The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	1117220	1130403	4877335		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1117220_1117982_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1117975_1118602_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1118741_1119881_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1119943_1120936_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1121029_1122394_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1122482_1123259_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1123263_1123902_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1123898_1125161_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847984.1|1125157_1126066_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001300386.1|1126261_1127029_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1127079_1127736_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_039023140.1|1127841_1130403_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	1731760	1741201	4877335		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|1731760_1732687_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1732691_1733423_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1733403_1733511_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1733570_1734302_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1734523_1736209_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1736205_1736925_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1736971_1737442_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1737481_1737943_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001375261.1|1738067_1740068_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001333512.1|1740064_1741201_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 3
NZ_CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	1825394	1836309	4877335		Enterobacteria_phage(22.22%)	10	NA	NA
WP_125922846.1|1825394_1826672_+	hypothetical protein	NA	A0A1V0E6Q2	Klebsiella_phage	24.5	1.1e-12
WP_099147824.1|1826707_1828036_+	flippase	NA	NA	NA	NA	NA
WP_099147860.1|1828115_1828508_+	serine acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	41.1	6.8e-11
WP_000043542.1|1828679_1830086_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_049139659.1|1830310_1831375_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_016161468.1|1831401_1832271_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
WP_004206787.1|1832302_1833193_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
WP_004206788.1|1833207_1833762_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
WP_000704907.1|1833942_1835109_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_087523507.1|1835301_1836309_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 4
NZ_CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	2761398	2817440	4877335	terminase,holin,portal,integrase,tRNA,tail,capsid,head	Escherichia_phage(45.45%)	61	2769590:2769604	2817542:2817556
WP_001297484.1|2761398_2762505_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2762540_2763182_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2763185_2764556_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2764724_2765396_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2765395_2766856_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2766931_2768053_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359434.1|2768101_2769328_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2769577_2770714_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2769590:2769604	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2770697_2771561_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|2772115_2772784_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042047081.1|2773021_2773552_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_032143699.1|2774285_2774657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|2774965_2776474_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001233546.1|2780427_2781027_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|2781094_2784574_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|2784634_2785243_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|2785179_2785923_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|2785928_2786627_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|2786626_2786983_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|2786960_2790188_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|2790234_2790495_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|2790536_2790923_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097535.1|2790922_2791627_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|2791687_2792032_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|2792028_2792478_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2792474_2792813_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|2792821_2793139_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|2793215_2794433_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000923134.1|2795038_2796265_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|2796412_2798170_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2798169_2798652_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2798799_2799150_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|2799675_2799969_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2800059_2800242_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|2800458_2800992_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2801055_2801406_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2801410_2801626_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|2801933_2802122_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2802382_2802718_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2802788_2803001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2803489_2803576_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|2803970_2804792_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|2804788_2805169_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2805169_2806228_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2806229_2806508_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2806675_2806888_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001224662.1|2807922_2808105_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2808198_2808555_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|2808612_2809035_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2809075_2810146_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|2810217_2810643_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2810626_2810869_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|2811260_2811599_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_001092153.1|2812030_2812231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2812323_2812542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2812506_2812710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2813110_2813299_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2813295_2813487_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2813580_2816022_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2816083_2816353_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|2816321_2817440_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2817542:2817556	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 5
