The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	27282	70036	4105450	transposase,tRNA	Synechococcus_phage(50.0%)	42	NA	NA
WP_010930363.1|27282_28233_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995007.1|28314_28650_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929578.1|28674_29109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247164.1|29141_30359_-	thiolase family protein	NA	NA	NA	NA	NA
WP_010929580.1|30364_30862_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019247165.1|31069_32005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929582.1|32214_33006_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929583.1|33048_34470_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010929584.1|34625_35576_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814398.1|35572_36763_-	MFS transporter	NA	NA	NA	NA	NA
WP_010929585.1|37012_37924_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_010929586.1|37925_40064_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003814404.1|40060_40600_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003814405.1|40603_41332_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929587.1|41318_42212_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_019247766.1|42282_42678_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_003814412.1|42687_43218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
WP_023852754.1|43346_43646_-	DUF1974 domain-containing protein	NA	NA	NA	NA	NA
WP_010929588.1|43663_44614_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929589.1|45200_45749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815265.1|45720_45957_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815255.1|46084_46978_+	membrane protein	NA	NA	NA	NA	NA
WP_010929590.1|48147_49395_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003817748.1|49391_50006_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_010929591.1|50141_51092_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443813.1|51134_52391_+	muropeptide transporter	NA	NA	NA	NA	NA
WP_010929592.1|53622_54357_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_019247224.1|54362_54953_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_003817737.1|54977_55667_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023852650.1|55663_56425_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010929594.1|56504_57404_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|57497_58448_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929595.1|59248_60475_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010929596.1|60474_60894_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929597.1|61077_62019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248755.1|62442_63417_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929599.1|63473_64055_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010929600.1|64067_64370_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_029443770.1|64488_65547_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_019247832.1|65581_66853_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010929603.1|67482_68664_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929584.1|69085_70036_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	232645	291254	4105450	transposase	uncultured_Mediterranean_phage(20.0%)	44	NA	NA
WP_010929956.1|232645_233596_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929591.1|233715_234666_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931563.1|234662_235853_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_010931562.1|235974_236739_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_003807735.1|236825_237929_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010931561.1|238120_239137_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815102.1|239418_239907_+	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	34.1	1.6e-17
WP_003817656.1|241250_241931_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.8	3.5e-15
WP_010931560.1|241992_242844_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_010931559.1|242840_243638_-	thiazole synthase	NA	NA	NA	NA	NA
WP_010931558.1|243741_244635_-	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_010931557.1|244646_246536_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.8	7.6e-07
WP_010931556.1|246872_250646_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	50.8	8.6e-10
WP_010929591.1|250642_251593_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268689.1|251610_251787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023853374.1|251747_251888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929826.1|251901_252594_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
WP_003818232.1|252967_253468_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_023853391.1|253574_254495_+	bestrophin	NA	NA	NA	NA	NA
WP_010929823.1|254511_254988_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929822.1|255081_256932_+	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
WP_010929821.1|256987_257746_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929820.1|257773_259207_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003818225.1|259280_260060_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929819.1|260072_260906_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020699616.1|260914_261685_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
WP_010929818.1|261684_262749_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929817.1|262900_265528_-	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.4	6.1e-23
WP_010929816.1|265591_268213_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_003815964.1|269140_269599_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_010929815.1|269877_272121_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_010929814.1|272317_274342_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_010929813.1|274465_275428_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929812.1|275639_276779_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929811.1|276801_277767_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_004565905.1|277962_279153_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
WP_003815955.1|279166_279412_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_010929810.1|279440_281462_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003815953.1|281508_283116_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
WP_010929808.1|283216_284386_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|287267_288218_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929807.1|288241_289300_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003818201.1|289374_289749_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|290303_291254_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	307108	347523	4105450	integrase,transposase	Acinetobacter_phage(10.0%)	38	295736:295760	342808:342832
295736:295760	attL	CGCTGCCCCGGTACGGCACGTGCAG	NA	NA	NA	NA
WP_005012067.1|307108_308059_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929840.1|308516_309440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814626.1|309448_309847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929841.1|310088_312059_+	DUF3220 domain-containing protein	NA	NA	NA	NA	NA
WP_010929843.1|313545_314535_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
WP_010926403.1|314531_314732_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929845.1|314844_315186_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
WP_019247983.1|315196_316381_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
WP_010929847.1|316417_316945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929848.1|317002_317650_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
WP_010929849.1|317646_318633_-	DNA recombinase	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
WP_010926410.1|318636_318819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926411.1|318815_319193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929850.1|319426_319894_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
WP_010929851.1|319929_320880_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010926414.1|320978_321221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929852.1|321387_322029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|322039_322990_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248860.1|323099_323495_-	RidA family protein	NA	NA	NA	NA	NA
WP_010929854.1|323664_324366_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010929855.1|324629_325490_+	hypothetical protein	NA	A0A2C9D0H9	Yersinia_phage	53.6	1.7e-51
WP_003807743.1|325564_325900_-	YegP family protein	NA	NA	NA	NA	NA
WP_010929856.1|326040_327186_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929857.1|327213_327873_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_010929858.1|328877_329084_+	DUF3596 domain-containing protein	NA	NA	NA	NA	NA
WP_003807750.1|329349_329481_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_094145972.1|329927_336830_+	autotransporter BatB	NA	NA	NA	NA	NA
WP_023853476.1|336881_337463_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_010929862.1|337735_338713_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929863.1|338747_340301_+	acyl--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	22.6	1.5e-13
WP_010929864.1|340308_341049_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929865.1|341072_341837_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003807759.1|341881_342217_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_023853484.1|342270_343200_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
342808:342832	attR	CTGCACGTGCCGTACCGGGGCAGCG	NA	NA	NA	NA
WP_005012067.1|343159_344110_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929866.1|344228_345173_-	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	33.3	9.5e-27
WP_003816336.1|345169_346411_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	4.0e-25
WP_005013747.1|346572_347523_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	490422	608317	4105450	transposase,tRNA	Acinetobacter_phage(22.22%)	101	NA	NA
WP_005012067.1|490422_491373_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929956.1|491471_492422_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929957.1|493144_494419_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003807618.1|494505_495588_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	3.3e-07
WP_010929958.1|495598_496411_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010929959.1|496447_496774_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_003807624.1|496778_497339_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_003819054.1|497579_498572_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929960.1|498590_499586_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023853194.1|499601_500978_+	FAD binding domain in molybdopterin dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	37.3	2.4e-18
WP_010929962.1|500970_503352_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_019247263.1|503368_503758_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_020699695.1|503884_504115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|504219_505170_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929963.1|505268_506219_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	47.2	6.9e-17
WP_003815183.1|506215_507088_-	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	34.5	2.4e-08
WP_010929964.1|508018_509305_+	cytochrome c	NA	NA	NA	NA	NA
WP_010929965.1|509358_510285_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_010929966.1|510303_510759_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_003815177.1|511610_512402_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.5e-20
WP_003815175.1|512433_513054_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010929967.1|513050_513680_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003815172.1|513692_514301_-	HAD-IIIA family hydrolase	NA	E3T535	Cafeteria_roenbergensis_virus	26.1	5.2e-10
WP_003815171.1|514297_515287_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.7	4.3e-38
WP_010929968.1|515392_516607_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_010929969.1|518558_519509_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929970.1|520942_522229_+	membrane protein	NA	NA	NA	NA	NA
WP_010929971.1|522394_522703_+	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_033446243.1|522724_523369_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	8.5e-11
WP_003807038.1|523409_525200_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
WP_010929972.1|525312_526173_+	endonuclease	NA	NA	NA	NA	NA
WP_010929973.1|526169_527375_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010929974.1|527371_528256_-	DMT family transporter	NA	NA	NA	NA	NA
WP_033446233.1|529772_530207_-	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
WP_014905478.1|530169_531168_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931408.1|531279_532425_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931407.1|532499_533828_+	amidase	NA	NA	NA	NA	NA
WP_003815296.1|533861_534452_-	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_010931406.1|534741_535536_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019249391.1|536705_537440_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931404.1|537446_538313_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_010931403.1|538320_540096_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_029443756.1|540138_540636_-	cupredoxin family protein	NA	NA	NA	NA	NA
WP_005013747.1|540932_541883_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486105.1|541981_542932_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931400.1|543272_544223_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931399.1|546546_547695_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931398.1|547739_548363_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931397.1|548515_549508_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003815313.1|549504_550242_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003815315.1|550321_551143_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931396.1|551231_552095_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003815317.1|552221_552458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931395.1|554432_555467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003817805.1|555525_556503_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931394.1|556510_557431_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023852622.1|557427_559128_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
WP_010931393.1|559130_560036_+	hydrolase	NA	NA	NA	NA	NA
WP_010931392.1|560079_561213_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_005012808.1|561341_562292_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931391.1|562390_564460_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.3	2.6e-101
WP_019247688.1|564502_566605_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_010931389.1|566911_567988_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_010931388.1|568063_568948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003815341.1|569130_569553_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_010931387.1|569562_570963_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003817813.1|571005_571911_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_010931386.1|572009_573551_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003815348.1|573585_574125_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_010931385.1|574137_574608_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003815363.1|574745_574988_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_003815364.1|575104_575986_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003815365.1|576058_576379_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023852617.1|577230_578181_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003815367.1|579504_580281_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931383.1|580315_582088_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931382.1|582089_582992_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
WP_003817821.1|583116_583476_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010931381.1|583507_584470_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
