-76
WP_000133388.1|1819628_1819973_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275466.1|1820039_1820756_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.8e-127
WP_000710949.1|1820770_1821145_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1821240_1821450_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_101975774.1|1822967_1823384_+	hypothetical protein	NA	A0A0P0ZDY0	Stx2-converting_phage	86.5	3.2e-43
WP_158639002.1|1823609_1823762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101975775.1|1824716_1825055_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	89.5	4.0e-52
WP_001335877.1|1825054_1825753_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_101974128.1|1825763_1826507_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.3e-147
WP_137534157.1|1826452_1827085_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.4	1.2e-97
WP_032271866.1|1830866_1831490_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
WP_101975648.1|1831554_1832868_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023452.1|1832869_1833139_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_001118085.1|1833250_1833832_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|1833899_1834535_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|1834662_1835721_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|1835795_1836446_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_062881695.1|1837492_1838356_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.2	2.0e-10
WP_000531601.1|1838339_1839476_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359446.1|1839725_1840952_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1841000_1842122_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_062881694.1|1842197_1843658_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1843657_1844329_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_062881693.1|1844497_1845868_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	3.2e-108
WP_001297479.1|1845871_1846513_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1846548_1847655_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476089.1|1847708_1848170_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248692.1|1848179_1848833_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_062881692.1|1849004_1850255_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.9e-22
WP_062881691.1|1850368_1851511_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.4	1.2e-204
WP_000088653.1|1851500_1851737_-	excisionase	NA	NA	NA	NA	NA
WP_000544528.1|1852877_1853183_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180491.1|1853169_1853646_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.0e-85
WP_012738274.1|1853862_1854045_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738495.1|1854135_1854429_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1854720_1855131_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1855416_1855623_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_062881690.1|1855787_1855982_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	3.7e-26
WP_000453622.1|1856370_1856916_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	3.1e-94
WP_062881689.1|1856890_1858816_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|1858812_1859019_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_095585867.1|1860468_1860990_+|tail	phage tail tape measure protein	tail	A0A291AWV3	Escherichia_phage	100.0	2.2e-41
1859882:1859897	attR	GTCAGCGATGGATTTT	NA	NA	NA	NA
WP_095585866.1|1861054_1864126_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_062881460.1|1864125_1864707_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.5e-102
>prophage 11
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	2066474	2222582	5302502	protease,terminase,tRNA,head,integrase,capsid,portal,holin,transposase,tail	Escherichia_phage(35.48%)	145	2071812:2071837	2117161:2117186
WP_024226007.1|2066474_2067707_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|2067961_2068945_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|2069220_2069394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024226008.1|2069423_2070797_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.5e-52
WP_096851542.1|2070925_2071861_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.2	1.2e-146
2071812:2071837	attL	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
WP_096851543.1|2071912_2073148_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.0	4.3e-237
WP_000079604.1|2073149_2073365_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001356607.1|2073464_2073653_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|2073645_2073840_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166315.1|2073896_2074706_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000102194.1|2074698_2077368_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_001427414.1|2077448_2077619_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560226.1|2077618_2077840_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000887681.1|2077886_2078735_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000379547.1|2079146_2079299_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000410105.1|2079605_2080025_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2080121_2080364_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702017.1|2080360_2080783_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001356605.1|2080860_2081649_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000788984.1|2081655_2082402_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_000450718.1|2082424_2083186_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_001151116.1|2083201_2083624_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000014164.1|2083620_2083851_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001138877.1|2084005_2084656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418464.1|2084642_2085764_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000902698.1|2085886_2086099_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_071525388.1|2086335_2086587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940305.1|2086658_2087258_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_000228017.1|2087257_2087548_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000640110.1|2087544_2088087_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_101975647.1|2088788_2090735_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.6	0.0e+00
WP_000143458.1|2090871_2091051_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|2091091_2091337_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|2091414_2091630_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087728.1|2091634_2092168_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|2092438_2093008_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2093007_2093154_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2093381_2093567_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|2093778_2094051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|2094083_2094560_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|2094556_2096680_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|2096676_2096889_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|2096888_2098391_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114429.1|2098335_2100360_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|2100447_2100774_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281347.1|2100766_2101048_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001450644.1|2101050_2101674_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	98.6	2.9e-104
WP_000682716.1|2101686_2102085_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2102092_2102845_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_044707580.1|2102858_2103281_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	3.3e-72
WP_000532075.1|2103307_2103616_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_001303163.1|2103659_2106305_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
WP_000847298.1|2106301_2106631_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_096851779.1|2106630_2107329_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.4	5.8e-130
WP_053903785.1|2107334_2108078_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.8e-146
WP_096851774.1|2108023_2108653_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_101975646.1|2108893_2112367_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001228289.1|2112434_2113034_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000279065.1|2113098_2114421_+|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001023406.1|2114422_2114692_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_001131659.1|2114804_2115380_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|2115452_2116082_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|2116163_2116805_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001364706.1|2117385_2117820_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	4.0e-28
2117161:2117186	attR	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
WP_062882263.1|2119461_2122986_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001200683.1|2123259_2123526_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|2123522_2123945_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|2124055_2125045_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001543716.1|2125252_2127892_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698141.1|2127888_2128074_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001364714.1|2128081_2128408_+	YdbL family protein	NA	NA	NA	NA	NA
