The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015572	Pasteurella multocida strain USDA-ARS-USMARC-60381 chromosome, complete genome	2344125	338131	363901	2344125	head,transposase,tail,terminase	Mannheimia_phage(61.11%)	24	NA	NA
WP_005720092.1|338131_338548_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_064775610.1|338594_339731_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_064775609.1|339870_340197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081317749.1|340244_346139_-	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	36.1	1.6e-257
WP_042743292.1|346142_346733_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.1	3.1e-52
WP_064775658.1|346675_347416_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	60.0	1.3e-84
WP_064775657.1|347418_348123_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.1	1.6e-82
WP_064775655.1|350956_351652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533102.1|351956_352286_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	49.1	4.8e-26
WP_016533103.1|352655_353072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533104.1|353144_354161_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	69.9	7.6e-131
WP_015691079.1|354173_354566_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
WP_015691078.1|354565_354967_-	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
WP_015691077.1|354968_355343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691076.1|355344_355812_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
WP_015691075.1|355828_356065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691074.1|356121_357279_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	43.3	8.3e-81
WP_015691073.1|357296_358067_-	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.2	1.5e-25
WP_015691071.1|358402_358837_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	61.2	3.1e-41
WP_015691070.1|358811_359030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775738.1|359032_360634_-|head	phage head morphogenesis protein	head	A0A0M3LQ07	Mannheimia_phage	52.1	3.3e-152
WP_064775653.1|360623_362027_-	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	59.6	4.4e-153
WP_064775652.1|362036_363308_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	61.7	8.6e-148
WP_081273988.1|363310_363901_-	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	39.5	4.9e-21
>prophage 2
NZ_CP015572	Pasteurella multocida strain USDA-ARS-USMARC-60381 chromosome, complete genome	2344125	367184	396033	2344125	integrase,transposase,holin	Mannheimia_phage(20.69%)	44	363215:363230	399151:399166
363215:363230	attL	CCCATGTTTTTCCAGA	NA	NA	NA	NA
WP_016533462.1|367184_367769_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.3	6.5e-58
WP_016533461.1|367740_368106_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_016569984.1|368464_368620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533470.1|368694_369060_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_064775605.1|369059_369662_-	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_016533468.1|369749_369962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016569985.1|370035_370494_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_041423202.1|370483_371014_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016533441.1|371023_371713_-	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_016533442.1|371712_372615_-	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_014390722.1|372616_372970_-	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_064775604.1|372966_373668_-	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014391093.1|373725_373953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720263.1|374021_374231_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_064775603.1|374358_375048_+	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_016533478.1|375193_375457_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016533477.1|375459_375939_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533476.1|375935_376319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|376937_377168_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_016533491.1|377759_378305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570070.1|378570_379218_+	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	64.2	3.5e-36
WP_014390710.1|379279_379591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|379657_379942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570068.1|379928_380165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101766859.1|380342_381323_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	40.1	3.4e-51
WP_016533454.1|381326_382178_+	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_064775601.1|382170_382782_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016570065.1|382785_383250_+	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_016533530.1|383261_383453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570064.1|383495_383849_+	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_014391448.1|383920_384709_+	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_064775647.1|384759_385359_+	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.9e-18
WP_016533502.1|385355_385721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080637896.1|385708_385921_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_064775646.1|385932_386421_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	51.2	3.2e-34
WP_015691048.1|386524_387433_+	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	36.1	2.5e-40
WP_064775645.1|387677_387899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391442.1|387909_388632_+	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
WP_075271365.1|388815_389118_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014391441.1|389021_390077_+|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.9	1.6e-62
WP_005725034.1|390451_391306_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
WP_014325726.1|391882_392347_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_005719438.1|392529_393030_-	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