WP_005012067.1|584568_585519_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931380.1|585531_586467_-	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
WP_010931379.1|586526_587366_-	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_010931378.1|587362_588532_-	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_003815379.1|588528_589818_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_003815381.1|589860_590235_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_023852620.1|590349_591078_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_010931377.1|591085_591790_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_010931376.1|592053_593574_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.1	9.0e-43
WP_003815390.1|593629_594193_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
WP_003817833.1|594211_595243_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
WP_010931375.1|595239_596028_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
WP_023997720.1|596203_597193_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|598949_599900_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931374.1|601122_602025_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814312.1|602026_602881_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010931373.1|602927_604037_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931372.1|604047_604566_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003814302.1|604595_605228_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_003814300.1|605299_605959_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_023852703.1|605955_607095_-	MFS transporter	NA	NA	NA	NA	NA
WP_019247745.1|607444_608317_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	612731	676564	4105450	transposase,tRNA	Pandoravirus(12.5%)	47	NA	NA
WP_010931363.1|612731_613748_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814287.1|614019_614646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931367.1|614701_615829_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
WP_003814283.1|615834_621552_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
WP_003814277.1|622119_623064_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
WP_003814275.1|623252_624188_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010931365.1|624305_625877_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247692.1|625956_627165_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_019247693.1|627662_628580_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003814254.1|630940_631162_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_010929632.1|631492_632509_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814252.1|632593_632845_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_003814250.1|632848_633664_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_010931362.1|633776_634655_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003820957.1|634766_636530_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
WP_010931361.1|636645_637986_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010927010.1|639055_640480_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003814239.1|640479_641181_-	response regulator	NA	W8CYM9	Bacillus_phage	36.6	5.6e-32
WP_010930179.1|642685_643636_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994844.1|643731_644703_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931357.1|644707_645388_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_003814742.1|645525_645918_+	OsmC family protein	NA	NA	NA	NA	NA
WP_010931561.1|646025_647042_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814739.1|647281_648067_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010931356.1|648161_649571_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_010927090.1|649581_650382_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010931355.1|650402_651173_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010931354.1|651215_651683_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
WP_005013747.1|651679_652630_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818344.1|654578_655457_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_019247959.1|656383_659362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931070.1|659715_660666_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931353.1|660662_661751_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_010931352.1|661786_662650_-	3-alpha,7-alpha, 12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931351.1|663789_664179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014486103.1|664182_664965_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_047122778.1|664998_665784_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931349.1|666059_667199_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931348.1|667195_667987_+	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
WP_010931347.1|667983_668733_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
WP_010931346.1|668729_669602_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004566224.1|669601_670603_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003808195.1|670599_671763_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003808193.1|671788_672472_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247312.1|672425_673760_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_010931344.1|673752_674847_+	CoA transferase	NA	NA	NA	NA	NA
WP_005012067.1|675613_676564_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	695475	772784	4105450	integrase,transposase,tRNA,protease	Bacillus_phage(20.0%)	59	742612:742630	762500:762518
WP_023995489.1|695475_696426_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931335.1|696524_698000_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931334.1|699587_700475_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931333.1|700477_701419_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931332.1|701464_703030_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931331.1|704807_706133_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931330.1|706315_707773_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.1	7.6e-15
WP_003816386.1|707736_708234_-	dihydrofolate reductase	NA	A0A140HLG8	Bacillus_phage	38.9	3.0e-24
WP_010931328.1|708264_709236_-	thymidylate synthase	NA	J7KKN7	Erwinia_phage	33.3	4.8e-50
WP_023994724.1|709288_709720_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010931327.1|709849_710518_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003808448.1|711246_712350_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_010931326.1|712455_713730_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	NA	NA	NA	NA
WP_010930472.1|713741_714767_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L4U8	Tupanvirus	44.2	4.7e-72
WP_010931325.1|714768_716139_+	membrane protein	NA	NA	NA	NA	NA
WP_010931324.1|716139_717276_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931323.1|717322_719248_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	29.0	1.0e-27
WP_010931322.1|719244_720366_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931321.1|720362_721517_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010931320.1|721513_722644_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003808462.1|722651_724217_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_010931319.1|724223_725606_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	6.2e-51
WP_003808465.1|725884_726496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931317.1|726587_728003_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818936.1|728020_728731_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010931316.1|728727_730050_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_010931315.1|730129_732091_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_003818932.1|732216_733530_-	fumarylacetoacetase	NA	NA	NA	NA	NA
WP_003818930.1|733638_734937_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_010931314.1|735119_736028_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003808487.1|736037_736247_-	DUF2783 domain-containing protein	NA	NA	NA	NA	NA
WP_003808489.1|736258_737938_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931313.1|738039_738993_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010925978.1|739083_739911_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_010931312.1|739909_741796_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003818921.1|741792_742392_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_010931311.1|742440_743340_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
742612:742630	attL	CTGCCTGGCGTGGCCGAGT	NA	NA	NA	NA
WP_010931310.1|743548_744499_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.5	7.3e-43
WP_029443719.1|744621_745236_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_010931308.1|745364_745961_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010931307.1|745957_746740_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010931306.1|746812_747904_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_010931305.1|748183_749311_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	33.6	1.4e-48
WP_010931304.1|749652_750699_+	Fic family protein	NA	NA	NA	NA	NA
WP_019247951.1|751209_753966_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_023994585.1|753967_756919_+	DNA methylase	NA	G8I4P9	Mycobacterium_phage	25.1	2.9e-21
WP_010931301.1|756934_758146_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_076879586.1|758142_758343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931070.1|758329_759280_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_077274087.1|759296_759791_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_019247740.1|759794_760052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248455.1|760595_761507_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_029443992.1|761588_761873_+	ATP-dependent helicase	NA	A0A1V0SIN4	Klosneuvirus	34.1	6.8e-05
WP_005012067.1|762656_763607_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
762500:762518	attR	ACTCGGCCACGCCAGGCAG	NA	NA	NA	NA
WP_019247178.1|764025_766590_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_019247179.1|766634_768488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014905963.1|768820_770392_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162291319.1|771660_771816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|771833_772784_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	1028123	1121111	4105450	transposase	Bacillus_virus(30.0%)	86	NA	NA
WP_005012067.1|1028123_1029074_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486100.1|1029176_1029839_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019249309.1|1029933_1030104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247599.1|1030456_1031458_+	amidase	NA	NA	NA	NA	NA
WP_003818702.1|1031460_1032657_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486098.1|1032677_1033481_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_019247598.1|1033561_1033858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247597.1|1033888_1034452_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014486097.1|1034492_1035350_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003818698.1|1035357_1036107_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	6.2e-29
WP_014486096.1|1036128_1037001_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014486095.1|1037029_1037809_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486094.1|1037842_1038640_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003808978.1|1041294_1041687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014486091.1|1041680_1042541_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003818691.1|1042544_1043507_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014486089.1|1044283_1044973_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.8e-12
WP_010930208.1|1045833_1046784_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931181.1|1047133_1048003_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010926062.1|1048073_1048769_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010931179.1|1048758_1049268_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010931178.1|1049264_1050485_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931177.1|1050432_1051335_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_023997744.1|1052221_1053508_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931176.1|1053546_1054920_+	amidase	NA	NA	NA	NA	NA
WP_010931175.1|1054958_1055660_-	riboflavin synthase	NA	NA	NA	NA	NA
WP_010931174.1|1055958_1056948_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003809010.1|1057048_1057510_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931173.1|1057525_1058074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931172.1|1058215_1059691_-	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	3.0e-35
WP_010931171.1|1059796_1060888_+	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_010931170.1|1060891_1061674_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931169.1|1061683_1062472_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.0	1.1e-33
WP_010931168.1|1063597_1064032_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_010931167.1|1064028_1065039_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003809025.1|1065082_1066009_-	VOC family protein	NA	NA	NA	NA	NA
WP_003809026.1|1066295_1066664_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_154698394.1|1066716_1066863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023853143.1|1066880_1067831_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931165.1|1067875_1070302_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	1.2e-86
WP_010931164.1|1070350_1071043_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	4.7e-07
WP_010931163.1|1071115_1072315_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_003819549.1|1072332_1073238_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931162.1|1073353_1074283_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010931161.1|1074308_1075655_+	MFS transporter	NA	NA	NA	NA	NA
WP_019247888.1|1075667_1076432_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.5	3.1e-12
WP_010931159.1|1076445_1077228_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|1077420_1078371_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931158.1|1078432_1079542_-	porin	NA	NA	NA	NA	NA
WP_003815281.1|1080054_1080891_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
WP_010931157.1|1081017_1081926_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|1081922_1082873_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023998107.1|1082890_1083061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247492.1|1083258_1083801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1084836_1085787_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247402.1|1086028_1086397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248356.1|1086442_1087567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003820818.1|1088701_1089442_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931155.1|1089545_1090166_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023852714.1|1090269_1091220_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931154.1|1091216_1093325_-	AsmA family protein	NA	NA	NA	NA	NA
WP_003820814.1|1093469_1094129_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003820813.1|1094160_1094625_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_019248355.1|1094900_1095086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931153.1|1095137_1095890_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931152.1|1095896_1097159_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_023852748.1|1097200_1098439_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820806.1|1099516_1100644_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
WP_003814524.1|1100654_1101482_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010931150.1|1101468_1102335_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_010931149.1|1103701_1104106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446288.1|1104468_1105380_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003820799.1|1105394_1106105_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931147.1|1106101_1107346_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_003820797.1|1107347_1107782_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_003814535.1|1107810_1108116_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005012067.1|1108214_1109165_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994659.1|1109221_1110370_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010930176.1|1110450_1111401_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931144.1|1111932_1112730_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247918.1|1112777_1113431_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003814544.1|1113387_1114476_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