WP_062882264.1|2129719_2131219_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_062882265.1|2131277_2133551_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_062882266.1|2133798_2135844_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_062882267.1|2136128_2137058_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|2137069_2137357_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_024226016.1|2137365_2138112_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189193.1|2138126_2138624_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_062882268.1|2138631_2139702_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292357.1|2139698_2140466_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969780.1|2140465_2141254_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_032204914.1|2142670_2143093_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206184.1|2143092_2144298_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_024226020.1|2145740_2146691_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_024226021.1|2146672_2147263_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_062882269.1|2147494_2148355_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_062882270.1|2148418_2150725_+	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_096851638.1|2150895_2151549_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_024226025.1|2151548_2152445_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_062882272.1|2152460_2154218_+	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_062882273.1|2154207_2155524_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000048948.1|2155574_2156180_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_062882274.1|2156380_2160283_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_062882275.1|2160554_2161355_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000115949.1|2161551_2162991_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_062882276.1|2163032_2164034_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000428998.1|2164222_2164753_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|2164997_2165171_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001320773.1|2165242_2165392_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_096851637.1|2165491_2166861_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_000961821.1|2166938_2167151_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_000216644.1|2168782_2168950_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.6	1.2e-09
WP_000731236.1|2171768_2172113_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|2172163_2172697_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_001043239.1|2172774_2172993_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
WP_012578895.1|2173214_2173400_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736096.1|2173485_2173710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095749.1|2174078_2174306_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2174347_2174713_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_097469946.1|2175733_2177671_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_001063096.1|2177715_2177937_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|2180463_2180790_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007911.1|2180799_2181150_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573374.1|2181146_2181593_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001275479.1|2181991_2182708_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_001030063.1|2182713_2183088_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|2183183_2183393_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000807964.1|2186674_2187016_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_101975644.1|2187015_2187714_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.6	8.4e-129
WP_101975643.1|2187724_2188468_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	6.8e-145
WP_122994999.1|2188413_2189046_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.0	2.6e-97
WP_000649829.1|2189233_2189761_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_101975642.1|2189894_2193287_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	88.0	0.0e+00
WP_101974110.1|2193353_2193953_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
WP_101974109.1|2194017_2195331_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.9	4.8e-77
WP_101975641.1|2195332_2195602_+|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.1e-44
WP_062881604.1|2195742_2196618_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.3	2.1e-161
WP_062881606.1|2196842_2197493_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	98.6	4.6e-121
WP_000214712.1|2199483_2199687_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|2199864_2200551_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000636571.1|2200639_2201386_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_001364659.1|2201522_2203568_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_062881602.1|2203611_2204082_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_085949012.1|2204147_2204841_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881816.1|2205381_2206047_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062881817.1|2206082_2208185_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
WP_000550675.1|2208426_2209488_+	YncE family protein	NA	NA	NA	NA	NA
WP_001295649.1|2209602_2211102_-	L-asparagine permease	NA	NA	NA	NA	NA
WP_062881818.1|2211368_2211986_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_062881819.1|2212061_2212274_+	YncH family protein	NA	NA	NA	NA	NA
WP_085949012.1|2212498_2213192_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_062881864.1|2213772_2215431_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	8.3e-26
WP_096851760.1|2219243_2219486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358663.1|2219480_2220677_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_032312347.1|2221445_2222582_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	2313690	2411428	5302502	terminase,integrase,holin,transposase,tail	Enterobacteria_phage(30.65%)	104	2313677:2313736	2411384:2412149
2313677:2313736	attL	GGTAGTGCATCCAATTAGTAGAACATGTGTTTTTCGATAAACGCTCCGATCACTTTTTCG	NA	NA	NA	NA
WP_085949012.1|2313690_2314385_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001353827.1|2315340_2315859_+	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_001076535.1|2315855_2316305_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000018639.1|2316305_2316539_-	YdcY family protein	NA	NA	NA	NA	NA
WP_001389205.1|2316624_2316798_-	orphan toxin OrtT	NA	NA	NA	NA	NA
WP_001303494.1|2316992_2317088_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_000867982.1|2317489_2318299_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
WP_062881687.1|2318508_2319933_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001251313.1|2320737_2321679_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062881686.1|2321679_2322645_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	2.6e-27
WP_000047456.1|2322708_2323854_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760615.1|2324098_2325505_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_077879189.1|2325583_2326000_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	4.8e-31
WP_032195248.1|2326045_2326222_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	56.1	5.2e-11
WP_000494244.1|2326443_2326674_+	YncJ family protein	NA	NA	NA	NA	NA
WP_024177737.1|2326765_2328727_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	9.2e-24
WP_062881684.1|2328799_2329336_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071796541.1|2329388_2330603_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_074433958.1|2330642_2331851_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	3.2e-208
WP_001261013.1|2332382_2333051_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586728.1|2333353_2333947_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_074433957.1|2333943_2334936_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_062881681.1|2335059_2336040_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140884.1|2336034_2336571_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2336633_2336858_-	YdcH family protein	NA	NA	NA	NA	NA
WP_062881680.1|2336997_2338653_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_062881679.1|2338877_2340221_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|2340437_2341361_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062881678.1|2341398_2341578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053274549.1|2341590_2343039_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.4	8.4e-06
WP_095585824.1|2344211_2344682_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.1	1.3e-77
WP_001303046.1|2344970_2345336_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000074669.1|2345377_2345602_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2345683_2345998_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2346524_2346710_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000411802.1|2347418_2347625_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000917733.1|2352575_2352773_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_096851746.1|2352985_2353675_-	antiterminator	NA	I6PDF8	Cronobacter_phage	47.6	2.7e-55
WP_096851745.1|2353671_2354031_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.8e-34
WP_001265156.1|2354043_2355093_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.9e-108
WP_072184779.1|2355094_2355373_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
WP_000902693.1|2355540_2355753_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
WP_001278450.1|2355942_2356047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261939.1|2356870_2357119_+	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|2357280_2357922_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_101975638.1|2358003_2358633_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.8	4.6e-78