NZ_CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	3748754	3804562	4877335	terminase,integrase,portal,holin,transposase,plate,protease,tail,capsid,head	Shigella_phage(56.86%)	71	3750124:3750172	3790026:3790074
WP_000772656.1|3748754_3749963_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
3750124:3750172	attL	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_023147794.1|3750667_3751648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158638449.1|3752406_3753621_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	6.1e-34
WP_062914700.1|3753655_3755089_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.7	7.0e-106
WP_089602599.1|3755492_3756266_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.0	3.2e-36
WP_062914698.1|3756326_3756881_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.4	2.2e-87
WP_062914697.1|3756910_3757417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032316.1|3757419_3757830_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
WP_001340317.1|3757810_3758044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000383548.1|3758775_3759360_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_062914695.1|3759350_3760409_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	2.5e-201
WP_062914694.1|3760395_3760821_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	5.2e-81
WP_001259087.1|3760820_3761369_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	6.6e-97
WP_062914693.1|3761368_3762448_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	98.9	6.5e-205
WP_062914692.1|3762444_3763821_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.7	4.8e-253
WP_062914691.1|3763845_3765753_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.1	0.0e+00
WP_000571713.1|3765837_3766161_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_000090998.1|3766157_3766514_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_061353157.1|3766513_3768010_-|tail	phage tail protein	tail	U5P0H3	Shigella_phage	99.6	1.0e-277
WP_062914690.1|3767993_3768164_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	1.2e-25
WP_101973388.1|3768172_3768733_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	1.2e-104
WP_062914689.1|3768729_3769236_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	5.0e-83
WP_062914688.1|3769210_3769621_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	3.9e-70
WP_000927711.1|3769617_3769941_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_062914687.1|3769943_3770144_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	6.5e-26
WP_000257490.1|3770192_3771398_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	100.0	8.2e-225
WP_001193631.1|3771412_3772063_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_062914686.1|3772040_3773282_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	7.6e-242
WP_000605606.1|3773281_3773464_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_124064769.1|3773475_3774972_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	1.8e-298
WP_000929172.1|3775205_3775700_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135210.1|3775825_3776176_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	3.1e-63
WP_016159276.1|3776303_3776738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012599940.1|3777263_3777656_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	86.2	1.4e-53
WP_016159277.1|3777639_3778116_-	glycoside hydrolase family 104 protein	NA	U5P0A9	Shigella_phage	98.7	6.4e-88
WP_001120496.1|3778119_3778446_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_053897786.1|3778725_3779547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062914684.1|3779570_3780056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042093445.1|3780077_3780425_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	87.6	4.7e-56
WP_062914683.1|3780442_3781432_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	4.0e-193
WP_062914682.1|3781439_3782249_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.1	2.4e-151
WP_062914681.1|3782268_3782658_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	96.9	1.9e-66
WP_000210164.1|3782654_3782981_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_074151166.1|3782980_3783475_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.1e-85
WP_062914680.1|3783471_3784413_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
WP_001250269.1|3784402_3784582_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|3784757_3785309_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|3785346_3785547_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3785644_3786271_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000917896.1|3786456_3786753_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008200.1|3787429_3787966_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3787956_3788319_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3788318_3788624_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000433939.1|3788623_3788974_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051893.1|3788850_3790014_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_000893278.1|3790218_3791472_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3790026:3790074	attR	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3791483_3792587_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_039023169.1|3792874_3793930_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|3793968_3794370_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|3794427_3795672_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3795763_3796222_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|3796482_3797940_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|3797996_3798533_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|3798465_3798732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|3799037_3799490_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|3799499_3799898_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|3799900_3800194_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3800245_3801301_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001333407.1|3801371_3802142_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001334802.1|3802101_3803841_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3804064_3804562_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	3812820	3885663	4877335	plate,protease,tRNA,transposase	