WP_003814547.1|1114640_1116866_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_023852715.1|1119143_1120040_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_162268686.1|1119993_1120143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1120160_1121111_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	1151497	1222468	4105450	transposase,protease	uncultured_Mediterranean_phage(25.0%)	53	NA	NA
WP_005012808.1|1151497_1152448_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931130.1|1152504_1153617_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|1156000_1156951_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931129.1|1157541_1158318_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_003812908.1|1158435_1158699_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_010931128.1|1158799_1159804_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_010931127.1|1160004_1161606_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_010931126.1|1161631_1162390_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931125.1|1162481_1163138_-	adenylate kinase	NA	NA	NA	NA	NA
WP_010931124.1|1163228_1163993_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003812895.1|1164002_1164191_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_010931123.1|1164246_1165290_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_010931122.1|1165286_1165700_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_003812889.1|1165696_1166317_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012067.1|1166597_1167548_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931120.1|1167715_1169107_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
WP_010931119.1|1169179_1169758_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_019247560.1|1169874_1171272_+	chloride channel protein	NA	NA	NA	NA	NA
WP_010931117.1|1171387_1172593_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_003820399.1|1172692_1173211_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.1e-14
WP_003812875.1|1173305_1173551_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
WP_003820400.1|1173778_1174093_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
WP_023853340.1|1174191_1179372_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_010931115.1|1179368_1181537_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_010931114.1|1181592_1183908_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
WP_003820402.1|1183912_1185232_+	PqiA/YebS family transporter subunit	NA	NA	NA	NA	NA
WP_014905522.1|1185250_1186924_+	MCE family protein	NA	NA	NA	NA	NA
WP_010931111.1|1186928_1187597_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_010931110.1|1187753_1191575_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_154698391.1|1191729_1191888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930800.1|1191905_1192856_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812857.1|1192877_1194023_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003820410.1|1194171_1195101_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812851.1|1195097_1196186_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_010931109.1|1196182_1196986_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
WP_003812846.1|1196982_1197714_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
WP_010931108.1|1197771_1199061_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931107.1|1199157_1199760_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003812839.1|1204313_1204652_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931105.1|1205359_1205626_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012067.1|1207332_1208283_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931103.1|1208279_1209611_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931102.1|1210871_1212872_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003819722.1|1212864_1213506_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_003809276.1|1213502_1213910_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_010931101.1|1213906_1214707_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_010931100.1|1214781_1215486_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931099.1|1215517_1216312_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_005013747.1|1216308_1217259_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995489.1|1217357_1218308_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812014.1|1218406_1218841_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_010931098.1|1218923_1221260_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
WP_010930525.1|1221451_1222468_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	1269862	1350737	4105450	transposase,tRNA	Bacillus_virus(25.0%)	60	NA	NA
WP_010927663.1|1269862_1270813_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931070.1|1270809_1271760_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931069.1|1272020_1273049_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010931068.1|1273128_1274427_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_003816847.1|1274423_1275005_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010931067.1|1275317_1279364_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	67.4	6.3e-160
WP_010931066.1|1279604_1287266_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.9	7.3e-24
WP_005012067.1|1287262_1288213_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931065.1|1289352_1289826_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931064.1|1289965_1290586_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931063.1|1290721_1291522_+	aldolase	NA	NA	NA	NA	NA
WP_003810897.1|1291576_1292668_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931062.1|1292689_1293133_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_010931061.1|1293161_1293794_-	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_003810909.1|1293904_1294321_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010931060.1|1294313_1295006_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_010931059.1|1295112_1295487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931058.1|1295563_1296373_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931057.1|1296468_1297413_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_003816577.1|1297451_1298423_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003810921.1|1298513_1298951_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_029443733.1|1299009_1299891_-	NRDE family protein	NA	NA	NA	NA	NA
WP_010931054.1|1300894_1301755_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010931053.1|1301787_1303170_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	28.4	7.9e-30
WP_010931052.1|1303166_1304186_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247407.1|1304558_1305053_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931051.1|1305060_1305801_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931050.1|1305881_1307486_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_010931049.1|1307525_1308314_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.4	2.0e-22
WP_023995127.1|1308439_1310605_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	1.9e-14
WP_010931047.1|1311485_1312298_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004568502.1|1312310_1312619_+	DUF2160 domain-containing protein	NA	NA	NA	NA	NA
WP_010931046.1|1312736_1314467_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931045.1|1314468_1315671_-	lipoprotein	NA	NA	NA	NA	NA
WP_010931044.1|1315743_1316412_-	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_003810957.1|1316533_1317001_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019247521.1|1317136_1318519_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_014486086.1|1318515_1319640_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_010931042.1|1319636_1322273_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010931070.1|1322688_1323639_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931041.1|1327385_1327997_-	DUF2239 family protein	NA	NA	NA	NA	NA
WP_003812368.1|1328219_1329680_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.6e-97
WP_010931040.1|1329776_1331369_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	1.0e-17
WP_019247974.1|1331722_1331980_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003816876.1|1331981_1333322_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010931038.1|1333417_1334107_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247976.1|1334119_1335550_+	MFS transporter	NA	NA	NA	NA	NA
WP_014905903.1|1337274_1338096_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931036.1|1338106_1339678_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010931035.1|1339706_1340684_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931034.1|1340710_1341514_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	2.7e-30
WP_010931033.1|1341510_1342305_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003816890.1|1342312_1343548_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_019247978.1|1343561_1343975_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_019247980.1|1344285_1344603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1344724_1345675_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931031.1|1346296_1348024_-	sulfate permease	NA	NA	NA	NA	NA
WP_010931030.1|1348135_1349494_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023853289.1|1349550_1349769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1349786_1350737_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	1470128	1522281	4105450	transposase,tRNA	Salmonella_phage(25.0%)	45	NA	NA
WP_005013747.1|1470128_1471079_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023999730.1|1471096_1471249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814065.1|1471245_1471599_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814063.1|1471611_1471974_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814061.1|1472015_1472441_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_003814059.1|1472643_1473900_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
WP_003814057.1|1474098_1475079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015028.1|1475228_1476470_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_005013747.1|1476568_1477519_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814052.1|1477527_1478223_-	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_003814050.1|1481044_1481644_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_010930950.1|1481654_1483820_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
WP_010930949.1|1483843_1485628_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_017685545.1|1485627_1485717_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_003814042.1|1486411_1486684_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_003814040.1|1486683_1488750_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_010929577.1|1488746_1489697_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1489795_1490746_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015014.1|1490861_1491194_-	multidrug transporter	NA	NA	NA	NA	NA
WP_010929073.1|1491190_1491877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930948.1|1491863_1492823_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	3.1e-57
WP_010930947.1|1492855_1495225_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	7.6e-81
WP_010930946.1|1495224_1495857_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_010930945.1|1495958_1497299_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.9	1.6e-75
WP_010930944.1|1497345_1498701_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	1.6e-83
WP_005014990.1|1498991_1499228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814024.1|1499415_1499733_-	virulence factor	NA	NA	NA	NA	NA
WP_003814023.1|1500005_1500521_-	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	5.1e-06
WP_003814021.1|1500791_1501547_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_019247690.1|1501885_1502092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814020.1|1502099_1502759_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_010930941.1|1503053_1505258_-	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_010930940.1|1505368_1506592_-	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_003814017.1|1506714_1507689_-	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013753.1|1507756_1508950_-	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_003814016.1|1508964_1509765_-	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_010930939.1|1509761_1511618_-	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_003814014.1|1511614_1512220_-	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_003814013.1|1512238_1513624_-	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814012.1|1514349_1515576_+	transporter	NA	NA	NA	NA	NA
WP_003814011.1|1515664_1516447_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|1516545_1517496_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814010.1|1517522_1518296_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814009.1|1518307_1519549_+	MFS transporter	NA	NA	NA	NA	NA
WP_076879548.1|1521330_1522281_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	1566206	1634291	4105450	tRNA,transposase	Streptococcus_virus(11.11%)	57	NA	NA
WP_010930416.1|1566206_1566695_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_019248504.1|1566812_1567391_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010930418.1|1567496_1567865_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|1567963_1568914_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994932.1|1568920_1570033_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_010930419.1|1570719_1571922_+	MFS transporter	NA	NA	NA	NA	NA
WP_010930420.1|1572125_1574786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930421.1|1574798_1578203_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_023995689.1|1578870_1581096_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.2e-43
WP_010930423.1|1581142_1581469_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_010930424.1|1581519_1582128_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_010931070.1|1582226_1583177_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930425.1|1583246_1584011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446226.1|1584007_1584544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930427.1|1584710_1585562_-	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
WP_010928449.1|1585621_1586248_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_005012067.1|1586244_1587195_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019249265.1|1587293_1588406_-	DUF1513 domain-containing protein	NA	NA	NA	NA	NA
WP_019248041.1|1588395_1589397_-	imelysin family protein	NA	NA	NA	NA	NA
WP_019247498.1|1589502_1591014_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_023853587.1|1591010_1592315_-	imelysin	NA	NA	NA	NA	NA
WP_010930431.1|1592426_1592987_-	membrane protein	NA	NA	NA	NA	NA
WP_010930432.1|1593254_1593809_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
WP_010930433.1|1594264_1594480_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_033446228.1|1594734_1597332_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	1.5e-21
WP_010930435.1|1597328_1598516_+	cupin	NA	NA	NA	NA	NA
WP_010930436.1|1599173_1599788_+	serotype 3 fimbrial subunit	NA	NA	NA	NA	NA
WP_023994740.1|1599876_1600998_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_033446216.1|1601015_1601921_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_005012067.1|1602813_1603764_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930439.1|1603945_1604698_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003811112.1|1604766_1605426_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003811113.1|1605422_1606151_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	39.3	3.3e-35
WP_010930440.1|1606163_1608443_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.1	5.9e-06