WP_001131657.1|2358705_2359281_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001101699.1|2359393_2359663_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_101974170.1|2359664_2360978_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	3.6e-80
WP_101974156.1|2361038_2361638_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	5.9e-107
WP_101975637.1|2361704_2365181_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.3	0.0e+00
WP_072065989.1|2365416_2366049_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.1	5.8e-105
WP_101975636.1|2365994_2366738_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.5e-147
WP_080025938.1|2366748_2367447_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_000847298.1|2367446_2367776_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000532073.1|2370455_2370764_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|2370790_2371213_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|2371226_2371979_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2371986_2372385_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974960.1|2372397_2373021_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_001281350.1|2373023_2373305_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2373297_2373624_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_000102415.1|2377169_2377382_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077626.1|2377378_2379502_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000373407.1|2379498_2379975_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|2380449_2380635_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092902.1|2381153_2381687_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_001041949.1|2382198_2382990_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284518.1|2382993_2383209_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290212.1|2383285_2383558_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143464.1|2383598_2383778_-	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_000483509.1|2386447_2387506_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000917733.1|2387657_2387855_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000762902.1|2388081_2388903_-	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|2388899_2389274_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_001265189.1|2389286_2390336_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_024177817.1|2390337_2390607_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
WP_001452497.1|2390660_2390888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217944.1|2391111_2391483_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|2391475_2391793_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|2391895_2392108_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211435.1|2392322_2392871_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
WP_000215514.1|2393218_2393404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096851718.1|2393463_2394222_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.4	1.2e-80
WP_157837342.1|2394256_2394799_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000020565.1|2394710_2395751_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.2	6.7e-90
WP_000705370.1|2395722_2396274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|2396257_2396485_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|2396562_2396970_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379589.1|2397159_2397315_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171938.1|2397474_2397693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302137.1|2397696_2397861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|2398258_2398447_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2398443_2398632_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102168.1|2398724_2401169_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000113189.1|2401233_2401482_+	excisionase	NA	NA	NA	NA	NA
WP_000113671.1|2401459_2402590_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	1.7e-102
WP_074433998.1|2403076_2403295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|2406062_2406653_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2406836_2407484_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2407620_2407767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2408194_2408473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|2409639_2410209_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_085949012.1|2410734_2411428_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
2411384:2412149	attR	CGAAAAAGTGATCGGAGCGTTTATCGAAAAACACATGTTCTACTAATTGGATGCACTACCTAGTAAACAACCACTATGACTTTCTCTTGTAACGCAAAACTTATTATCAGTGACCACAACACGATATGTTCTGTTGCCAACCGTTACTTGCGTCCCGCTATCAGCAAGCCGCTGCTCTGCCGGCATTCCCCTTATATCCGCCTCTATGGCGTACAACTGACCGATCTGCTCCAGGGCTTCTTCCGTCAGTGCTGACGGGATGCGGACGTGCACATCGTGGATCTTTCGGCGGGCATGAGCCCAGCAGGCAGCTTCCGTTATCCCACCATTGCGATACAGCTCGTTGAACCCGGCGTACGCATCCGCTTGCAGCACACCGCTGAAGCAGGCAAGATGAGTCTGCGGATGGATGCCTTTTCTGTCCGGGCTGTAAGCGAACCACACTGCAGGTGCCAACGCTGACCCTGCATTGCGGTCATCACGAACATACGCCCACAACCGCCCGGTCTTCGTCTTCTTATTACCCGGCAGCAGTACCTGGACCGGGGTATCATCGGCATGGAGTTTGCCGTCAGTCATGACATAGCCATGAAGCGCCTCTTCCAGCGGAGACAGCAGCCGGCAGCATGCATCCACCCAGCCCGACAGCAGTGAACGCCTCAGCTCCACACCTTGCCGGCCGTATATTTCTGACTGGCGATACAGCGGGGTGTGCTCTGCATACTTCGAGGTCAGCACGCGGGCCAGCAGCCCCGGTCCGGCGATA	NA	NA	NA	NA
>prophage 13
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	2709764	2814265	5302502	plate,terminase,tRNA,head,integrase,capsid,portal,holin,transposase,tail	Enterobacteria_phage(69.39%)	108	2751986:2752045	2789327:2789447
WP_001551240.1|2709764_2711537_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|2711846_2712413_+	hydrolase	NA	NA	NA	NA	NA
WP_000639274.1|2712409_2713228_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2713280_2713676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2713716_2714460_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564725.1|2714456_2715428_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_062882190.1|2715592_2718022_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_024226209.1|2718046_2719147_-	cytochrome c	NA	NA	NA	NA	NA
WP_062882189.1|2719534_2720281_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001307851.1|2720294_2720861_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025322.1|2721076_2722810_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
WP_001307852.1|2722986_2723475_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001202069.1|2723596_2723989_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_062882188.1|2723988_2726067_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_062882187.1|2726059_2727208_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000763867.1|2728064_2728454_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2728468_2729518_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_062882186.1|2729520_2730381_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_062882185.1|2730399_2732001_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	4.4e-16
WP_062882184.1|2732046_2733708_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.5	1.6e-08
WP_000147302.1|2733850_2734354_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_096851635.1|2736343_2737270_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|2737266_2738154_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_062882182.1|2738860_2739211_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2739990_2740419_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2740425_2741850_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2741824_2742625_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|2742791_2743778_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_062882181.1|2743792_2745307_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_062882180.1|2745387_2746365_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062882179.1|2747161_2747665_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2747743_2747995_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2748109_2748196_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_062882178.1|2748458_2748782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2748952_2749450_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2749486_2749726_-	YecH family protein	NA	NA	NA	NA	NA
WP_062882177.1|2749917_2751129_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2751190_2751856_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2751986:2752045	attL	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCT	NA	NA	NA	NA
WP_001342226.1|2752212_2753214_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
WP_078280140.1|2753219_2753567_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290352.1|2753596_2754247_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|2754262_2754667_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|2754756_2754894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2754965_2755169_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000742491.1|2755190_2755541_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000158976.1|2755551_2755830_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000357025.1|2755841_2756084_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021647.1|2756080_2756194_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000985152.1|2756280_2756484_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000564224.1|2756807_2757197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272083.1|2757193_2760034_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000686499.1|2760110_2761070_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000211289.1|2761074_2761386_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289969.1|2761449_2762040_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000087812.1|2762529_2763576_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613774.1|2763575_2765327_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262655.1|2765481_2766318_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_024219921.1|2766341_2767394_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.6	4.9e-189