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_000420818.1|3812820_3813957_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|3814387_3814780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039023185.1|3814757_3818990_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|3819065_3821207_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3821416_3821935_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3822629_3823130_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3823164_3823389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3823439_3824915_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3824921_3825335_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3825338_3827189_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3827152_3828235_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|3828259_3829540_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3829536_3830061_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|3830063_3831395_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|3831399_3832161_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|3832169_3834935_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|3834931_3835675_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|3835679_3837092_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|3837200_3840635_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|3840645_3841998_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3842021_3842504_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908066.1|3842547_3843462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236653.1|3843471_3843951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|3844087_3844873_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|3845409_3846141_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|3846205_3846673_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|3846669_3847392_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|3847425_3848181_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3848252_3849611_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|3849658_3850282_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|3850285_3851086_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|3851326_3852241_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3852237_3853041_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|3858800_3859376_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|3859563_3860595_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|3860587_3861241_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3861280_3862096_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3862213_3862618_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3862614_3863322_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3863433_3865152_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|3865205_3866030_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|3866229_3866940_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|3866953_3867376_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3867372_3867918_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3868083_3868284_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3868270_3868531_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|3868579_3869878_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901099.1|3869942_3870332_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3870388_3872530_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3872628_3873588_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3873600_3877083_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3877119_3877716_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139654.1|3877712_3878861_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3878860_3879649_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3879652_3880108_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|3880212_3881238_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3881241_3881727_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3881848_3884281_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3884310_3885663_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 7
NZ_CP019071	Escherichia coli strain CRE1493 chromosome, complete genome	4877335	4557191	4655096	4877335	terminase,holin,portal,integrase,transposase,plate,tRNA,protease,head,tail,capsid,lysis	Escherichia_phage(48.0%)	98	4566891:4566926	4663981:4664016
WP_000187022.1|4557191_4558292_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4558331_4558691_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4558690_4559341_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|4559671_4561072_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4561054_4561972_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|4562238_4563612_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001352356.1|4563672_4564449_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4564456_4565461_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|4565614_4566766_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
4566891:4566926	attL	CCGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
WP_001005586.1|4567363_4570015_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556306.1|4570196_4571930_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274643.1|4572144_4572996_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323841.1|4572982_4573324_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204105.1|4573325_4574204_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184811.1|4574169_4576467_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4576517_4576838_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|4576852_4577932_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039023143.1|4578240_4580742_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	7.9e-12
WP_000424840.1|4580753_4581416_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|4581426_4582530_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647894.1|4582804_4583422_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271242.1|4583448_4584354_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001295695.1|4584446_4586627_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007529.1|4586955_4587846_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4588194_4590627_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_001295694.1|4590629_4591790_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4592066_4592384_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797353.1|4592567_4593176_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|4593236_4593449_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001333520.1|4593651_4595850_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4596005_4597031_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|4597122_4598082_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4598174_4598705_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|4598714_4600046_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4600112_4601039_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4601131_4601617_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4601701_4601947_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4602371_4603217_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4603239_4604748_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4604882_4605893_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|4605989_4606736_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323547.1|4606740_4607169_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655989.1|4607195_4607495_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4607706_4608147_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802214.1|4608247_4608847_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216327.1|4608954_4609722_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001326656.1|4609776_4610532_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045683.1|4