WP_010930441.1|1608467_1608671_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_010930442.1|1608712_1609345_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.9	2.4e-13
WP_010930443.1|1609480_1610398_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010930444.1|1610394_1611108_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_003811135.1|1611345_1612116_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003811137.1|1612120_1612720_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	41.6	1.4e-20
WP_003811138.1|1612964_1614455_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_010926696.1|1614513_1614798_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003811148.1|1615363_1616290_-	YicC family protein	NA	NA	NA	NA	NA
WP_003811149.1|1616426_1617167_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_010930446.1|1617333_1618710_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003811152.1|1618891_1619797_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930448.1|1621448_1623251_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003811159.1|1623368_1624019_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_005012808.1|1624117_1625068_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930450.1|1625089_1626310_+	oxygen-independent coproporphyrinogen III oxidase-like protein	NA	NA	NA	NA	NA
WP_003811164.1|1626495_1627908_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003811167.1|1627971_1629039_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	1.1e-05
WP_010930451.1|1629038_1630526_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_010930452.1|1630535_1631480_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811176.1|1631639_1632338_+	pirin family protein	NA	NA	NA	NA	NA
WP_010930453.1|1632415_1633321_+	pirin family protein	NA	NA	NA	NA	NA
WP_005012067.1|1633340_1634291_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	1670240	1725831	4105450	transposase	Brazilian_cedratvirus(25.0%)	47	NA	NA
WP_005013747.1|1670240_1671191_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930486.1|1671249_1672023_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486074.1|1672015_1673572_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_005013747.1|1673568_1674519_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810741.1|1675845_1676448_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003810743.1|1676687_1677389_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003816696.1|1677382_1678165_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
WP_005012808.1|1678349_1679300_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930483.1|1679398_1680136_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
WP_010926609.1|1680325_1681084_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930482.1|1681130_1682120_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930481.1|1682297_1683266_-	transporter	NA	NA	NA	NA	NA
WP_010930480.1|1684805_1685774_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010930479.1|1685782_1686724_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010930478.1|1687197_1688208_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930477.1|1688198_1689713_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930476.1|1689709_1691056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930475.1|1691058_1692093_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_023852967.1|1692142_1693768_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
WP_005012067.1|1694320_1695271_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930487.1|1695375_1696323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247865.1|1696376_1698191_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010930489.1|1698183_1698858_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023995112.1|1698987_1702062_+	autotransporter SphB2	NA	NA	NA	NA	NA
WP_019247905.1|1702075_1702375_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930492.1|1702689_1703313_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010930493.1|1703556_1704426_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930494.1|1704403_1705348_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247909.1|1705433_1706360_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247910.1|1706472_1707252_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930497.1|1707242_1708439_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010930498.1|1708469_1709420_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930499.1|1709641_1710331_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930500.1|1710395_1711151_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930501.1|1711202_1712195_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930502.1|1712204_1713158_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811538.1|1713273_1714236_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019249376.1|1715637_1716066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1716062_1717013_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930503.1|1717306_1718029_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
WP_010930504.1|1718467_1719655_-	MFS transporter	NA	NA	NA	NA	NA
WP_010930505.1|1719658_1720009_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930506.1|1721758_1722730_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930507.1|1722743_1723457_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930508.1|1723461_1724379_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811452.1|1724485_1724782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929588.1|1724880_1725831_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	1958596	2028249	4105450	tRNA,transposase	Staphylococcus_phage(16.67%)	54	NA	NA
WP_003818515.1|1958596_1961254_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.0	3.3e-173
WP_010930709.1|1961331_1962534_-	MFS transporter	NA	NA	NA	NA	NA
WP_003810260.1|1962530_1963043_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247822.1|1963165_1963603_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931070.1|1963879_1964830_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_077069014.1|1964928_1965879_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_023853105.1|1966042_1967938_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.5	2.3e-19
WP_010930711.1|1968051_1968219_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003810297.1|1968282_1968519_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_033446265.1|1968887_1970039_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_010929591.1|1971602_1972553_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818523.1|1973004_1974006_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003810306.1|1974178_1975036_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_003810308.1|1975032_1976295_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	6.8e-28
WP_003818524.1|1976395_1976770_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_010930713.1|1976842_1978030_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_010930714.1|1978114_1978885_+	spermidine synthase	NA	NA	NA	NA	NA
WP_010930715.1|1978998_1979763_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930716.1|1979713_1981015_+	malonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_010930717.1|1981011_1981818_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003818532.1|1983562_1984534_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003818533.1|1984690_1985203_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	52.3	1.8e-43
WP_010930718.1|1985361_1986336_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930719.1|1987336_1988131_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.7	5.1e-05
WP_003818535.1|1988156_1988963_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_003810329.1|1989073_1989664_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_010930720.1|1989674_1990853_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_010930721.1|1990955_1991330_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019248531.1|1991582_1992914_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_019247651.1|1992980_1996211_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003810344.1|1997701_1998448_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_010930724.1|1998532_1998994_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_010930725.1|1999031_2000090_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_010930726.1|2000052_2001882_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003810356.1|2001921_2002494_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_010930727.1|2003918_2004740_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	4.1e-42
WP_010930728.1|2005058_2006381_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_010930729.1|2006740_2007376_+	membrane protein	NA	NA	NA	NA	NA
WP_010930730.1|2007335_2008286_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930731.1|2009156_2010029_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930732.1|2010106_2011246_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930733.1|2011604_2012861_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_003816691.1|2012866_2013394_+	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_003816690.1|2013398_2014217_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003816687.1|2014216_2014939_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930735.1|2014960_2015275_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930736.1|2015292_2016441_+	CoA transferase	NA	NA	NA	NA	NA
WP_010930737.1|2016471_2017347_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003816680.1|2017343_2018663_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_010930739.1|2019943_2021431_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_010930740.1|2024025_2024925_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023852887.1|2025062_2026028_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015810.1|2026126_2027077_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|2027298_2028249_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	2039745	2089141	4105450	transposase	Erysipelothrix_phage(16.67%)	45	NA	NA
WP_005013747.1|2039745_2040696_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812172.1|2041833_2042130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247707.1|2042304_2043657_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	2.9e-45
WP_010930153.1|2043799_2044816_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930748.1|2046795_2047809_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_010930749.1|2047895_2048801_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003812179.1|2048957_2049302_+	exported protein	NA	NA	NA	NA	NA
WP_010930750.1|2049459_2049918_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010930751.1|2049931_2052148_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003812183.1|2052144_2053206_+	XdhC family protein	NA	NA	NA	NA	NA
WP_010930752.1|2053234_2054209_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930753.1|2054160_2054979_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.8	2.3e-16
WP_003812191.1|2054991_2055600_-	peptidase S16	NA	NA	NA	NA	NA
WP_010930754.1|2055774_2056170_+	VOC family protein	NA	NA	NA	NA	NA
WP_010930755.1|2056188_2057628_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	37.4	7.4e-55
WP_003812199.1|2057656_2058004_+	GFA family protein	NA	NA	NA	NA	NA
WP_010929577.1|2058022_2058973_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2059625_2060576_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023997035.1|2060659_2062477_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.3e-37
WP_019247659.1|2062550_2063198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930758.1|2063210_2064140_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_014905663.1|2064309_2064774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003816977.1|2065021_2065702_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003816975.1|2065750_2067442_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.3	5.0e-42
WP_010930760.1|2067457_2068009_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003816971.1|2068005_2068377_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930761.1|2068489_2069326_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_029443822.1|2069336_2069861_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_003812228.1|2069958_2070138_+	DUF3008 family protein	NA	NA	NA	NA	NA
WP_010930763.1|2070267_2071242_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003816964.1|2071372_2071729_+	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_010930764.1|2071718_2072594_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_010930765.1|2072692_2073577_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930766.1|2073598_2074894_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_003816959.1|2075842_2076493_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_010930767.1|2076580_2078101_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010930768.1|2078358_2080224_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|2081269_2082220_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268681.1|2082237_2082378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930769.1|2083192_2083552_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_010930770.1|2083539_2084976_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_010930771.1|2084972_2085626_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930772.1|2085622_2086816_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_010930773.1|2086919_2088194_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
WP_005012067.1|2088190_2089141_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	2100345	2141036	4105450	transposase,tRNA,protease	Klosneuvirus(25.0%)	36	NA	NA
WP_005013747.1|2100345_2101296_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|2101394_2102345_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_047122784.1|2102304_2102718_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	59.0	3.8e-36
WP_003816708.1|2103002_2103302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930783.1|2103711_2105994_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.1	3.2e-36
WP_010930784.1|2106679_2108710_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.9	1.0e-65
WP_006218592.1|2108729_2108942_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003810720.1|2109219_2109759_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023852902.1|2109872_2111168_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	33.5	3.0e-63
WP_010930786.1|2111244_2112402_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_010930787.1|2112585_2113485_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_010930788.1|2113503_2114808_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_010930789.1|2114773_2115880_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003810707.1|2115967_2116204_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_010930790.1|2116342_2117413_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
WP_003810703.1|2117416_2118772_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_023852925.1|2118798_2119956_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_010930791.1|2119961_2120600_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_033446258.1|2120601_2121897_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_033446257.1|2121946_2123233_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_003810693.1|2123248_2123755_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004568542.1|2123751_2124900_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003810689.1|2124927_2125353_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
WP_010930794.1|2125675_2128558_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
WP_023852900.1|2128650_2129406_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_010930796.1|2130171_2131521_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_076879566.1|2131619_2132570_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930048.1|2132668_2133619_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930594.1|2133692_2134166_+	RidA family protein	NA	NA	NA	NA	NA
