The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	301711	372466	4942719	integrase,plate	Enterobacteria_phage(50.0%)	67	316715:316735	329929:329949
WP_000667026.1|301711_303910_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_072643765.1|303919_304876_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|304854_305265_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000783650.1|305883_308217_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000856729.1|308231_308552_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459302.1|308687_309143_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|309135_309423_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980231.1|309415_310015_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.9e-49
WP_001149160.1|310011_310278_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283027.1|310829_311564_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	1.4e-129
WP_000638629.1|311560_312061_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446152.1|312134_312707_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
WP_000622599.1|313009_313750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064054.1|313746_315375_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001130497.1|315367_316552_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.4	3.2e-144
316715:316735	attL	GATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_077249963.1|316820_318155_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001240681.1|318235_318913_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.8	1.7e-46
WP_001609339.1|318960_320802_-	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	4.2e-18
WP_000990803.1|320836_321034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999103.1|321189_322221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013184.1|322235_322619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807036.1|322623_322821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390656.1|323802_324105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580787.1|324104_324308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532782.1|324365_324746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000606591.1|324880_325450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000873433.1|325693_325894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000059840.1|327308_327545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323651.1|328000_328552_-	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	60.0	1.2e-05
WP_000893255.1|330120_331374_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
329929:329949	attR	GATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_001285288.1|331385_332489_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749865.1|332776_333832_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_000174677.1|333870_334272_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189543.1|334329_335574_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|335665_336124_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|336384_337842_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602134.1|337898_338513_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001325639.1|338509_339676_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	5.5e-32
WP_001059855.1|339894_340347_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226182.1|340343_341399_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001349398.1|341469_342240_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001298878.1|342199_343939_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000598760.1|344043_344322_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|344314_344671_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543899.1|344727_345501_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|345686_345947_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615982.1|345949_346228_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|346383_347124_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|347094_347862_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|348067_348646_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|348885_351330_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|351372_351846_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118029.1|351999_352770_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_122985282.1|355257_355443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939262.1|355357_355840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508710.1|355823_360059_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.5e-23
WP_000103361.1|360134_362276_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_001142958.1|362485_363004_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|363700_364201_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|364235_364460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056975.1|364510_365986_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611738.1|365992_366406_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_072643767.1|366409_368260_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|368223_369306_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|369330_370611_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|370607_371132_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246437.1|371134_372466_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 2
NZ_CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	1464011	1544513	4942719	transposase,integrase,tRNA	Escherichia_phage(20.69%)	80	1535293:1535352	1550007:1550827
WP_000230718.1|1464011_1464455_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	4.8e-45
WP_000204054.1|1464471_1464849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072645.1|1464852_1465335_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
WP_000594596.1|1466307_1467006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016231879.1|1467156_1469877_-	lytic transglycosylase domain-containing protein	NA	A5VW64	Enterobacteria_phage	60.9	7.5e-149
WP_072643837.1|1469873_1471193_-	DNA transfer protein p33	NA	B6SCW4	Bacteriophage	43.2	1.6e-35
WP_000909176.1|1471192_1471870_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_000420674.1|1471863_1472325_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001555747.1|1473087_1475844_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.0	3.4e-298