610638_4611628_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591795.1|4611947_4612910_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4613090_4613993_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001145759.1|4614200_4614713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|4614986_4616356_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000468308.1|4616428_4616647_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|4616728_4617892_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|4617891_4618371_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069960.1|4618385_4620833_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000785970.1|4620825_4620945_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4620977_4621253_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4621309_4621828_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286718.1|4621840_4623031_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_062914736.1|4623090_4623693_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001333339.1|4623700_4625236_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|4625284_4625632_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|4625628_4626033_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001333405.1|4626174_4626690_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_024176421.1|4626704_4627307_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001032315.1|4627278_4627695_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
WP_001285346.1|4628989_4629601_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_001121501.1|4629593_4630502_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_000127167.1|4630506_4630854_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001093698.1|4630850_4631486_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_001001770.1|4631552_4632005_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_000917160.1|4631997_4632465_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
WP_000040631.1|4632572_4632998_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
WP_000736582.1|4632985_4633411_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
WP_001144097.1|4633425_4633923_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000123123.1|4633922_4634204_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846414.1|4634207_4634411_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
WP_062914735.1|4634410_4634920_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	4.3e-90
WP_024176422.1|4635019_4635763_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
WP_001248567.1|4635766_4636840_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_001085956.1|4636898_4637753_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_000156872.1|4637926_4639699_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038166.1|4639698_4640733_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
WP_000012516.1|4641104_4643588_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001016257.1|4644905_4645652_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_002431311.1|4645666_4647208_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_000027659.1|4648682_4648958_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|4648954_4649179_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|4649178_4649481_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|4649480_4649705_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4649768_4650269_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4650438_4650711_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4650847_4651141_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4651210_4652191_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|4652377_4652878_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|4653027_4653726_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4653722_4655096_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
4663981:4664016	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACGG	NA	NA	NA	NA
>prophage 1
NZ_CP019074	Escherichia coli strain CRE1493 plasmid p1493-3, complete sequence	73992	1256	56760	73992	transposase,integrase	Escherichia_phage(35.29%)	54	NA	NA
WP_063090490.1|1256_1997_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_101973396.1|3329_3962_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.0	1.6e-123
WP_000105383.1|4228_5665_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000427623.1|6082_7087_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_058672119.1|7285_7570_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.3	5.4e-10
WP_000079938.1|8039_8309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050858704.1|8305_8587_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_152931508.1|8639_8777_+	hypothetical protein	NA	Q6H9S6	Enterobacteria_phage	94.4	7.3e-13
WP_024187381.1|8742_8952_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
WP_063072981.1|9114_9372_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
WP_063072980.1|10010_10436_-	ester cyclase	NA	NA	NA	NA	NA
WP_001541953.1|10444_11434_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022631027.1|11449_12226_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001067858.1|13794_14499_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_101973397.1|14444_15239_-|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	9.2e-132
WP_000557454.1|16453_17314_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|17326_17869_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|18350_18542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|18547_18793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|19296_20001_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000845048.1|20135_21149_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|21293_21791_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|21902_22193_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|22198_22990_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000084745.1|23474_23867_+	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001376233.1|24186_24471_-	bleomycin resistance protein	NA	NA	NA	NA	NA
WP_001067858.1|24575_25280_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_002914189.1|25599_26775_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_000347934.1|26798_29951_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|30020_30500_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_101973398.1|30601_31306_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	4.5e-138