WP_010930593.1|2134191_2135400_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003816734.1|2135396_2136170_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_014905757.1|2136169_2136793_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_010926757.1|2136958_2137219_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_010930591.1|2137522_2138104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004568544.1|2138170_2138425_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_010930590.1|2138411_2141036_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
>prophage 17
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	2168819	2234368	4105450	transposase,tRNA,protease	Lake_Baikal_phage(20.0%)	58	NA	NA
WP_010929577.1|2168819_2169770_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930573.1|2169970_2170780_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_005013747.1|2170904_2171855_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930572.1|2171851_2172745_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_003812452.1|2172869_2173064_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003812453.1|2173063_2173405_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_010930571.1|2173414_2175277_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.4	3.0e-101
WP_003812456.1|2175406_2175919_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_003812458.1|2175921_2176245_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.8	6.8e-25
WP_003812460.1|2176246_2176657_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	7.5e-53
WP_010930570.1|2176694_2177906_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_003812463.1|2177923_2178436_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_010930569.1|2178651_2179143_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_010930568.1|2179395_2181432_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_019247244.1|2181509_2182712_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_010930566.1|2182840_2183491_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	3.3e-10
WP_005012067.1|2185048_2185999_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247934.1|2186569_2186782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247935.1|2186799_2187531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003812478.1|2187565_2188207_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_010930565.1|2188199_2188868_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_010930564.1|2191080_2191857_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930563.1|2191878_2193036_-	thiolase	NA	NA	NA	NA	NA
WP_003812491.1|2193032_2193464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930562.1|2193460_2194258_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010930561.1|2194277_2194679_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010930560.1|2194745_2195717_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930559.1|2195782_2197006_-	CoA transferase	NA	NA	NA	NA	NA
WP_019247936.1|2197233_2198184_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930557.1|2198307_2200761_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	1.5e-220
WP_010930556.1|2200949_2202254_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
WP_003812508.1|2202358_2203012_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
WP_010930555.1|2203014_2204325_-	trigger factor	NA	NA	NA	NA	NA
WP_076879561.1|2204503_2205082_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	1.0e-23
WP_010930553.1|2205193_2205394_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.4	7.4e-14
WP_003812519.1|2205739_2206306_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_010930551.1|2206389_2206593_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	1.6e-16
WP_003812524.1|2206899_2207220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003812526.1|2207261_2207543_-	membrane protein	NA	NA	NA	NA	NA
WP_010930550.1|2207617_2208874_-	autotransporter Phg	NA	NA	NA	NA	NA
WP_010930549.1|2209256_2209586_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_003812536.1|2211156_2211978_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_010930548.1|2211977_2213117_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_019247938.1|2213123_2214020_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_033446179.1|2214034_2215942_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.8	1.1e-66
WP_010926400.1|2216301_2218914_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003812546.1|2218966_2221267_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.9	9.9e-110
WP_003812548.1|2221263_2222472_-	aminotransferase	NA	NA	NA	NA	NA
WP_010930545.1|2222733_2223108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2223104_2224055_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879626.1|2224153_2226148_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.3	4.4e-21
WP_010930543.1|2226207_2227173_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_010930542.1|2227162_2230024_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
WP_010930541.1|2230026_2230533_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010930540.1|2230637_2231846_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
WP_033446178.1|2231847_2232786_-	membrane protein	NA	NA	NA	NA	NA
WP_010930538.1|2232947_2233421_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|2233417_2234368_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	2319496	2383074	4105450	transposase,protease	uncultured_Caudovirales_phage(11.11%)	49	NA	NA
WP_010931070.1|2319496_2320447_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809615.1|2320748_2321225_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_019247142.1|2321848_2323486_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	8.8e-12
WP_003809610.1|2323516_2324830_-	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	67.1	2.1e-149
WP_004568205.1|2324963_2325281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023852827.1|2325381_2326704_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|2326700_2327651_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2327749_2328700_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930836.1|2329229_2330252_-	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003820286.1|2330280_2331111_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_029443740.1|2331127_2332825_-	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010930838.1|2332889_2333966_-	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	1.2e-28
WP_010930839.1|2334125_2334989_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930840.1|2335019_2335589_+	phosphohydrolase	NA	NA	NA	NA	NA
WP_010930841.1|2335605_2336457_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003813142.1|2337514_2338396_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_010930842.1|2338470_2339460_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010930843.1|2339522_2340473_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003813147.1|2340535_2341393_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003813149.1|2341452_2341941_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930844.1|2343513_2344704_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930845.1|2344700_2346287_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_010930846.1|2346305_2347373_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_010930847.1|2347477_2349022_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.4	3.1e-14
WP_010930848.1|2349441_2351016_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023997180.1|2351132_2352140_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003813165.1|2352136_2352976_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930850.1|2352980_2354618_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	3.6e-21
WP_005013747.1|2354614_2355565_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268683.1|2355582_2355726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930851.1|2355707_2356982_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.6e-24
WP_010930852.1|2357011_2357302_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_047122810.1|2357374_2358388_+	histone deacetylase family protein	NA	A0A2K9L4C2	Tupanvirus	35.2	1.7e-42
WP_010930854.1|2358407_2359670_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_010930855.1|2359672_2360596_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010930856.1|2360592_2362086_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010930857.1|2362096_2363029_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_076879554.1|2363210_2364536_+	aspartate aminotransferase family protein	NA	A0A1C9EHH3	Mycobacterium_phage	22.5	1.8e-07
WP_010930859.1|2364570_2365926_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_023853666.1|2365986_2367507_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.9	1.7e-78
WP_010930861.1|2367661_2368393_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023853662.1|2368490_2369801_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_010930863.1|2369816_2370728_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_010930864.1|2370718_2371312_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003813196.1|2371373_2371760_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003813199.1|2371771_2372242_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_010930865.1|2372253_2372877_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_010930866.1|2372897_2375645_-	autotransporter Vag8	NA	NA	NA	NA	NA
WP_005012808.1|2382123_2383074_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	2528015	2586259	4105450	transposase,tRNA	Planktothrix_phage(28.57%)	54	NA	NA
WP_005012067.1|2528015_2528966_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930388.1|2529445_2530102_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_010930387.1|2530116_2531784_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_010930386.1|2531786_2532416_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_014486072.1|2532627_2533722_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930384.1|2533866_2534679_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_010930383.1|2534682_2536266_-	membrane protein	NA	NA	NA	NA	NA
WP_010930382.1|2536436_2537567_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010930381.1|2537753_2538830_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_010930380.1|2538911_2539562_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_010930379.1|2539576_2540980_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004567445.1|2541263_2542082_-	solute-binding protein	NA	NA	NA	NA	NA
WP_010930378.1|2542078_2542783_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.6e-13
WP_010930377.1|2543682_2544798_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004567447.1|2544831_2545206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930376.1|2545228_2546386_-	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_003812666.1|2546398_2546632_-	lipoprotein	NA	NA	NA	NA	NA
WP_019247523.1|2547266_2550236_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_023853518.1|2550250_2550460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248667.1|2550611_2551241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023994978.1|2551237_2553295_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010930372.1|2553351_2554032_-	DUF3306 domain-containing protein	NA	NA	NA	NA	NA
WP_003820494.1|2554028_2554589_-	DUF3305 domain-containing protein	NA	NA	NA	NA	NA
WP_004567450.1|2554595_2555693_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010930371.1|2555845_2556439_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_010930370.1|2556435_2557728_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_003812685.1|2557741_2558284_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_010930369.1|2558293_2559130_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003820487.1|2559163_2560225_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.8	2.9e-80
WP_019247210.1|2560266_2561319_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_019247209.1|2561334_2561637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012808.1|2561778_2562729_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268680.1|2562746_2562911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930368.1|2562907_2564602_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003809599.1|2564598_2565684_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	6.4e-27
WP_010930367.1|2565731_2566631_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003809593.1|2566641_2567286_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010930366.1|2568307_2571550_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_023852833.1|2571560_2572715_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	3.3e-53
WP_010930364.1|2572941_2573904_+	transaldolase	NA	H6WFR1	Cyanophage	29.2	7.5e-11
WP_005013747.1|2574002_2574953_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930363.1|2575051_2576002_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930362.1|2576011_2576701_-	VIT family protein	NA	NA	NA	NA	NA
WP_003811741.1|2576760_2577198_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003811743.1|2577243_2578137_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003811746.1|2578184_2579357_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003811748.1|2579353_2580508_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003811750.1|2580704_2581055_-	RnfH family protein	NA	NA	NA	NA	NA
WP_003811752.1|2581044_2581479_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010930800.1|2581495_2582446_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811754.1|2582593_2583061_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.1	6.2e-27
WP_010930360.1|2583041_2584199_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.2	2.3e-14
WP_003811759.1|2584264_2585191_-	paraslipin	NA	NA	NA	NA	NA
WP_005012067.1|2585308_2586259_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	2628539	2695039	4105450	transposase	uncultured_Caudovirales_phage(40.0%)	56	NA	NA
WP_005012067.1|2628539_2629490_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811850.1|2629859_2630432_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_003811852.1|2630434_2631445_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_010930335.1|2631437_2631938_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_003811855.1|2631948_2632290_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_010930334.1|2632358_2633093_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_003811859.1|2633109_2633379_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_010930333.1|2633401_2634190_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_010929632.1|2634236_2635253_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_014486070.1|2635469_2636912_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
WP_010930332.1|2637090_2638710_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
WP_010930331.1|2638830_2640651_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
WP_010930330.1|2640729_2642262_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_010930329.1|2642295_2643942_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_010930328.1|2644011_2645034_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
WP_010930327.1|2645051_2646185_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_010930326.1|2646187_2646877_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_010930325.1|2646876_2647662_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_003817181.1|2647705_2648470_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_003817180.1|2648508_2649930_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_010930324.1|2649995_2650700_-	flagellar basal body rod modification protein FlgD	NA	NA	NA	NA	NA
WP_003817176.1|2650747_2651167_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_010930323.1|2651179_2651587_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_010930322.1|2651770_2652481_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_003817172.1|2652607_2652898_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_003817170.1|2652915_2653398_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_010930321.1|2657903_2659058_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_010931363.1|2659363_2660380_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930319.1|2660626_2661415_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003812020.1|2661481_2662162_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812022.1|2662158_2662929_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