WP_001208878.1|1475830_1476202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628967.1|1476194_1476536_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_042196814.1|1476546_1477149_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.8	8.8e-26
WP_000181940.1|1477141_1477363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|1477359_1477623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|1477619_1477814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001399727.1|1477806_1478874_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	36.8	8.9e-13
WP_033554327.1|1478867_1479050_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_072643836.1|1479042_1479876_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	46.7	9.0e-21
WP_000412532.1|1479888_1480320_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.8e-28
WP_001018038.1|1480319_1480523_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_063101851.1|1480629_1481580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028120363.1|1481598_1482852_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.1	3.9e-193
WP_000621336.1|1483040_1483904_-	YicC family protein	NA	NA	NA	NA	NA
WP_001247093.1|1484030_1484747_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_000806162.1|1484812_1485454_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000818601.1|1485490_1486087_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_001298007.1|1486193_1486649_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050152.1|1486629_1487850_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.7	1.1e-43
WP_001352775.1|1488021_1488690_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|1488906_1489143_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|1489163_1489331_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|1489428_1490238_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|1490276_1490756_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_000891564.1|1490763_1492041_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_000360402.1|1492453_1493512_+	lipopolysaccharide core heptosyltransferase RfaQ	NA	NA	NA	NA	NA
WP_000634246.1|1493508_1494633_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001298957.1|1494625_1495423_+	lipopolysaccharide core heptose(I) kinase RfaP	NA	NA	NA	NA	NA
WP_000080643.1|1495465_1496473_+	lipopolysaccharide 3-alpha-galactosyltransferase	NA	NA	NA	NA	NA
WP_000639946.1|1496498_1497206_+	lipopolysaccharide core heptose(II) kinase RfaY	NA	NA	NA	NA	NA
WP_000346017.1|1497230_1498244_+	UDP-glucose--(galactosyl) LPS alpha1,2-glucosyltransferase	NA	NA	NA	NA	NA
WP_000227812.1|1498252_1499395_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_000204742.1|1499430_1500639_-	O-antigen ligase RfaL	NA	NA	NA	NA	NA
WP_001264565.1|1500635_1501628_-	lipopolysaccharide heptosyltransferase RfaC	NA	NA	NA	NA	NA
WP_000699219.1|1501631_1502678_-	ADP-heptose--LPS heptosyltransferase RfaF	NA	NA	NA	NA	NA
WP_000587764.1|1502687_1503620_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001307464.1|1503908_1504781_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|1505055_1506252_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|1506261_1507287_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|1507525_1508560_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|1508546_1509506_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|1509509_1510793_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001352773.1|1510802_1512347_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001315904.1|1512591_1513023_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|1513163_1513415_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_000003382.1|1513477_1513945_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_001076194.1|1513944_1514964_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001277561.1|1515043_1515865_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000932342.1|1515917_1516391_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_000586964.1|1516576_1517767_-	quinone-dependent L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001297449.1|1517763_1518540_-	transcriptional regulator LldR	NA	NA	NA	NA	NA
WP_001297977.1|1518539_1520195_-	L-lactate permease	NA	NA	NA	NA	NA
WP_001033224.1|1520563_1525414_-	adhesin	NA	NA	NA	NA	NA
WP_024199749.1|1525457_1526039_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000665680.1|1526684_1527047_-	YibL family ribosome-associated protein	NA	NA	NA	NA	NA
WP_000517100.1|1527331_1527541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000228271.1|1527552_1528140_-	transcriptional repressor MtlR	NA	NA	NA	NA	NA
WP_000645424.1|1528139_1529288_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000093247.1|1529517_1531431_-	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_000479626.1|1531967_1532330_+	DUF3302 domain-containing protein	NA	NA	NA	NA	NA
WP_000364939.1|1532332_1533469_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000412211.1|1534487_1535147_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
1535293:1535352	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|1535356_1536061_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|1536182_1537088_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|1537084_1538323_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|1538322_1538907_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072647428.1|1539399_1540164_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	71.2	2.8e-93
WP_014839980.1|1540549_1540966_+	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
WP_101973099.1|1540970_1542653_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-225
WP_001067855.1|1542643_1543348_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|1543499_1544513_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
1550007:1550827	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGCCAGGAATGCCCGGCGCGCGGATACTTCCGCTCAAGGGCGTCGGGAAGCGCAACGCCGCTGCGGCCCTCGGCCTGGTCCTTCAGCCACCATGCCCGTGCACGCGACAGCTGCTCGCGCAGGCTGGGTGCCAAGCTCTCGGGTAACATCAAGGCCCGATCCTTGGAGCCCTTGCCCTCCCGCACGATGATCGTGCCGTGATCGAAATCCAGATCCTTGACCCGCAGTTGCAAACCCTCACTGATCCGCATGCCCGTTCCATACAGAAGCTGGGCGAACAAACGATGCTCGCCTTCCAGAAAACCGAGGATGCGAACCACTTCATCCGGGGTCAGCACCACCGGCAAGCGCCGCGACGGCCGAGGTCTTCCGATCTCCTGAAGCCAGGGCAGATCCGTGCACAGCACCTTGCCGTAGAAGAACAGCAAGGCCGCCAATGCCTGACGATGCGTGGAGACCGAAACCTTGCGCTCGTTCGCCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTGGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTT	NA	NA	NA	NA