WP_001039464.1|31416_31803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351729.1|34405_34798_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|34935_35820_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|35851_37051_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|37156_37807_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|37838_38081_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001300563.1|38852_39965_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000427623.1|40460_41465_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|41543_41978_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|42049_42400_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_001143760.1|42561_45567_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001217881.1|45730_46288_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|46470_47331_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001043260.1|47492_48308_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|48368_49172_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|49171_50008_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|50313_50556_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_031606906.1|50587_51214_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_063097389.1|51319_52519_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|52785_53091_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214121.1|53118_54333_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001447541.1|54549_55434_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_077781541.1|55464_56760_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP019075	Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence	96986	0	94954	96986	holin,tail,terminase,integrase,transposase	Escherichia_phage(60.2%)	102	37134:37150	92195:92211
WP_158638452.1|1861_2251_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	100.0	7.6e-63
WP_000175491.1|2290_2656_-	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_001345482.1|4572_5175_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580776.1|5161_5605_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|5601_5931_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_048218298.1|6005_6269_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	62.4	4.0e-23
WP_023351542.1|6704_7277_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.6	1.5e-83
WP_048218313.1|7307_7796_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	72.2	1.7e-59
WP_062914758.1|7795_8398_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	9.8e-94
WP_001032314.1|8369_8786_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	4.1e-22
WP_077879135.1|8788_12010_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	46.0	1.1e-16
WP_001286326.1|12021_12456_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_048218248.1|12534_13371_-	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	98.2	8.4e-152
WP_062914759.1|13370_14804_-	hypothetical protein	NA	A0A1B0VAD6	Salmonella_phage	99.8	8.2e-272
WP_000002800.1|14800_15157_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_100183872.1|15156_18852_-	transglycosylase SLT domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	85.9	0.0e+00
WP_000926342.1|18933_19815_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	98.6	2.7e-172
WP_000523980.1|19829_20441_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_023153778.1|20451_21018_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	99.5	1.1e-99
WP_032192786.1|21248_22142_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	30.3	3.4e-26
WP_001057312.1|22193_22670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093548.1|22692_23043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001396852.1|23401_23521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071550046.1|23539_23761_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	9.3e-26
WP_033560573.1|23757_24849_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	79.8	7.1e-159
WP_001187875.1|25013_25814_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_062914760.1|25843_26689_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	97.5	1.8e-149
WP_052761440.1|26953_28009_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	70.8	9.0e-143
WP_001561122.1|28078_28366_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_053896077.1|28655_29252_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	100.0	6.3e-109
WP_000509939.1|29423_29933_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035251.1|29944_30526_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.5	3.8e-103
WP_062914761.1|30561_31377_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	9.8e-113
WP_062914762.1|31386_32976_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.5	1.9e-301
WP_023153705.1|33036_34743_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.4	4.7e-311
WP_053903354.1|34969_35971_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	4.8e-178
WP_001285362.1|35987_37184_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
37134:37150	attL	CATTCTGTTTGCTCTTT	NA	NA	NA	NA
WP_001076427.1|37741_38602_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_000458377.1|38928_39330_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	54.0	5.5e-32
WP_001281923.1|39400_39760_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.1	4.6e-38
WP_000336811.1|39771_39912_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	97.8	3.1e-19
WP_000007769.1|39937_40360_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_048218262.1|40399_41188_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.9	1.7e-117
WP_001369296.1|41196_41376_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_001177862.1|41649_41934_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
WP_000472529.1|41926_42832_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_062914763.1|42828_45093_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	66.8	0.0e+00
WP_000751808.1|47067_47895_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
WP_001276603.1|48284_49649_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_062914764.1|49648_50647_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.1	8.1e-194
WP_000535208.1|50693_51326_-	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_023153696.1|51318_52335_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	4.5e-192
WP_000602719.1|52336_53122_-	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.6	3.6e-144
WP_000896801.1|53108_53837_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141908.1|53840_55058_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235786.1|55067_55445_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|55591_55837_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943607.1|55839_56418_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000096174.1|56484_56640_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000484110.1|57141_57768_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_023352819.1|57764_58442_+	hypothetical protein	NA	Q71TJ1	Escherichia_phage	99.6	1.1e-133
WP_000684868.1|58438_59140_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	2.1e-143
WP_023153718.1|59441_60704_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.8	9.2e-235
WP_000021768.1|60776_61283_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
WP_023153717.1|61477_62206_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	1.7e-140
WP_000158004.1|62289_62493_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_023352820.1|62485_62725_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
WP_023154014.1|62721_63447_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	49.8	7.5e-48
WP_000118152.1|63443_63743_+	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_033550033.1|63744_64302_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	62.8	5.1e-36
WP_000224220.1|64303_64567_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_053903357.1|64577_65177_+	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	92.6	7.5e-78