WP_010930208.1|2663027_2663978_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811401.1|2664033_2664951_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003811400.1|2664961_2666140_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_010930318.1|2666159_2667155_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811396.1|2668743_2669352_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003811393.1|2669339_2670380_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811391.1|2670397_2671360_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811389.1|2671356_2672550_-	CoA transferase	NA	NA	NA	NA	NA
WP_010930317.1|2672546_2673344_-	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_014486069.1|2673369_2674356_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930316.1|2674374_2676414_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
WP_010930315.1|2676615_2677296_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930314.1|2677309_2678221_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_003811381.1|2678217_2678796_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010930313.1|2678934_2679840_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930312.1|2679847_2683267_+	TM0106 family RecB-like putative nuclease	NA	NA	NA	NA	NA
WP_010930311.1|2683254_2685855_-	BP1344/BB2830 family autotransporter	NA	NA	NA	NA	NA
WP_003811375.1|2686810_2687443_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003811372.1|2687836_2688595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003811370.1|2688591_2689794_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010930208.1|2689981_2690932_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930310.1|2691839_2692985_+	DUF3182 family protein	NA	NA	NA	NA	NA
WP_019247449.1|2692971_2693727_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003811361.1|2693843_2694023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930208.1|2694088_2695039_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	2877442	3015921	4105450	holin,transposase,tRNA	uncultured_Mediterranean_phage(17.65%)	107	NA	NA
WP_010929956.1|2877442_2878393_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813574.1|2878491_2879373_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003821443.1|2879450_2880830_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010930218.1|2880868_2881714_-	membrane protein	NA	NA	NA	NA	NA
WP_033451623.1|2881729_2882044_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010930217.1|2882076_2882613_-	membrane protein	NA	NA	NA	NA	NA
WP_003813585.1|2882785_2883361_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_003813586.1|2883463_2884201_-	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_010930216.1|2884268_2885906_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_019247742.1|2886013_2886769_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_010930214.1|2886756_2887719_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_033446255.1|2887826_2888621_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_010930213.1|2888682_2890758_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.0	2.4e-75
WP_010930212.1|2890922_2893298_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_010930211.1|2893378_2894734_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003813618.1|2896212_2896935_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930207.1|2896989_2897973_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|2898102_2899053_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813621.1|2899049_2899952_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930206.1|2900039_2900798_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023853245.1|2900810_2901902_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003813626.1|2901999_2903427_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
WP_010930204.1|2903656_2904871_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_003813631.1|2904916_2907787_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_010930202.1|2910197_2910686_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930201.1|2910811_2913508_+	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_010930200.1|2913662_2915945_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_010930199.1|2916109_2916742_+	fimbrial protein	NA	NA	NA	NA	NA
WP_010930198.1|2916840_2917791_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812405.1|2917837_2918392_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_003816844.1|2918459_2919305_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_019248398.1|2919374_2920343_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023853221.1|2920342_2922139_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930196.1|2924038_2927965_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010930194.1|2928700_2931931_-	autotransporter SphB3	NA	NA	NA	NA	NA
WP_010928340.1|2932212_2933040_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003812422.1|2933073_2933769_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.6	7.0e-35
WP_019247537.1|2933761_2935042_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010930192.1|2935051_2936029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930191.1|2936010_2937711_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.3e-50
WP_010926448.1|2937813_2938917_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_010926447.1|2938947_2939703_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930190.1|2939709_2941230_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
WP_010930189.1|2941272_2941575_+	membrane protein	NA	NA	NA	NA	NA
WP_003812436.1|2941571_2942204_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930188.1|2942282_2944148_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
WP_020699602.1|2944144_2944939_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	1.2e-11
WP_010930186.1|2944967_2946083_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930185.1|2946987_2947866_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930184.1|2947865_2948690_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
WP_010929591.1|2948857_2949808_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930183.1|2950020_2952870_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010930182.1|2952851_2953580_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_019248549.1|2953720_2955184_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.5	1.7e-43
WP_010930180.1|2955180_2955552_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_003812701.1|2955569_2956883_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_003812703.1|2956919_2957378_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155120815.1|2957332_2957473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2957490_2958441_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930178.1|2958437_2959451_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_003812707.1|2959590_2960577_+	homoserine kinase	NA	NA	NA	NA	NA
WP_161633091.1|2960935_2961643_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_010929591.1|2962223_2963174_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809618.1|2963325_2963928_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_010930175.1|2963946_2964579_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_162096758.1|2964623_2964875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930174.1|2964816_2966703_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
WP_010930173.1|2966721_2967564_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
WP_003819875.1|2967560_2968919_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_003809629.1|2969139_2969934_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930172.1|2970164_2971658_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_010930171.1|2971893_2973975_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_014486066.1|2974169_2975210_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	40.2	2.1e-51
WP_010930169.1|2975344_2976361_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003809638.1|2976382_2977240_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_010930167.1|2977284_2978061_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
WP_154698393.1|2978273_2978411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|2978428_2979379_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809441.1|2979405_2979870_-	barstar family protein	NA	NA	NA	NA	NA
WP_014486065.1|2981076_2983365_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_010930165.1|2983481_2984354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930164.1|2984396_2985551_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010930163.1|2985585_2986416_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_023853525.1|2986499_2988044_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_010930161.1|2988086_2988446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003819794.1|2988447_2988861_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003809432.1|2988901_2989219_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003809431.1|2989303_2990020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930160.1|2990283_2991705_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_005015810.1|2994377_2995328_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633096.1|2995307_2995562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931363.1|2995900_2996917_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003809411.1|2997249_2998185_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	3.0e-41
WP_010930154.1|2998234_3000115_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003809416.1|3000181_3000526_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	1.0e-10
WP_010930155.1|3000670_3001807_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
WP_023853534.1|3001803_3002877_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003809423.1|3003034_3004471_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_010930157.1|3004561_3005203_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010931363.1|3005538_3006555_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_015041211.1|3007492_3008920_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010930151.1|3008916_3009939_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
WP_003809396.1|3009928_3010402_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010930149.1|3010542_3011430_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_014486064.1|3011426_3013070_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_003819773.1|3013066_3014074_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010931363.1|3014904_3015921_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	3027197	3098513	4105450	transposase	Xanthomonas_phage(14.29%)	57	NA	NA
WP_005012067.1|3027197_3028148_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809486.1|3028391_3028655_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003819817.1|3028728_3029010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930142.1|3029026_3029887_-	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
WP_003809479.1|3029883_3030219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930141.1|3030272_3030923_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_019247197.1|3032603_3033548_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003809467.1|3033593_3033911_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930139.1|3033913_3034852_-	DnaJ domain-containing protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
WP_003819814.1|3035029_3035515_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930138.1|3035533_3036082_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_023994624.1|3036113_3036266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930137.1|3037595_3038237_+	glutathione transferase	NA	NA	NA	NA	NA
WP_010930136.1|3038391_3040740_+	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_003809454.1|3040736_3041675_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010930135.1|3041700_3042891_+	acetate kinase	NA	NA	NA	NA	NA
WP_010930134.1|3042887_3043661_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010930133.1|3043690_3044884_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010930132.1|3045001_3046012_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010930131.1|3046029_3048066_-	transketolase	NA	NA	NA	NA	NA
WP_010930130.1|3048260_3049001_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_010929969.1|3049099_3050050_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929584.1|3050148_3051099_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003817151.1|3051141_3052317_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_010930129.1|3052538_3054329_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	2.4e-39
WP_010930128.1|3054341_3056003_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_010930127.1|3056015_3058721_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_003817147.1|3059013_3060768_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010930126.1|3060764_3061391_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003811948.1|3061387_3062239_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.1e-33
WP_010930125.1|3062368_3064429_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_010930124.1|3064615_3065230_+	SCO family protein	NA	NA	NA	NA	NA
WP_010930123.1|3065375_3065627_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014486063.1|3065696_3067079_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010930121.1|3067075_3070255_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_029443805.1|3071062_3071980_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930119.1|3072031_3072763_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_010926548.1|3072822_3073395_+	chorismate lyase	NA	NA	NA	NA	NA
WP_010929632.1|3074903_3075920_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930118.1|3076057_3077107_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_005012067.1|3077211_3078162_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813314.1|3078257_3078983_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_003813315.1|3079193_3079574_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_014905652.1|3079879_3080752_+	EamA family transporter	NA	NA	NA	NA	NA
WP_023852686.1|3080759_3081140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023852693.1|3081293_3082568_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_010930113.1|3084055_3084964_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_010930112.1|3085761_3086826_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	3.8e-24
WP_003821528.1|3088662_3089697_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003813333.1|3089886_3090528_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003821527.1|3090610_3092437_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010930111.1|3092680_3093610_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_010930110.1|3093609_3094359_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_003821521.1|3094430_3095345_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.7	9.8e-45
WP_010930108.1|3095364_3096510_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_014486062.1|3096570_3097482_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	38.8	8.0e-47
WP_005012067.1|3097562_3098513_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	3117935	3173065	4105450	transposase	Bacillus_phage(28.57%)	48	NA	NA
WP_005012808.1|3117935_3118886_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566317.1|3119015_3119408_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
WP_003821497.1|3119684_3120596_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.4e-05
WP_010930088.1|3120720_3121695_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|3121691_3122642_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810865.1|3122740_3123826_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_010930072.1|3123923_3124334_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003810859.1|3124949_3126863_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_010930071.1|3126998_3129611_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_019248496.1|3129612_3130347_-	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.2	1.9e-62
WP_003810851.1|3130510_3131692_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003810850.1|3131688_3131901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930069.1|3131897_3132878_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010930068.1|3132923_3133751_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	1.7e-67