WP_000632311.1|2767439_2768240_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|2768341_2768836_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864911.1|2768835_2769036_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_001342221.1|2769038_2769362_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072343.1|2769358_2769751_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_000780555.1|2769747_2770155_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000202144.1|2770293_2772171_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_001342220.1|2772194_2772662_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000356339.1|2772654_2773290_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271909.1|2773286_2773868_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000213447.1|2773864_2774215_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111967.1|2774218_2775115_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000071738.1|2775107_2775638_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_024220069.1|2775640_2777773_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	2.7e-130
WP_000144010.1|2777772_2778351_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000979946.1|2779121_2779610_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_024220070.1|2779622_2782430_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.6	0.0e+00
WP_000763327.1|2782416_2782545_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665297.1|2782580_2782946_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.1e-55
WP_000290450.1|2783000_2783513_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005413.1|2783512_2784697_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	5.6e-226
WP_024220071.1|2784854_2785964_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	2.4e-194
WP_001317900.1|2786363_2787503_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|2787792_2788053_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|2788243_2788384_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001303543.1|2788572_2788854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160187.1|2789845_2790394_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2789327:2789447	attR	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
WP_062882176.1|2790450_2792283_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000611328.1|2792279_2792936_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_000590344.1|2793231_2793408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000106474.1|2793394_2793619_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001272991.1|2794638_2795391_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	6.0e-32
WP_001158220.1|2795387_2796056_-	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_062882174.1|2796070_2797057_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001295643.1|2797161_2797962_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024226221.1|2798049_2798601_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_000079778.1|2799528_2800860_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_062882173.1|2801105_2802521_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_062882172.1|2802536_2802947_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_001057840.1|2802946_2803312_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_062882171.1|2803389_2804877_+	alpha-amylase	NA	NA	NA	NA	NA
WP_062882170.1|2804910_2805324_-	lipoprotein	NA	NA	NA	NA	NA
WP_000118901.1|2805510_2806716_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2806712_2806946_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_062882169.1|2807052_2807721_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	9.6e-82
WP_062882168.1|2808113_2808428_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_062882167.1|2808642_2810301_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2810293_2811289_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_024226223.1|2811281_2811968_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_001358663.1|2813068_2814265_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	2839224	2928238	5302502	plate,protease,head,integrase,holin,transposase,tail	Escherichia_phage(42.86%)	102	2830516:2830532	2913309:2913325
2830516:2830532	attL	TTTTTTGATTTCTGTGT	NA	NA	NA	NA
WP_085949012.1|2839224_2839919_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_001079070.1|2839980_2840511_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	1.6e-55
WP_001302717.1|2841146_2841461_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_129014757.1|2841982_2842168_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	4.9e-20
WP_000455406.1|2842395_2842545_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056883.1|2842544_2843114_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_062881865.1|2843388_2843922_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.7	1.3e-100
WP_001072901.1|2843926_2844142_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2844219_2844465_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143462.1|2844505_2844685_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_074434003.1|2847232_2847487_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.8	1.0e-36
WP_001056416.1|2847763_2848348_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_001310454.1|2848515_2848764_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001512118.1|2848765_2850856_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
WP_000129790.1|2850927_2851860_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|2851862_2852084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|2852096_2852351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2852352_2852634_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|2852630_2852903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|2852907_2853201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|2853212_2853743_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_050863685.1|2853840_2854383_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	39.4	4.9e-28
WP_000578573.1|2854386_2854920_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000465562.1|2854919_2855435_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973023.1|2855438_2855990_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000633440.1|2855986_2856298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|2856312_2856663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|2856678_2857011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|2857003_2857201_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000378480.1|2857190_2857487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214366.1|2857483_2857993_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000852377.1|2858062_2858488_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|2858559_2859060_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|2859094_2859523_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|2859506_2859725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342747.1|2859734_2859962_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|2859942_2860251_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|2860247_2860538_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|2860540_2861122_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|2861121_2862786_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532592.1|2862785_2864375_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_000046901.1|2864358_2865690_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_032311117.1|2865811_2866285_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
WP_000850822.1|2866461_2867586_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|2867585_2868533_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_096851665.1|2868576_2868987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|2868983_2869403_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|2869399_2869960_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|2869960_2870206_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|2870202_2871705_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|2871713_2872079_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|2872093_2872570_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|2872696_2874772_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146116.1|2874758_2876108_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|2876091_2877216_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|2877205_2877820_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|2877812_2878250_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000301577.1|2879319_2879880_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|2879879_2880791_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|2880825_2881347_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|2881426_2881630_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|2881852_2882413_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|2882512_2884552_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|2884698_2884881_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|2884916_2885162_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|2885200_2885665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|2885779_2885980_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|2885933_2886671_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_000301785.1|2887424_2888138_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101974095.1|2888272_2888470_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	95.4	7.5e-27
WP_062882008.1|2888694_2889249_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	6.8e-65