>prophage 3
NZ_CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	2548615	2555755	4942719		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2548615_2549254_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590388.1|2549250_2550513_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_000847985.1|2550509_2551418_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|2551613_2552381_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|2552431_2553088_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272894.1|2553193_2555755_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
>prophage 4
NZ_CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	2933822	3024717	4942719	head,transposase,terminase,portal,tRNA,holin,integrase,plate,capsid,tail	Enterobacteria_phage(82.98%)	89	2983502:2983525	3028533:3028556
WP_024176232.1|2933822_2934974_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	6.8e-43
WP_087599334.1|2935443_2936599_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	4.7e-68
WP_000864948.1|2937143_2938169_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000824228.1|2938140_2939430_-	MFS transporter	NA	NA	NA	NA	NA
WP_123863910.1|2940663_2940954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072643857.1|2941704_2944014_+	ATPase	NA	NA	NA	NA	NA
WP_000117529.1|2944017_2945334_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000093090.1|2945330_2947529_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_000100141.1|2948010_2949027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087530468.1|2950932_2952094_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.4e-51
WP_000160236.1|2954599_2954755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131472.1|2956021_2957212_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	7.6e-130
WP_000368131.1|2957537_2958470_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|2958763_2959519_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937833.1|2959700_2960759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296861.1|2961124_2962465_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|2962836_2963121_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531954.1|2963300_2964611_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_072643721.1|2964610_2966755_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|2966957_2967443_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|2968117_2968681_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001617103.1|2968762_2971405_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_001281615.1|2971424_2972177_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000678661.1|2972193_2972700_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|2972696_2973167_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000730291.1|2973163_2973688_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001323815.1|2973689_2974547_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|2974668_2975220_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001295704.1|2975385_2976318_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918470.1|2976352_2977438_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001043799.1|2977441_2978266_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|2978265_2979075_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089232.1|2979074_2979623_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|2979656_2979935_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683808.1|2980055_2982062_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|2982220_2983441_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
2983502:2983525	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_000127762.1|2983751_2984930_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|2984926_2985922_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_072643722.1|2986190_2987084_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_001173929.1|2987088_2987421_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000078920.1|2987683_2987824_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|2988014_2988275_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_025653455.1|2988317_2989427_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.5e-204
WP_000005386.1|2989584_2990769_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
WP_000290462.1|2990768_2991281_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651572.1|2991336_2991711_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000333503.1|2991719_2991875_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_072643723.1|2991861_2994669_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.3	0.0e+00
WP_000979955.1|2994681_2995170_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954202.1|2995326_2995899_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_072643724.1|2995942_2996521_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.5	3.5e-96
WP_072643725.1|2996520_2998863_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	98.1	4.1e-111
WP_072643726.1|2998865_2999396_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	5.6e-93
WP_072643727.1|2999388_3000285_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_000213441.1|3000288_3000639_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	7.8e-59
WP_001519197.1|3000635_3001217_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	3.3e-102
WP_077249964.1|3001213_3001849_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_000920594.1|3001841_3002309_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780545.1|3002446_3002854_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	2.5e-64
WP_000072327.1|3002850_3003243_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_072643729.1|3003239_3003563_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	6.1e-50
WP_000864897.1|3003565_3003766_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_001297578.1|3003765_3004260_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