WP_000516537.1|65259_65493_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_001677496.1|65671_65965_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
WP_023154376.1|65971_66346_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	97.6	1.1e-66
WP_077780118.1|66327_67260_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	97.7	2.6e-178
WP_001261544.1|67256_67619_+	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_001377386.1|68280_68532_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
WP_000506726.1|68655_69045_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|69117_69339_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|69338_69719_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113019.1|69723_69903_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_000648823.1|69930_70974_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.8	2.2e-205
WP_001369802.1|71062_71515_+	hypothetical protein	NA	Q71T63	Escherichia_phage	98.7	1.1e-78
WP_000219605.1|71601_72795_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	99.0	4.1e-208
WP_000124155.1|72794_74279_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
WP_000611656.1|74303_75155_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874154.1|75265_75475_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000542336.1|76078_76300_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_000067534.1|76307_77339_+|integrase	site-specific integrase	integrase	Q71TG5	Escherichia_phage	99.7	2.2e-194
WP_023156637.1|77946_78507_+	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	95.7	2.3e-97
WP_023156639.1|78695_79337_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	98.1	1.6e-113
WP_000747846.1|80746_80995_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|80991_81432_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_062914756.1|81465_88233_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.7	0.0e+00
WP_023153801.1|88308_90018_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_023352830.1|90010_91030_+	hypothetical protein	NA	Q71TR6	Escherichia_phage	89.7	7.6e-163
WP_001345478.1|91321_91879_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_023352831.1|92047_92536_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	87.7	1.1e-74
92195:92211	attR	AAAGAGCAAACAGAATG	NA	NA	NA	NA
WP_023351931.1|92738_93527_+	hypothetical protein	NA	A0A077SK34	Escherichia_phage	99.2	8.0e-144
WP_023352832.1|93519_94614_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.7	6.7e-40
WP_001165936.1|94645_94954_-	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
>prophage 1
NZ_CP019076	Escherichia coli strain CRE1493 plasmid p1493-5, complete sequence	127772	40494	90028	127772	integrase,transposase	Macacine_betaherpesvirus(28.57%)	51	77764:77823	93430:94252
WP_087523611.1|40494_41767_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.8e-174
WP_089634947.1|41752_42322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029702196.1|43676_44240_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	40.0	3.0e-20
WP_039023242.1|44287_45649_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|45700_45931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071781657.1|46447_46696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|46967_47159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271685.1|47155_47578_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001666994.1|47624_47927_-	antirestriction protein	NA	NA	NA	NA	NA
WP_113441034.1|48015_48258_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_061355072.1|48221_48446_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_001006251.1|48463_49234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001546462.1|49278_49713_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|49726_49948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032181561.1|49948_50632_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
WP_064766247.1|51016_51919_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817031.1|52656_53628_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|53627_54794_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|55381_56137_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016970.1|56858_57665_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159871.1|57665_57971_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813630.1|57972_58191_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001261286.1|58750_58981_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|58977_59394_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|59468_61034_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361402.1|61018_62041_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000449408.1|64290_64449_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000949452.1|64438_64945_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|65127_65943_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|66289_68176_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|68216_68744_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|68847_70227_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|70229_71513_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729219.1|71502_72633_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|72637_73333_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|73319_73805_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|73829_74315_+	hypothetical protein	NA	NA	NA	NA	NA
77764:77823	attL	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|77828_78533_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|79036_80050_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|80207_80681_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|80811_81600_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|81805_82153_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|82146_82986_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|83113_83317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|83472_84678_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|84688_84994_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|85220_85985_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|86477_87062_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|87061_88300_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|88296_89202_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|89323_90028_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
93430:94252	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTATTTTTCGGGGATCTGATTGCCCTCTGGCAATATCATTCAGCACGCCATAGTCGGCATCATGGTCCATTCGCCAGAAAACCGAAGCACCGGCATCAGCCAGGCGTGGAGAAAACTGGTATCCCAGCAGCCAGAAAAGGCCAAAGACAAGTTCGCTGGCACCTGCTGTATCGGTCATAATTTCGGTTGGATTCAGCCCGGTCTCCTGTTCCAGAAGACCTTCCAGCACAAAGATAGAGTCCCTCAGCGTCCCCGGTATAACGATGCCATGAAAGCCGGAATACTGATCGGACACAAAGTTGTACCAGGTGATCCCTCTGTTATTACCAAAGTATTTGCGGTTCGGTCCGGCATTGATTGTTCTGACTGGCGTAACAAAGCGCATTCCATCTGCAGATGCCACTTCTCCTCCACCCCATATCTGTGCCAGTGGCAGCGTTGCCTGAAAATCAACCAGTCTGGCATTAGCGCTGGTGATAGTTTCAGCCCGCAGATAGTTCGCTTTTGTCCAGTTCAGCCGGTGTCGGGTCAGTGCAGGAACATTTGATCTGATCAGTGGTTCCAGACCGATATTGCAGGCTTCAGCCATCAGCACGGCGCTGATGCTGACGGGCAGATCATCAACTCTGGCACTGGCTTCACTAGCATGGAAAAACTCATCAGCAAATCCGGTATGGGCGTTAATTTCGAGCAGCAACTCCGTTAAATCCACCGGAGGGAGTAGATCACTGATCATTTTGCTCAGTCGTTTCAGACTGTCCGGCT	NA	NA	NA	NA