WP_001217447.1|2889257_2889617_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265233.1|2889629_2890679_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_062882007.1|2890680_2890953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000756596.1|2891074_2891419_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2891538_2891751_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2891984_2892542_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_044809747.1|2892543_2892792_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	78.6	2.2e-23
WP_001289673.1|2892888_2893200_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2893192_2893420_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2893416_2893698_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450617.1|2893730_2894447_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_101974178.1|2894468_2895215_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.8	1.8e-113
WP_101975632.1|2895221_2896292_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	8.5e-64
WP_000693883.1|2896363_2896789_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001515476.1|2897728_2898526_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_101974093.1|2902894_2904107_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	3.5e-167
WP_062882558.1|2907665_2908718_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_062882557.1|2909032_2910349_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2910450_2911905_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532912.1|2912247_2912964_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122985555.1|2913592_2915236_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
2913309:2913325	attR	ACACAGAAATCAAAAAA	NA	NA	NA	NA
WP_001011017.1|2915353_2916304_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011483.1|2916405_2917323_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986346.1|2917779_2918715_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_024226619.1|2918776_2919856_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_024226617.1|2919867_2920611_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2920607_2921153_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_158638995.1|2924410_2924878_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000450409.1|2925036_2925366_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001200891.1|2925537_2926596_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001254932.1|2927086_2928238_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 15
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	3005706	3016539	5302502	terminase,tail	Escherichia_phage(36.36%)	16	NA	NA
WP_074433962.1|3005706_3005844_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	95.6	3.7e-17
WP_000950982.1|3005949_3006831_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_096851758.1|3007097_3007886_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.1	1.6e-144
WP_021351651.1|3008009_3008381_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_062881478.1|3009829_3010327_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.5	1.0e-11
WP_001299328.1|3010721_3010946_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302717.1|3011027_3011342_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3011867_3012053_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3012280_3012412_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3012424_3012607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062881662.1|3012762_3013296_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	2.4e-99
WP_100224537.1|3013454_3013685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134792477.1|3014364_3014598_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	4.0e-11
WP_000499454.1|3014678_3014837_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_158638458.1|3014922_3015666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3015849_3016539_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
>prophage 16
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	3019681	3139144	5302502	protease,terminase,tRNA,lysis,head,integrase,capsid,holin,transposase,tail	Enterobacteria_phage(38.16%)	114	3016310:3016325	3138658:3138673
3016310:3016325	attL	ATGGATGAACCTTTTG	NA	NA	NA	NA
WP_032204680.1|3019681_3020755_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	95.8	9.7e-193
WP_000679004.1|3021098_3022346_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001542993.1|3022345_3025468_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000667531.1|3025468_3028546_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_062882550.1|3028546_3029962_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675150.1|3029958_3031362_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137873.1|3031358_3032081_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|3032271_3032604_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|3032812_3033109_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|3033110_3033407_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_062882551.1|3033509_3034871_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	1.6e-216
WP_001318299.1|3035201_3035519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062882552.1|3035932_3036832_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_072146912.1|3036913_3037693_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_062882553.1|3037792_3038800_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_085949012.1|3038804_3039499_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_024226538.1|3039654_3041010_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_062881587.1|3041013_3041298_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182904.1|3041328_3041781_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000289788.1|3043086_3043941_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_062881586.1|3044248_3045301_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_071796522.1|3045622_3046834_+	MFS transporter	NA	NA	NA	NA	NA
WP_062881585.1|3046830_3047835_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	2.2e-13
WP_000434038.1|3048770_3049517_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351455.1|3049568_3050387_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822274.1|3050451_3051252_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195589.1|3051248_3052037_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|3052259_3052532_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_024231052.1|3052652_3053498_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153074.1|3053719_3054058_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_062881463.1|3054139_3055174_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_085949012.1|3056352_3057046_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_000677395.1|3058457_3059132_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|3059212_3059755_-	fimbrial protein	NA	NA	NA	NA	NA
WP_024177741.1|3060046_3060328_-	YehE family protein	NA	NA	NA	NA	NA
WP_062882073.1|3060590_3061700_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|3061831_3063865_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001343818.1|3067809_3068052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000636938.1|3071501_3071819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024226433.1|3072124_3073213_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_096851674.1|3073223_3075503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062882071.1|3075495_3076632_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.2e-162
WP_062882070.1|3076628_3078026_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	67.0	2.9e-237
WP_062882069.1|3078150_3078612_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_062882068.1|3078651_3079122_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.6e-81
WP_000598641.1|3079168_3079888_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_062882067.1|3079884_3081570_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.3	8.1e-303
WP_085949012.1|3081767_3082462_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_072148138.1|3083248_3083659_+	secretion protein EspV	NA	Q6H9S1	Enterobacteria_phage	99.3	5.5e-72
WP_096851744.1|3084311_3085556_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	91.1	2.0e-229
WP_096851743.1|3085887_3086469_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	60.0	4.3e-54
WP_001101698.1|3086579_3086849_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_101975630.1|3088887_3092364_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.3	0.0e+00
WP_122997399.1|3092599_3093232_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	3.5e-102
WP_101975778.1|3093177_3093921_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.3	7.5e-144
WP_001152185.1|3093931_3094630_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_000807964.1|3094629_3094971_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001513217.1|3098253_3098463_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000133388.1|3099724_3100069_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3100065_3100512_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_101975674.1|3100508_3100859_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	1.0e-58
WP_000125984.1|3100869_3101196_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|3103722_3103944_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|3103988_3105926_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_101974072.1|3105989_3107651_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
WP_000958372.1|3107647_3108211_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_000279804.1|3108500_3108866_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