WP_001297575.1|3004361_3005162_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
WP_001055119.1|3005207_3006260_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
WP_032191985.1|3006283_3007120_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
WP_072643730.1|3007274_3009026_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.4	0.0e+00
WP_000087812.1|3009025_3010072_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001068329.1|3010720_3011218_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_025653443.1|3011257_3012100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025653442.1|3012183_3012498_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	53.3	1.4e-19
WP_001504475.1|3012502_3013462_-	plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
WP_072643731.1|3013538_3016379_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.0	0.0e+00
WP_000564228.1|3016375_3016765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447282.1|3016761_3017379_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|3017390_3017690_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153674.1|3017686_3017932_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000985159.1|3017928_3018132_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021656.1|3018218_3018332_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514283.1|3018328_3018571_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
WP_000158962.1|3018582_3018870_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000813367.1|3018880_3019222_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	6.6e-55
WP_000200501.1|3019474_3019681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004249.1|3019687_3019975_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_001390705.1|3020088_3020409_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000023401.1|3020505_3021510_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
WP_025653439.1|3021668_3022826_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	6.0e-23
WP_001289165.1|3022891_3023905_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283581.1|3023904_3024717_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
3028533:3028556	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
>prophage 5
NZ_CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	3318721	3330526	4942719		Enterobacteria_phage(33.33%)	10	NA	NA
WP_101973116.1|3318721_3320116_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
WP_000183060.1|3320290_3321184_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_101973117.1|3321555_3322641_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	3.6e-102
WP_001023611.1|3322640_3323540_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	2.8e-28
WP_032255796.1|3323597_3324476_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.0e-107
WP_032255798.1|3324478_3325024_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.7	1.3e-52
WP_032255466.1|3325054_3326329_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	25.6	5.1e-23
WP_032255468.1|3326353_3327376_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	45.1	2.8e-72
WP_032255470.1|3327488_3328694_+	O35 family O-antigen flippase	NA	NA	NA	NA	NA
WP_032255472.1|3328681_3330526_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.7	1.9e-34
>prophage 6
NZ_CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	3814728	3881879	4942719	head,lysis,terminase,portal,integrase,capsid,tail,protease	Enterobacteria_phage(45.1%)	76	3811827:3811841	3862939:3862953
3811827:3811841	attL	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_001260840.1|3814728_3815550_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|3815649_3815733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743960.1|3815825_3816161_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091838.1|3816557_3817811_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|3817917_3818811_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|3818945_3820166_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|3820290_3820986_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|3820938_3822231_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|3822389_3823004_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|3823046_3823901_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|3823902_3824520_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|3824530_3826954_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041535.1|3827014_3829441_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
WP_001295396.1|3829639_3829945_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3830052_3830763_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|3830765_3831326_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|3831360_3831702_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3831836_3832163_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001370501.1|3832368_3833583_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|3833594_3834614_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001389342.1|3834671_3834800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876986.1|3834801_3836082_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001296941.1|3836116_3836353_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048286.1|3836440_3838912_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.5e-58
WP_001083273.1|3839005_3839197_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001331023.1|3839193_3839382_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331024.1|3839782_3839935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171928.1|3839921_3840137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|3840296_3840452_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000362155.1|3840717_3841137_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|3841237_3841519_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|3841502_3841928_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|3841999_3843070_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|3843110_3843533_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|3843873_3845871_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_000625668.1|3845934_3847212_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019008.1|3847342_3848224_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000957771.1|3848220_3848913_-	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_001117226.1|3848924_3850124_-	MFS transporter	NA	NA	NA	NA	NA