WP_023852913.1|3133900_3135715_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.9	5.7e-44
WP_003810840.1|3135769_3136153_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_010930066.1|3136149_3137100_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810839.1|3137212_3137464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810837.1|3137657_3137873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810835.1|3137969_3139088_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003810832.1|3139207_3139420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930064.1|3139579_3139801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3139853_3140804_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930062.1|3141980_3143351_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_010930061.1|3143383_3144175_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930060.1|3144187_3145243_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019247557.1|3145268_3146144_-	amidohydrolase	NA	NA	NA	NA	NA
WP_023852826.1|3146249_3146498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003819989.1|3146532_3147987_-	carboxylase	NA	NA	NA	NA	NA
WP_004568140.1|3147983_3148505_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_010930057.1|3148533_3149886_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_029444137.1|3150109_3152998_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_010930056.1|3155142_3156444_+	phospholipase	NA	NA	NA	NA	NA
WP_010930055.1|3156458_3157175_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_010930054.1|3157456_3158137_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_010930052.1|3158664_3159324_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_010930051.1|3159722_3161555_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.3e-27
WP_005012067.1|3161551_3162502_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814007.1|3163665_3165381_+	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_003814006.1|3165391_3165883_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_010930015.1|3165955_3166972_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814004.1|3167139_3167919_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003814003.1|3167937_3168465_-	lipoprotein	NA	NA	NA	NA	NA
WP_005019401.1|3168463_3168670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814002.1|3168758_3169028_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_003821234.1|3169118_3171278_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003814000.1|3171398_3172118_+	lipoprotein	NA	NA	NA	NA	NA
WP_005013747.1|3172114_3173065_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	3254125	3323128	4105450	transposase	Klosneuvirus(16.67%)	55	NA	NA
WP_041337087.1|3254125_3255076_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813068.1|3255072_3256092_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.7	1.5e-49
WP_010930049.1|3256101_3258810_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.0	2.8e-15
WP_010930050.1|3258957_3259614_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005013747.1|3259712_3260663_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023998705.1|3260810_3261704_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_010930013.1|3261903_3263598_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_010930012.1|3263632_3264559_+	VOC family protein	NA	NA	NA	NA	NA
WP_010930011.1|3264627_3265725_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003818996.1|3265743_3266607_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	9.6e-34
WP_010930010.1|3266618_3267401_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004566042.1|3267397_3268516_+	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_010930009.1|3268512_3270045_+	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_003818991.1|3270085_3271093_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_023999677.1|3271237_3271960_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930007.1|3271975_3272998_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010930006.1|3273314_3274049_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930005.1|3274133_3275879_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_010930004.1|3275875_3276628_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930003.1|3276672_3277629_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003818983.1|3277717_3278284_+	membrane protein	NA	NA	NA	NA	NA
WP_010930002.1|3278291_3279152_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_020699739.1|3279181_3279910_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.4e-32
WP_003807497.1|3279941_3280625_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010930000.1|3281462_3282377_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929999.1|3282441_3283350_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929998.1|3283440_3284865_-	TolC family protein	NA	NA	NA	NA	NA
WP_010929997.1|3284866_3286189_-	cyclolysin T1SS periplasmic adaptor subunit CyaD	NA	NA	NA	NA	NA
WP_010929996.1|3286185_3288324_-	cyclolysin T1SS permease/ATPase CyaB	NA	W8CYL7	Bacillus_phage	29.2	2.7e-45
WP_010929995.1|3288401_3293522_-	bifunctional adenylate cyclase toxin/hemolysin CyaA	NA	NA	NA	NA	NA
WP_153302771.1|3293622_3293931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929994.1|3294000_3294558_+	cyclolysin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_010929993.1|3294573_3296055_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023853308.1|3296109_3297963_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929992.1|3298225_3299563_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010929991.1|3299597_3301595_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010929990.1|3301612_3303661_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010929989.1|3303791_3304658_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929988.1|3304926_3305892_-	octaprenyl diphosphate synthase	NA	NA	NA	NA	NA
WP_010929987.1|3306006_3307155_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_003807462.1|3307579_3307891_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003807460.1|3307924_3308185_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003807459.1|3308334_3309468_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003807457.1|3309538_3310675_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.8	5.8e-63
WP_010925762.1|3310840_3311635_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003807452.1|3311697_3312141_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|3312256_3313207_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_020699729.1|3313329_3313737_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010929984.1|3313809_3316005_+	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|3316226_3317177_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852739.1|3317136_3317661_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003814467.1|3317792_3318764_+	FecR family protein	NA	NA	NA	NA	NA
WP_010929983.1|3318883_3321328_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_010929982.1|3321343_3321934_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|3322177_3323128_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	3338574	3438687	4105450	tail,transposase,protease,terminase,tRNA	uncultured_Caudovirales_phage(14.29%)	108	NA	NA
WP_005012067.1|3338574_3339525_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814437.1|3340256_3340634_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_003814436.1|3340618_3341320_-	membrane protein	NA	NA	NA	NA	NA
WP_010931409.1|3341463_3342156_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_010931410.1|3342155_3343259_-	phosphotransferase	NA	NA	NA	NA	NA
WP_010931411.1|3343368_3345741_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010931412.1|3345737_3347297_+	chaperone SurA	NA	NA	NA	NA	NA
WP_010931413.1|3347321_3348119_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010931414.1|3348150_3349296_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
WP_003814419.1|3349400_3350843_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_010929184.1|3350845_3352075_-	spore maturation protein	NA	NA	NA	NA	NA
WP_005012808.1|3354212_3355163_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247922.1|3356292_3356850_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247923.1|3356825_3357176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814657.1|3357344_3358139_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
WP_010931416.1|3358135_3359185_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003814652.1|3359184_3359874_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003814650.1|3359960_3360458_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_010931417.1|3360489_3361806_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_010931418.1|3361822_3362797_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003814643.1|3362833_3363292_-	protein TolR	NA	NA	NA	NA	NA
WP_003814641.1|3363291_3363972_-	protein TolQ	NA	NA	NA	NA	NA
WP_010931419.1|3363974_3364403_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814636.1|3364455_3366186_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
WP_003814635.1|3366251_3366824_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_010931420.1|3366804_3367491_+	response regulator	NA	NA	NA	NA	NA
WP_010931421.1|3367846_3368518_+	SOS response-associated peptidase	NA	Q5QF62	Pseudomonas_virus	39.9	4.7e-36
WP_010931422.1|3368846_3369068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926433.1|3369067_3369349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931423.1|3369345_3369861_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_010931424.1|3369860_3370412_-	lysozyme	NA	NA	NA	NA	NA
WP_010931425.1|3370390_3370633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931426.1|3370637_3371450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926428.1|3371449_3371713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124740660.1|3371753_3371951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931428.1|3371931_3372348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931429.1|3372352_3376309_-	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
WP_010931430.1|3376301_3376691_-	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
WP_010931431.1|3376687_3377221_-	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
WP_010931432.1|3377288_3377648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931433.1|3377657_3380270_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
WP_010931434.1|3380295_3380586_-	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
WP_003813412.1|3380603_3380933_-	hypothetical protein	NA	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
WP_010931435.1|3380942_3381461_-	hypothetical protein	NA	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
WP_010931436.1|3381715_3382216_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
WP_010931437.1|3382223_3382646_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_010931438.1|3382642_3383041_-	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
WP_010931439.1|3383037_3383433_-	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_162096760.1|3383432_3383621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247789.1|3383634_3384117_-	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
WP_010931442.1|3384179_3384431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012808.1|3385105_3386056_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931443.1|3386484_3387087_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
WP_010931444.1|3387209_3387452_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
WP_010931445.1|3387457_3388513_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.6e-97
WP_010931446.1|3388541_3389960_-	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
WP_010931447.1|3389962_3391240_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
WP_019247942.1|3391226_3391712_-|transposase	transposase	transposase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
WP_005012067.1|3392351_3393302_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023853183.1|3393319_3393541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161633094.1|3393558_3394248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023853179.1|3394240_3394492_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_010931451.1|3395046_3395658_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_019247378.1|3395729_3395936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3396187_3397138_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248926.1|3397236_3398310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931475.1|3398477_3399272_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010925795.1|3399311_3399836_-	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_010931474.1|3399828_3401571_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010931473.1|3401780_3402539_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
WP_010931472.1|3402541_3403249_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
WP_010931471.1|3403265_3404147_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019247734.1|3404157_3404916_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019248554.1|3404884_3405640_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931468.1|3405709_3407128_+	amidase	NA	NA	NA	NA	NA
WP_003819076.1|3407149_3407800_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_033446132.1|3407933_3408269_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_010930800.1|3408357_3409308_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931467.1|3409384_3411205_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
WP_010931466.1|3411209_3412283_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
WP_003814230.1|3412405_3413374_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010927008.1|3413447_3414359_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_003814226.1|3414377_3414950_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010931465.1|3415030_3415579_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_010931464.1|3415578_3417168_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
WP_003814221.1|3417237_3417477_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_023995141.1|3417517_3418543_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003814217.1|3418608_3419790_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_010931463.1|3419886_3420339_+	membrane protein	NA	NA	NA	NA	NA
WP_010931462.1|3420348_3421689_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931461.1|3422005_3423043_+	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_003814209.1|3423424_3423784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041166340.1|3423867_3424809_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879617.1|3424883_3425834_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814206.1|3426127_3427222_+	porin	NA	NA	NA	NA	NA
WP_033446149.1|3427312_3428185_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003814203.1|3428206_3429046_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
WP_010931459.1|3429121_3430639_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_010931458.1|3430735_3431836_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010931457.1|3431852_3432275_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_003814195.1|3432297_3432510_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_010931456.1|3432556_3433477_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_010931455.1|3433659_3434409_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003814188.1|3434411_3434741_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_033446148.1|3435028_3436381_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	2.1e-51
WP_003814185.1|3436392_3436776_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010931453.1|3436837_3437638_+	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015810.1|3437736_3438687_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	3599355	3654329	4105450	transposase	Lake_Baikal_phage(20.0%)	44	NA	NA