WP_000095736.1|3108907_3109135_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001283921.1|3109597_3109855_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|3109851_3110349_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092313.1|3110548_3110986_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001135289.1|3110982_3111480_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000411802.1|3111479_3111686_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_101974071.1|3111978_3113829_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_096851751.1|3114906_3115395_-	antiterminator	NA	Q5TJL7	Enterobacteria_phage	99.4	7.7e-89
WP_001028864.1|3115385_3116057_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.9	1.6e-129
WP_101974070.1|3116053_3116659_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	99.0	8.1e-96
WP_101974069.1|3116658_3117381_-	DNA-binding protein	NA	O48426	Enterobacteria_phage	96.7	3.6e-127
WP_000335902.1|3117532_3118582_-	hypothetical protein	NA	Q9T208	Enterobacteria_phage	100.0	1.3e-181
WP_096851738.1|3118763_3119291_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	2.3e-99
WP_000736913.1|3119287_3119728_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145931.1|3119801_3120092_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_101974068.1|3120088_3120790_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	8.4e-129
WP_000185454.1|3120786_3121725_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438542.1|3121757_3122054_-	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_001180318.1|3122192_3122420_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3122498_3123206_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_029793531.1|3123266_3123608_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	98.2	2.8e-61
WP_096851725.1|3123674_3124136_+	hypothetical protein	NA	G9L674	Escherichia_phage	99.3	1.9e-76
WP_096851726.1|3124129_3125176_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	99.4	1.3e-205
WP_000198444.1|3125831_3126215_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_101974067.1|3126328_3127541_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_001502698.1|3127586_3128057_+	hypothetical protein	NA	A0A1U9AJ69	Stx1_converting_phage	100.0	1.7e-88
WP_072617038.1|3128207_3128576_+	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	100.0	2.0e-65
WP_001198861.1|3128648_3128813_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_122995013.1|3128781_3128895_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.3e-07
WP_085952403.1|3128920_3130133_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_000995395.1|3130313_3130610_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|3130615_3131401_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|3131397_3132078_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|3132074_3132257_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|3132229_3132421_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|3132431_3132713_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763383.1|3132811_3133033_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_021351746.1|3133029_3133800_+	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	98.8	6.2e-141
WP_095585854.1|3134290_3134551_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	82.3	1.5e-43
WP_000457728.1|3134638_3134881_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3134884_3135019_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|3135037_3135292_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|3135325_3136612_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_029208472.1|3136632_3137334_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
WP_001216963.1|3137393_3137501_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3137481_3138213_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_062882576.1|3138217_3139144_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	35.1	3.3e-24
3138658:3138673	attR	CAAAAGGTTCATCCAT	NA	NA	NA	NA
>prophage 17
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	3342357	3474849	5302502	bacteriocin,plate,protease,tRNA,integrase,capsid,portal,holin,transposase,tail	Escherichia_phage(41.53%)	147	3410009:3410025	3457407:3457423
WP_024226472.1|3342357_3343170_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3343169_3344183_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_074434101.1|3344248_3345406_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	1.7e-22
WP_085952403.1|3346498_3347712_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001435533.1|3347785_3348136_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.7e-59
WP_001111955.1|3348139_3349036_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
WP_000071702.1|3349028_3349559_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_000108515.1|3349561_3352024_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.2	8.1e-110
WP_000144022.1|3352023_3352602_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.9e-95
WP_000954205.1|3352645_3353218_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979946.1|3353374_3353863_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_062881740.1|3353875_3356683_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.8	0.0e+00
WP_001391627.1|3356669_3356798_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_000665314.1|3356833_3357199_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290450.1|3357253_3357766_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005431.1|3357765_3358950_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000132789.1|3359107_3359431_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	100.0	1.1e-43
WP_062881446.1|3362792_3363053_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|3363244_3363385_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001173929.1|3363647_3363980_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001539236.1|3363984_3364878_+	type VI secretion-associated protein	NA	NA	NA	NA	NA
WP_000615813.1|3365146_3366142_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127772.1|3366138_3367317_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|3367625_3368846_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_062881447.1|3369004_3371011_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3371131_3371410_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089241.1|3371443_3371992_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3371991_3372801_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043819.1|3372800_3373625_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|3373628_3374714_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001298774.1|3374748_3375681_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_062881448.1|3375846_3376398_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001323815.1|3376519_3377377_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_062881449.1|3377378_3377903_-	fimbrial protein	NA	NA	NA	NA	NA
WP_157911462.1|3377899_3378139_-	fimbrial protein	NA	NA	NA	NA	NA
WP_062881450.1|3380884_3381448_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|3382122_3382608_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_062881451.1|3382810_3384955_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_062881452.1|3384954_3386265_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|3386445_3386730_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|3387101_3388442_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_062881453.1|3388807_3389866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3390047_3390803_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_062881454.1|3391096_3392029_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
WP_096851649.1|3392250_3400602_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	94.3	0.0e+00
WP_000012449.1|3400670_3401936_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	98.8	9.9e-205
WP_000540391.1|3401946_3402198_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|3402207_3402654_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509481.1|3402656_3403313_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3403406_3403808_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3403864_3404005_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|3404237_3404972_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|3405062_3405680_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3405685_3405964_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000162954.1|3405978_3407247_-	host specificity protein J	NA	A0A2L1IV54	Escherichia_phage	89.5	2.6e-213
WP_001146329.1|3407243_3408869_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
WP_001370566.1|3409172_3409352_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	2.8e-28
WP_001023433.1|3409490_3409760_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_101975626.1|3409761_3411699_-|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
3410009:3410025	attL	CCCTTCGGCCCCTGAGG	NA	NA	NA	NA
WP_000207919.1|3411695_3412346_-	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
WP_000829200.1|3412345_3412909_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3412892_3413354_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3413403_3413793_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3413848_3415063_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_096851698.1|3415086_3416094_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	99.7	1.5e-179
WP_000787521.1|3416251_3418396_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	99.9	0.0e+00
WP_000143991.1|3418395_3420102_-	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_001086076.1|3420082_3420889_-	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
WP_001283921.1|3421288_3421546_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_001505200.1|3421542_3422040_-	kilA-N domain protein	NA	A0A0H4IPL1	Shigella_phage	100.0	2.4e-93
WP_071535903.1|3422261_3422468_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	66.1	2.1e-11