WP_122083109.1|3850635_3850743_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|3850787_3851000_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_011478175.1|3851167_3851446_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265040.1|3851447_3852497_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
WP_000904112.1|3852509_3852884_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762868.1|3852880_3853702_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
WP_000562553.1|3854602_3854734_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506937.1|3855100_3855529_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|3855700_3856075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|3856326_3856542_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001135280.1|3856541_3857039_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|3857255_3857438_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|3857528_3857822_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_032195597.1|3858184_3858379_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	2.2e-26
WP_072643792.1|3858767_3859313_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	1.5e-93
WP_001609942.1|3859287_3861213_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198150.1|3861209_3861416_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	4.9e-29
WP_001331248.1|3861412_3863014_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	3.6e-308
3862939:3862953	attR	CTGGGCGGCTGCGGC	NA	NA	NA	NA
WP_000123295.1|3862994_3864314_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.5	3.4e-232
WP_001513196.1|3864323_3864656_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063218.1|3864711_3865737_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|3865778_3866174_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|3866185_3866539_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975054.1|3866550_3867129_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000683105.1|3867125_3867521_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001609944.1|3867528_3868269_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000479169.1|3868284_3868707_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459488.1|3868688_3869123_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_072643793.1|3869115_3871677_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.6	0.0e+00
WP_000847345.1|3871673_3872003_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152538.1|3872002_3872701_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_001746230.1|3872706_3873450_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.3e-148
WP_071596891.1|3873386_3874019_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	87.1	7.4e-92
WP_047656194.1|3874079_3877493_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
WP_001230353.1|3877562_3878162_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
WP_072005420.1|3878226_3881298_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	1.6e-67
WP_001593356.1|3881297_3881879_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 7
NZ_CP019051	Escherichia coli strain CRE1540 chromosome, complete genome	4942719	4545829	4598503	4942719	transposase,integrase,tRNA,protease	Pseudomonas_phage(15.0%)	44	4545227:4545241	4595506:4595520
4545227:4545241	attL	TATTTCAGGCGGTCC	NA	NA	NA	NA
WP_000886683.1|4545829_4547122_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|4547212_4548556_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|4548566_4549178_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077012.1|4549332_4553400_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|4553534_4554029_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|4554573_4555539_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043618.1|4555661_4557428_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|4557428_4559150_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|4559191_4559896_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4560180_4560399_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_072643849.1|4560877_4561720_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_072643848.1|4561804_4562002_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_039022338.1|4562013_4562502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854808.1|4562498_4562876_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001354276.1|4562964_4563333_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_072643847.1|4563382_4564027_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	33.3	7.7e-28
WP_000692312.1|4564045_4564267_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186725.1|4564335_4564812_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214415.1|4564827_4565313_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	5.3e-13
WP_072643846.1|4565404_4566223_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	2.1e-46
WP_101973129.1|4566550_4569397_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069764.1|4569768_4570641_-	GTPase family protein	NA	NA	NA	NA	NA
WP_072647417.1|4570904_4572461_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.2e-105
WP_072643822.1|4572457_4573609_+	restriction endonuclease subunit S	NA	A0A1V0SKS6	Klosneuvirus	20.7	1.5e-05
WP_062895413.1|4573730_4576847_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_042631068.1|4576994_4577975_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_029364370.1|4578094_4578475_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
WP_000612591.1|4578471_4578819_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_072643824.1|4578868_4580407_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	2.2e-283
WP_029396387.1|4580844_4581579_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072643825.1|4581983_4582268_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_001287791.1|4582774_4582966_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124181.1|4583018_4583252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260380.1|4583347_4583971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029396382.1|4584231_4584627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002461143.1|4584923_4585697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973130.1|4586559_4587833_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.5e-168