WP_005012067.1|3599355_3600306_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929827.1|3600422_3601490_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_019247670.1|3601565_3604694_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_023853155.1|3605201_3606167_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010929830.1|3606169_3606841_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010929831.1|3606997_3607957_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_003821340.1|3607964_3608627_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005013747.1|3608623_3609574_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929806.1|3609695_3610949_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929805.1|3610926_3611889_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929804.1|3612020_3612515_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010929803.1|3612514_3613747_+	dehydratase	NA	NA	NA	NA	NA
WP_019247316.1|3614492_3614774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929802.1|3614760_3615747_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929801.1|3615890_3616295_+	RidA family protein	NA	NA	NA	NA	NA
WP_010929800.1|3616436_3619823_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010929799.1|3619853_3621317_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_019247315.1|3621325_3622954_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010929797.1|3623039_3623699_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929796.1|3623728_3624169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929795.1|3624679_3624883_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	5.8e-14
WP_010929794.1|3625058_3625964_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929577.1|3626062_3627013_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3627111_3628062_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814674.1|3629843_3631037_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_010929793.1|3631102_3632131_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_019247419.1|3632157_3633330_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003814681.1|3633455_3634433_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814685.1|3634443_3635415_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929791.1|3635481_3636267_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003814691.1|3636259_3637492_-	CoA transferase	NA	NA	NA	NA	NA
WP_003814694.1|3637687_3638443_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.9e-42
WP_010929789.1|3638553_3639072_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
WP_010929788.1|3640860_3642261_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003820700.1|3642360_3642705_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_003814701.1|3642793_3643264_+	universal stress protein	NA	NA	NA	NA	NA
WP_019247421.1|3643674_3644073_+	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
WP_010929577.1|3644204_3645155_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814730.1|3647599_3648334_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
WP_003814728.1|3648743_3648923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814726.1|3649113_3650427_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929786.1|3650442_3651954_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929785.1|3651950_3653156_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_022997984.1|3653351_3654329_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	3744142	3859812	4105450	transposase,tRNA,protease	Bacillus_phage(12.5%)	100	NA	NA
WP_005013747.1|3744142_3745093_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814960.1|3745215_3745944_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_010929739.1|3746040_3747219_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_010929738.1|3747215_3748049_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_010929737.1|3748085_3748826_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929736.1|3748945_3750121_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003820560.1|3750117_3751071_-	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	35.8	2.5e-30
WP_010929735.1|3751084_3751486_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_010927118.1|3751478_3752084_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_003814980.1|3752171_3752336_-	rubredoxin	NA	NA	NA	NA	NA
WP_010929734.1|3752452_3753301_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003814984.1|3753297_3753951_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_010929733.1|3753967_3755251_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_010929732.1|3755490_3757116_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_003814990.1|3757209_3757611_-	RidA family protein	NA	NA	NA	NA	NA
WP_003814993.1|3757635_3758070_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814996.1|3758071_3759721_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.2	2.6e-56
WP_010929731.1|3759761_3760931_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010929730.1|3760933_3761797_-	enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_010929729.1|3765160_3765865_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	1.1e-16
WP_003815010.1|3765858_3766653_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.5	2.6e-09
WP_003815011.1|3766649_3767615_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815013.1|3767618_3768539_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815015.1|3768635_3769799_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929728.1|3770021_3770912_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003815019.1|3770915_3771419_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929727.1|3771461_3772460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930048.1|3772456_3773407_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_111735998.1|3773495_3773783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|3773974_3774925_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566083.1|3774984_3775545_+	5'-3'-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	30.8	3.2e-14
WP_004566082.1|3777047_3777929_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929725.1|3778042_3779245_+	MFS transporter	NA	NA	NA	NA	NA
WP_003819105.1|3779373_3781233_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003819104.1|3781310_3782120_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010929724.1|3782190_3783192_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_003807710.1|3783223_3784084_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010929723.1|3784283_3785288_+	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	31.5	7.5e-30
WP_003819100.1|3785284_3786871_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003807706.1|3786879_3787806_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_003807705.1|3787828_3788455_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_005015810.1|3788553_3789504_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014906092.1|3789500_3790637_-|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	31.2	1.2e-07
WP_010927226.1|3790690_3791467_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_010929721.1|3791491_3791950_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003815815.1|3792089_3792731_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_003815816.1|3792795_3794178_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_010929720.1|3794203_3795052_+	cytochrome c1	NA	NA	NA	NA	NA
WP_003815819.1|3795210_3795822_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003815821.1|3795831_3796281_+|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
WP_010929718.1|3796947_3797109_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_077069015.1|3797184_3797400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3797386_3798337_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929717.1|3799380_3799659_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_010929716.1|3800801_3801350_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
WP_010929715.1|3801412_3803092_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
WP_010929714.1|3803088_3804840_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
WP_003817696.1|3804836_3804962_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_004567834.1|3804975_3806130_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_023852659.1|3806145_3807723_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010929712.1|3807848_3808394_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929591.1|3808953_3809904_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929711.1|3810634_3811615_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929710.1|3811628_3812753_+	CoA transferase	NA	NA	NA	NA	NA
WP_003814321.1|3812760_3814515_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010929709.1|3814621_3815521_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814324.1|3815585_3816569_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010929708.1|3816704_3817685_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929707.1|3817701_3819093_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_010929706.1|3819244_3819781_+|tRNA	bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_019247543.1|3819711_3821097_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
WP_003814332.1|3821239_3821878_-	membrane protein	NA	NA	NA	NA	NA
WP_010929705.1|3821964_3823854_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	3.3e-79
WP_003814337.1|3823850_3824792_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003814339.1|3824897_3825947_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
WP_010929704.1|3826199_3826901_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_010929703.1|3826897_3827596_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010929702.1|3827596_3828952_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
WP_010929701.1|3828948_3829440_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003814351.1|3829458_3830415_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003814355.1|3831825_3833928_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003814356.1|3834098_3835142_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814358.1|3835185_3835929_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814363.1|3836950_3837361_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_010929700.1|3838310_3839108_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930742.1|3839206_3840157_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|3840153_3841104_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3841190_3842141_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929681.1|3842255_3843257_-	HindIII family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_010929682.1|3843347_3843914_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
WP_010929683.1|3844232_3846146_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_010929684.1|3846187_3847618_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_019247308.1|3847730_3849143_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818947.1|3849159_3849855_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|3850073_3851024_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929687.1|3851048_3851948_-	virginiamycin B lyase	NA	NA	NA	NA	NA
WP_010929688.1|3852102_3852651_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
WP_010929689.1|3852689_3853409_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
WP_023994893.1|3853579_3856423_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_033455792.1|3857016_3859812_+|protease	serine protease autotransporter SphB1	protease	NA	NA	NA	NA
>prophage 28
NZ_CP017884	Bordetella pertussis strain J074 chromosome, complete genome	4105450	4004518	4069430	4105450	transposase	Planktothrix_phage(40.0%)	60	NA	NA
WP_039249574.1|4004518_4005004_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_153302797.1|4005092_4005230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931647.1|4005222_4006203_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019248461.1|4006469_4007279_+	pertussis toxin ADP-ribosyltransferase subunit PtxA	NA	NA	NA	NA	NA
WP_014906114.1|4007318_4007999_+	pertussis toxin binding subunit PtxB	NA	NA	NA	NA	NA
WP_010929491.1|4007992_4008451_+	pertussis toxin subunit 4	NA	NA	NA	NA	NA
WP_023853616.1|4008462_4008825_+	pertussis toxin binding subunit PtxD	NA	NA	NA	NA	NA
WP_010931651.1|4008907_4009591_+	pertussis toxin binding subunit PtxE	NA	NA	NA	NA	NA
WP_010929493.1|4009646_4009955_+	type IV secretion system protein PtlA	NA	NA	NA	NA	NA
WP_010929494.1|4009973_4010288_+	type IV secretion system protein PtlB	NA	NA	NA	NA	NA
WP_010931652.1|4010284_4012759_+	type IV secretion system protein PtlC	NA	NA	NA	NA	NA
WP_010931653.1|4012766_4014158_+	type IV secretion system protein PtlD	NA	NA	NA	NA	NA
WP_010929497.1|4014154_4014340_+	type IV secretion system protein PtlI	NA	NA	NA	NA	NA
WP_010929498.1|4014318_4015020_+	type IV secretion system peptidoglycanase PtlE	NA	NA	NA	NA	NA
WP_010931654.1|4015016_4015838_+	type IV secretion system protein PtlF	NA	NA	NA	NA	NA
WP_010931655.1|4015818_4016943_+	type IV secretion system protein PtlG	NA	NA	NA	NA	NA
WP_010929500.1|4016935_4017955_+	type IV secretion system protein PtlH	NA	NA	NA	NA	NA
WP_010931656.1|4018160_4019051_-	DMT family transporter	NA	NA	NA	NA	NA
WP_010929501.1|4019295_4020087_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003815873.1|4020169_4020544_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_010931658.1|4020521_4021931_+	DUF2868 domain-containing protein	NA	NA	NA	NA	NA
WP_003815876.1|4021923_4023306_+	GTPase/DUF3482 domain-containing protein	NA	A0A0R6PHS5	Moraxella_phage	38.9	9.9e-57
WP_003815878.1|4023640_4025245_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931659.1|4025322_4026294_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931660.1|4026304_4027231_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931661.1|4027621_4028572_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931662.1|4028741_4029968_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_010931663.1|4030167_4031034_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003815027.1|4031026_4031989_+	Nudix family hydrolase	NA	A0A221LFJ1	Barns_Ness_breadcrumb_sponge_sobemo-like_virus	53.4	1.9e-06
WP_010927663.1|4032089_4033040_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|4033138_4034089_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|4034187_4035138_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994937.1|4035134_4036628_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003815032.1|4036624_4039732_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010931665.1|4039728_4042797_-	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010931666.1|4042793_4044044_-	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023853184.1|4044224_4044977_-	cell division protein ZapD	NA	NA	NA	NA	NA
WP_010931667.1|4045018_4045663_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_010931668.1|4045671_4046652_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003815047.1|4046751_4047495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815049.1|4047577_4047925_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003815051.1|4048022_4048865_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003815053.1|4048909_4049797_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003815055.1|4049823_4050012_-	DUF3460 family protein	NA	NA	NA	NA	NA
WP_010931669.1|4050109_4051567_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_010931670.1|4051553_4053080_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003815061.1|4053098_4053566_-	membrane protein	NA	NA	NA	NA	NA
WP_010931671.1|4053565_4054588_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003815064.1|4054708_4055449_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	4.4e-35
WP_003815066.1|4055503_4056604_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815068.1|4056605_4057796_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815070.1|4057915_4058932_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	42.1	1.0e-71
WP_003815073.1|4059250_4059922_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.2	9.5e-29
WP_010927126.1|4059918_4060827_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_010931672.1|4061038_4061686_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_033446142.1|4065546_4066614_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003815084.1|4066624_4067434_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815086.1|4067523_4068297_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023853189.1|4068297_4068462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930363.1|4068479_4069430_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