WP_000622438.1|3422695_3422830_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	100.0	4.2e-13
WP_001056876.1|3422844_3423411_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	100.0	1.4e-105
WP_000087461.1|3423685_3424219_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|3424223_3424439_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3424515_3424788_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3424828_3425008_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_101975625.1|3425142_3427080_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.8	0.0e+00
WP_101975624.1|3427889_3428603_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_096851804.1|3430183_3430381_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	9.8e-27
WP_000762928.1|3430607_3431429_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_096851781.1|3431425_3431803_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	64.9	1.1e-37
WP_000002243.1|3431799_3432090_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_097736163.1|3432089_3432812_-	DNA-binding protein	NA	A0A0P0ZBS6	Stx2-converting_phage	99.6	3.0e-129
WP_101975623.1|3432886_3433564_-	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	98.7	4.0e-128
WP_001254256.1|3433839_3434022_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153269.1|3434018_3434546_-	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	1.2e-100
WP_000814576.1|3434542_3434989_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3434945_3435182_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3435192_3435408_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_101975779.1|3435540_3435819_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	98.9	2.2e-48
WP_044861139.1|3435889_3437266_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	2.4e-252
WP_096851712.1|3437262_3438150_-	replication protein	NA	A5VW95	Enterobacteria_phage	98.0	4.9e-142
WP_001244621.1|3438212_3438485_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_062882649.1|3438507_3438807_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	3.7e-49
WP_000067727.1|3438948_3439164_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|3439239_3439935_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|3440436_3440958_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|3441526_3441709_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|3441686_3441959_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_096851711.1|3442018_3442489_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
WP_001198866.1|3442680_3442821_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_000361831.1|3442813_3442927_+	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_000613346.1|3442923_3443112_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000536228.1|3443120_3443801_+	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_032346989.1|3443797_3444385_+	hypothetical protein	NA	G9L666	Escherichia_phage	99.0	5.4e-105
WP_032346988.1|3444408_3444705_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	9.5e-50
WP_001214452.1|3444715_3444880_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_096851710.1|3444876_3445491_+	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	71.7	9.2e-55
WP_096851709.1|3445487_3445898_+	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	72.1	2.0e-29
WP_096851708.1|3445906_3446566_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	61.5	3.4e-39
WP_101975622.1|3446562_3447333_+	ead/Ea22-like family protein	NA	Q08J58	Stx2-converting_phage	100.0	1.5e-142
WP_001014300.1|3447334_3447526_+	hypothetical protein	NA	Q6H9Z6	Enterobacteria_phage	100.0	1.2e-26
WP_096851720.1|3447528_3448125_+	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	99.5	6.3e-117
WP_032344420.1|3448220_3448949_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	7.9e-130
WP_000203834.1|3449272_3449911_+	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
WP_044164933.1|3449966_3450398_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	99.3	2.1e-74
WP_000163444.1|3450394_3451021_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_001291843.1|3450980_3451193_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_096851721.1|3451228_3451606_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	98.4	1.7e-51
WP_000453637.1|3451684_3451867_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_096851722.1|3451850_3453020_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	99.7	3.7e-230
WP_062881455.1|3453451_3454618_+|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	98.7	1.6e-220
WP_001247930.1|3454714_3455413_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_101974061.1|3455643_3456525_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.4	1.1e-144
WP_001101698.1|3456630_3456900_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_101975621.1|3458276_3458876_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	8.2e-109
3457407:3457423	attR	CCCTTCGGCCCCTGAGG	NA	NA	NA	NA
WP_101974059.1|3458942_3459674_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	99.6	4.2e-123
WP_000284506.1|3460060_3460276_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290217.1|3460352_3460625_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000142777.1|3460665_3460845_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_101974058.1|3460981_3462919_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	96.4	0.0e+00
WP_001356551.1|3463629_3463782_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204862.1|3464030_3464465_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	99.3	1.8e-81
WP_000144764.1|3464457_3464652_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001108006.1|3464648_3465254_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_001004008.1|3465253_3465976_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_062882575.1|3466050_3466785_-	antirepressor	NA	A0A0N7C203	Escherichia_phage	99.6	5.5e-123
WP_101974057.1|3467145_3467841_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.8	3.1e-131
WP_074433983.1|3467876_3468017_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	1.0e-14
WP_000814576.1|3468536_3468983_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3468939_3469176_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3469186_3469402_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3469534_3469813_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145931.1|3469883_3470174_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_064234920.1|3470170_3470872_-	Replication protein P	NA	A0A1U9AJJ8	Stx1_converting_phage	100.0	3.4e-130
WP_024231033.1|3473415_3474849_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	9.1e-29
>prophage 18
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	3695666	3782630	5302502	plate,terminase,tRNA,head,tail,integrase,capsid,portal,lysis	Salmonella_phage(60.0%)	95	3739356:3739400	3774390:3774434
WP_001298974.1|3695666_3696404_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219195.1|3696535_3697864_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001445929.1|3698072_3698954_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3699056_3699644_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3699699_3700083_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_062882030.1|3700385_3701075_+	uracil-DNA glycosylase	NA	A0A1L2JU97	Alcelaphine_gammaherpesvirus	51.5	1.3e-54
WP_000997403.1|3701122_3702160_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3702366_3702786_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001300438.1|3702854_3703553_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_062882029.1|3703584_3706245_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949248.1|3706358_3707714_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|3707759_3708083_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_062882028.1|3708079_3709378_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|3715154_3717728_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_062882642.1|3717857_3718589_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|3718585_3719566_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3719700_3720438_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3720708_3721050_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3721153_3721201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|3721300_3722461_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|3722503_3723625_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|3723635_3724706_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|3724915_3725281_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3725430_3725949_+	YfiR family protein	NA	NA	NA	NA	NA
WP_074434108.1|3725938_3727165_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589825.1|3727180_3727663_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3727739_3728087_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3728128_3728896_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3728926_3729475_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3729493_3729742_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_062882641.1|3729878_3731240_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3731406_3732198_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077879218.1|3732218_3733505_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001364786.1|3733559_3734153_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3734275_3735154_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3735239_3736901_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3737049_3737391_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3737452_3737743_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3737732_3738209_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162571.1|3738340_3738823_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3739356:3739400	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_000391795.1|3739523_3740006_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	2.7e-17