WP_101973131.1|4588398_4588962_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_072643827.1|4590172_4591996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072643828.1|4592096_4592345_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_065304405.1|4592360_4593926_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_072643829.1|4594149_4595358_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.2	2.9e-44
WP_000934041.1|4595875_4598152_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
4595506:4595520	attR	TATTTCAGGCGGTCC	NA	NA	NA	NA
WP_000520781.1|4598182_4598503_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 1
NZ_CP019053	Escherichia coli strain CRE1540 plasmid p1540-2, complete sequence	155802	18006	42760	155802	transposase	Escherichia_phage(66.67%)	26	NA	NA
WP_001067855.1|18006_18711_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|18943_19804_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|20172_20877_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|20882_21023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|21508_22246_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|22242_22467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|22677_24171_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|24201_25086_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_023300759.1|25302_26517_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_101973135.1|26544_26898_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000164043.1|28421_29072_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|29103_29346_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067855.1|29722_30427_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|30548_31454_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|31450_32689_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|32688_33273_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|33765_34530_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|34756_35062_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|35072_36278_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|36433_36637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|36764_37604_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|37597_37945_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|38167_38620_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004201164.1|39360_40173_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|40176_40542_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_000050481.1|41218_42760_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP019054	Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence	116028	546	61749	116028	plate,transposase,terminase,integrase	Escherichia_phage(67.24%)	63	11575:11589	62138:62152
WP_000523980.1|546_1158_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000188920.1|1168_1735_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_047630001.1|1815_2355_-	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	99.4	6.8e-46
WP_000039791.1|2358_2871_-	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
WP_000743164.1|3710_4754_+	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	92.5	2.0e-171
WP_001187875.1|4917_5718_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_001313473.1|5747_6593_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.2	2.1e-150
WP_001426344.1|6643_6889_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_001313475.1|7070_7226_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_072643890.1|7419_8532_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000509939.1|8691_9201_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035301.1|9212_9794_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_023156920.1|9829_10645_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	7.5e-113
WP_000085143.1|10654_12244_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	100.0	1.1e-306
11575:11589	attL	TCGAAATCAGCTCTT	NA	NA	NA	NA
WP_000067710.1|12304_14011_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_000038866.1|14236_15238_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|15254_16451_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001113737.1|17721_18606_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	100.0	9.5e-162
WP_001281124.1|18940_19333_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	100.0	1.5e-71
WP_000007765.1|19510_19933_-	hypothetical protein	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
WP_072643889.1|19972_20761_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	93.9	1.4e-116
WP_001369296.1|20769_20949_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_063099995.1|21223_21508_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_072643888.1|21500_22406_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	1.0e-158
WP_072643887.1|22402_24667_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.3	0.0e+00
WP_000900640.1|26224_26650_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
WP_000234831.1|26649_26814_+	DUF3927 family protein	NA	Q71T96	Escherichia_phage	100.0	7.6e-17
WP_001276603.1|27286_28651_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_015974268.1|28650_29649_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	100.0	1.9e-195
WP_000535202.1|29695_30328_-|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
WP_015974269.1|30320_31337_-	hypothetical protein	NA	Q71T91	Escherichia_phage	100.0	2.7e-192
WP_015974270.1|31338_32124_-	hypothetical protein	NA	Q71T90	Escherichia_phage	100.0	9.4e-145
WP_000896806.1|32110_32839_-	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_001141915.1|32842_34060_-	hypothetical protein	NA	Q71T88	Escherichia_phage	100.0	1.4e-224
WP_000235786.1|34069_34447_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|34593_34839_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943609.1|34841_35420_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	100.0	1.5e-107
WP_000096174.1|35486_35642_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000484110.1|36143_36770_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_001354545.1|36766_37444_+	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000684845.1|37440_38142_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_064669532.1|38443_39706_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.8	2.7e-234