WP_000980501.1|3740032_3740251_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_096851631.1|3740319_3741420_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980416.1|3741416_3741902_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	8.3e-67
WP_096851630.1|3741898_3745060_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	59.6	1.8e-308
WP_000763311.1|3745052_3745172_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3745186_3745489_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3745543_3746059_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046120.1|3746068_3747241_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_000905030.1|3747383_3747950_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	3.2e-86
WP_024184674.1|3748022_3748526_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	54.3	1.8e-40
WP_040072409.1|3748525_3749128_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.4	6.6e-98
WP_021546685.1|3749099_3749540_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	4.7e-53
WP_101975618.1|3749566_3750967_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.4	7.5e-153
WP_001086824.1|3750963_3751569_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_000268279.1|3751561_3752470_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	1.3e-142
WP_000177597.1|3752456_3752816_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993752.1|3752812_3753391_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	8.8e-92
WP_024225817.1|3753459_3753906_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.1e-62
WP_001039936.1|3753898_3754330_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_024225818.1|3754425_3754854_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	4.2e-46
WP_000730948.1|3754850_3755228_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	1.1e-15
WP_001341072.1|3755229_3755703_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|3755722_3755938_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3755941_3756145_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_096851628.1|3756144_3756609_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	7.9e-75
WP_096851627.1|3756704_3757355_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.0	4.7e-110
WP_024046822.1|3757358_3758417_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000216248.1|3758433_3759267_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
WP_001098462.1|3759409_3761176_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_096211030.1|3761175_3762201_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.1	2.1e-173
WP_032344223.1|3762246_3762540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096851626.1|3763023_3764916_-	NTPase KAP	NA	NA	NA	NA	NA
WP_001217575.1|3765237_3765471_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3765481_3765670_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_096851625.1|3765823_3768238_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_096851624.1|3768234_3769092_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	7.8e-161
WP_000145290.1|3769088_3769391_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_000752613.1|3769387_3769615_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|3769614_3769848_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001747374.1|3769915_3770257_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_000956176.1|3770374_3770671_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_096851623.1|3770678_3771188_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.1	7.3e-82
WP_000102105.1|3771220_3771463_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_096851622.1|3771586_3772216_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	55.5	2.1e-62
WP_021534483.1|3772219_3773239_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.0	6.4e-186
WP_096851621.1|3773241_3774273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062882640.1|3774705_3774954_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
3774390:3774434	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_062882639.1|3775114_3775756_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	4.8e-107
WP_074434107.1|3775837_3776467_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	2.1e-78
WP_062882638.1|3776539_3777121_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	55.3	2.1e-48
WP_001101698.1|3777231_3777501_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	4.9e-45
WP_101975617.1|3777502_3778816_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.0	5.9e-75
WP_095585894.1|3778967_3779567_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	96.5	3.1e-108
WP_062881838.1|3780857_3782630_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	98.8	0.0e+00
>prophage 19
NZ_CP024618	Escherichia coli strain SMN152SH1 chromosome, complete genome	5302502	5294529	5302459	5302502		Enterobacteria_phage(46.15%)	13	NA	NA
WP_062881958.1|5294529_5295063_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	99.4	5.3e-99
WP_001093917.1|5295480_5295762_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_001061345.1|5295798_5296371_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
WP_001014289.1|5297380_5297572_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	1.6e-26
WP_040092683.1|5297573_5298128_-	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	99.5	4.1e-102
WP_000476212.1|5298124_5298364_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
WP_062881956.1|5298356_5298560_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	5.2e-31
WP_062881955.1|5298556_5298919_-	hypothetical protein	NA	S5MC15	Escherichia_phage	99.2	2.1e-67
WP_000008232.1|5298909_5299446_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081287.1|5299573_5300398_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|5300462_5300825_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_062881953.1|5301493_5302168_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.1	8.6e-131
WP_000649477.1|5302258_5302459_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
>prophage 1
NZ_CP024617	Escherichia coli strain SMN152SH1 plasmid pO177A1, complete sequence	88896	227	68535	88896	integrase,transposase,protease,tRNA,tail	Stx2-converting_phage(22.22%)	44	1773:1792	68562:68581
WP_010917875.1|227_431_-|tail	tail fiber protein	tail	A0A0C4UQV0	Shigella_phage	39.4	8.3e-05
WP_000904930.1|652_1213_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
1773:1792	attL	AAACCCGGGGCGGTTCACTT	NA	NA	NA	NA
WP_000543828.1|2139_3177_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000528254.1|3630_4368_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_001444515.1|4321_4522_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001114107.1|5136_5382_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_085949012.1|5490_6185_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_096851742.1|6224_6371_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	55.3	1.9e-06
WP_001171554.1|11113_11494_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|11753_12101_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_062881749.1|14130_18033_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_000789660.1|18337_18529_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	3.5e-05
WP_032205206.1|18539_18905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|19138_19519_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|19515_19863_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_062882354.1|21506_21920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000864811.1|22876_23230_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_032204690.1|23632_25072_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987096.1|25075_27196_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_062882355.1|27245_30242_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|30243_30759_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000911317.1|33088_33487_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_077916033.1|33486_33717_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_096851681.1|33795_39066_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_062881715.1|39085_39832_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.4	1.6e-08
WP_062881716.1|39886_40447_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001299730.1|40582_40795_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001312851.1|41475_41625_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083845.1|41908_42166_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001442103.1|42397_42472_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_032084500.1|42452_42947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096851680.1|42939_43797_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_062881718.1|44708_44993_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421257.1|44992_45268_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_085952403.1|45484_46698_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_101974185.1|46800_51504_-	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_106879220.1|57885_57939_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101974067.1|58608_59822_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
WP_000592771.1|59997_62208_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|62251_62641_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_032204852.1|63740_64025_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062882567.1|64535_65276_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361612.1|65560_66538_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_101974067.1|67322_68535_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	8.4e-169
68562:68581	attR	AAACCCGGGGCGGTTCACTT	NA	NA	NA	NA