WP_072643886.1|39778_40285_+	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	98.2	3.5e-92
WP_072643885.1|40549_43666_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.2	2.2e-27
WP_001293319.1|43787_44993_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_101973138.1|44989_46546_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	2.2e-105
WP_001190712.1|46728_46950_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|46949_47330_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113018.1|47334_47514_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_094319660.1|47541_48585_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.1	2.2e-205
WP_016236875.1|48673_49126_+	hypothetical protein	NA	Q71T63	Escherichia_phage	98.7	2.0e-78
WP_000219607.1|49212_50406_+	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	94.0	1.3e-201
WP_000124150.1|50405_51890_+|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_000611657.1|51915_52767_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	4.0e-157
WP_000874154.1|52877_53087_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_063080290.1|53691_53913_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	98.6	1.7e-35
WP_000067536.1|53920_54952_+|integrase	site-specific integrase	integrase	A0A077SLE7	Escherichia_phage	99.4	1.4e-193
WP_063080289.1|55002_55314_+	hypothetical protein	NA	A0A077SK03	Escherichia_phage	98.1	8.8e-46
WP_000084745.1|56486_56879_+	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_063102497.1|57198_57585_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_001067858.1|57778_58483_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_077249987.1|58529_59342_-	acyl-CoA--6-aminopenicillanic acid acyl-transferase	NA	NA	NA	NA	NA
WP_000602738.1|60996_61749_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
62138:62152	attR	TCGAAATCAGCTCTT	NA	NA	NA	NA
>prophage 2
NZ_CP019054	Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence	116028	76502	115598	116028	transposase,lysis,head,holin,tail	Escherichia_phage(64.52%)	31	NA	NA
WP_000018321.1|76502_77318_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_001067855.1|77611_78316_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023351534.1|80044_80686_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	96.7	1.2e-110
WP_000526244.1|80788_81916_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	74.1	7.6e-156
WP_000747846.1|81952_82201_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|82197_82638_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_072643813.1|82671_89439_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
WP_024200402.1|89514_91224_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_000132937.1|91216_92236_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001345478.1|92527_93085_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000068862.1|93254_93743_+	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	98.8	2.5e-87
WP_072643812.1|93976_95089_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	95.7	1.0e-197
WP_001165932.1|95831_96143_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
WP_072643811.1|96132_99120_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.2	0.0e+00
WP_029401678.1|99132_99498_-	hypothetical protein	NA	A0A077SK35	Escherichia_phage	99.2	2.3e-45
WP_032163796.1|99494_101414_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	96.2	0.0e+00
WP_001345482.1|101415_102018_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_072643810.1|102004_102448_-|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	99.3	2.2e-82
WP_000887652.1|102444_102774_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000332810.1|102841_103123_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	98.9	1.8e-45
WP_000905118.1|103250_103811_+	recombinase family protein	NA	Q71TD8	Escherichia_phage	100.0	2.1e-98
WP_094319512.1|103858_105094_+|tail	phage tail protein	tail	A0A077SK37	Escherichia_phage	65.3	3.4e-181
WP_047630150.1|105096_105630_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	99.4	3.2e-96
WP_001164120.1|105658_106186_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.7	7.3e-93
WP_094319511.1|106189_109030_-|tail	phage tail protein	tail	Q71TP5	Escherichia_phage	83.3	0.0e+00
WP_001286328.1|109041_109476_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	9.6e-75
WP_001189838.1|109554_110391_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.3	5.8e-153
WP_000047923.1|110390_111824_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_000002800.1|111820_112177_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_101973136.1|112176_115197_-	transglycosylase SLT domain-containing protein	NA	A0A077SK38	Escherichia_phage	99.2	0.0e+00
WP_101973137.1|115235_115598_-	hypothetical protein	NA	Q1MVL3	Enterobacteria_phage	95.5	3.4e-49
>prophage 1
NZ_CP019055	Escherichia coli strain CRE1540 plasmid p1540-4, complete sequence	184166	24180	83820	184166	bacteriocin,protease,transposase	Enterobacteria_phage(23.53%)	39	NA	NA
WP_001442106.1|24180_24522_+|transposase	transposase	transposase	Q6H9S4	Enterobacteria_phage	92.4	5.5e-41
WP_001334660.1|25747_25867_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000451769.1|26619_26853_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_053216792.1|26853_27111_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001128098.1|27188_28421_-	MFS transporter	NA	NA	NA	NA	NA
WP_072647545.1|28432_29194_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	1.2e-14
WP_000110581.1|29193_30231_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000756335.1|30230_31229_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000086538.1|31583_32174_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	6.2e-24
WP_072647544.1|32751_33762_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.5	2.1e-19
WP_000124098.1|34228_34594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021514811.1|34715_35867_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
WP_001696784.1|36832_40966_+|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.6	4.3e-297
WP_000612591.1|43142_43490_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|43486_43867_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_072647542.1|43942_44923_-	FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_000379710.1|44919_45189_-	membrane protein	NA	NA	NA	NA	NA
WP_001323890.1|46128_46365_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001259758.1|46342_46654_+	colicin V	NA	NA	NA	NA	NA
WP_001183604.1|46823_48938_-	microcin H47 export transporter peptidase/ATP-binding subunit MchF	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_053216796.1|48912_50154_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001324224.1|50868_51066_+	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_000969988.1|51062_51245_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000377483.1|51343_51652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072647540.1|52211_53246_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	42.6	1.1e-73
WP_001222186.1|54090_56268_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_000271277.1|56312_57269_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933675.1|57353_58583_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_011402704.1|58686_62472_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_001318220.1|62485_63601_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000738422.1|66745_67039_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_085948338.1|67700_68973_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.8e-175
WP_000450493.1|69428_70622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000974761.1|72884_73826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001318212.1|75399_76770_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000733250.1|76773_78714_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_000928805.1|78710_79898_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	54.7	7.8e-10
WP_001312823.1|81435_81594_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000280980.1|82866_83820_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP019055	Escherichia coli strain CRE1540 plasmid p1540-4, complete sequence	184166	87015	149473	184166	integrase,transposase	Macacine_betaherpesvirus(23.53%)	52	71432:71447	150755:150770
71432:71447	attL	GGCATGAACAACCAGA	NA	NA	NA	NA
WP_001066942.1|87015_87756_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361611.1|88040_89018_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_072647572.1|91997_92912_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|92911_93739_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_072647571.1|93735_94593_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|94589_95447_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001318207.1|96689_97070_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000095526.1|97449_98643_-	MFS transporter	NA	NA	NA	NA	NA
WP_000602863.1|98778_100503_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000011908.1|100503_101451_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015721.1|101450_103193_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|103189_104467_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973520.1|104548_106750_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000361402.1|108206_109229_-	helicase UvrD	NA	NA	NA	NA	NA
WP_001128474.1|109213_110779_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001034044.1|110853_111270_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_072647566.1|111266_111497_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001513523.1|111883_114022_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044768.1|114183_114600_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|114596_114827_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001513524.1|115245_115935_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_001513525.1|115965_116655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813630.1|117210_117429_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|117430_117736_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_072748653.1|117736_118483_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	4.4e-43
WP_085947917.1|119344_120618_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000616196.1|120737_121184_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	55.3	1.8e-28
WP_015387373.1|121279_121537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523378.1|122265_122478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513516.1|123604_123781_-	lasso peptide microcin J25	NA	NA	NA	NA	NA
WP_001513515.1|124120_124747_+	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_001513514.1|124749_126291_+	lasso peptide isopeptide bond-forming cyclase	NA	NA	NA	NA	NA
WP_001513513.1|126293_128036_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.4	2.7e-19
WP_001238646.1|129903_131070_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000817028.1|131069_132041_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_000343071.1|133517_134093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|134238_135401_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_072647562.1|135839_136811_-|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	31.7	1.9e-25
WP_010891293.1|137335_137638_+	antirestriction protein	NA	NA	NA	NA	NA
WP_072647561.1|137684_138104_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027505.1|138103_138286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071589505.1|138759_139017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218649.1|139277_139508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001593055.1|139559_140921_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001333938.1|140967_141531_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.0	3.6e-21
WP_072647560.1|142008_142980_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_072647559.1|143532_144072_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_000005985.1|144129_144363_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001593049.1|144421_146386_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.7	9.2e-24
WP_000845962.1|146454_146889_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001016257.1|147170_147917_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_001298859.1|147931_149473_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
150755:150770	attR	GGCATGAACAACCAGA	NA	NA	NA	NA