WP_014326374.1|393201_396033_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.3	0.0e+00
399151:399166	attR	TCTGGAAAAACATGGG	NA	NA	NA	NA
>prophage 3
NZ_CP015572	Pasteurella multocida strain USDA-ARS-USMARC-60381 chromosome, complete genome	2344125	747052	756410	2344125		Planktothrix_phage(16.67%)	9	NA	NA
WP_014326208.1|747052_748051_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
WP_005724065.1|748067_749048_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
WP_005724066.1|749124_749910_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_010906540.1|749918_750710_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
WP_005753553.1|750944_752498_+	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_005724296.1|752573_753521_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
WP_014326206.1|753590_754478_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005753554.1|754477_755095_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_014326205.1|755135_756410_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.8e-92
>prophage 4
NZ_CP015572	Pasteurella multocida strain USDA-ARS-USMARC-60381 chromosome, complete genome	2344125	1720181	1823277	2344125	transposase,tail,integrase,terminase,tRNA	Mannheimia_phage(41.67%)	112	1777292:1777337	1823382:1823427
WP_014325726.1|1720181_1720646_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_005717387.1|1720827_1721556_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	38.1	4.9e-31
WP_014325725.1|1721621_1722290_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_014325724.1|1722299_1722842_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.7	4.8e-23
WP_014325723.1|1722904_1724215_-	porin	NA	NA	NA	NA	NA
WP_005723236.1|1724459_1724750_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_005723238.1|1724797_1726459_-	putative transporter	NA	NA	NA	NA	NA
WP_005723242.1|1728548_1729103_+	DUF5358 domain-containing protein	NA	NA	NA	NA	NA
WP_010907004.1|1729320_1730976_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	34.9	7.4e-83
WP_014325722.1|1731065_1732145_-	endonuclease	NA	NA	NA	NA	NA
WP_014325721.1|1732625_1733180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005717426.1|1733487_1734276_+	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014325720.1|1734288_1735233_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005723258.1|1735244_1735982_+	ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	32.5	1.5e-14
WP_016504262.1|1736127_1738557_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014325718.1|1739021_1740047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325717.1|1741064_1742303_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	25.6	1.0e-12
WP_014325716.1|1742316_1742889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325715.1|1743304_1747198_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	53.4	1.7e-114
WP_005723276.1|1747422_1747722_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005723278.1|1747702_1748707_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005717441.1|1748983_1749865_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_014325712.1|1750007_1751441_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005723282.1|1751430_1751682_-	YhdT family protein	NA	NA	NA	NA	NA
WP_005723284.1|1751764_1753111_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005717446.1|1753212_1753674_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005717447.1|1753828_1754275_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005717448.1|1754345_1755359_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_005723289.1|1755611_1756469_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_016504292.1|1756579_1757833_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_095177582.1|1758111_1759017_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_014325708.1|1759047_1759311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325707.1|1759328_1759952_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005751822.1|1760082_1760463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325706.1|1760492_1762562_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_014325705.1|1762697_1764116_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005723307.1|1764444_1766016_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_005717460.1|1766146_1766617_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_005717461.1|1766705_1766996_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	40.0	4.5e-12
WP_014325704.1|1767091_1768726_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.6	1.7e-188
WP_016504294.1|1769578_1770376_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014325702.1|1770377_1770977_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	9.7e-17
WP_014325701.1|1770994_1771843_+	ModD protein	NA	NA	NA	NA	NA
WP_005754621.1|1771942_1773775_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	1.8e-53
WP_005723318.1|1773882_1774779_-	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_005723319.1|1774862_1777007_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
1777292:1777337	attL	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATG	NA	NA	NA	NA
WP_005720092.1|1777758_1778175_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_064775610.1|1778221_1779358_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_064775609.1|1779497_1779824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069359803.1|1779871_1784875_-	DUF1983 domain-containing protein	NA	A0A0M3LQ61	Mannheimia_phage	38.8	6.2e-250
WP_014667799.1|1784878_1785499_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
WP_016569980.1|1785441_1786185_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	59.6	7.4e-83
WP_023430089.1|1786189_1786903_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.9	2.1e-82
WP_014390756.1|1786992_1787322_-	Gifsy-1 prophage VmtM	NA	S5MW28	Escherichia_phage	37.1	3.2e-14
WP_042743193.1|1787324_1789769_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	57.0	1.6e-150
WP_016533322.1|1789827_1790223_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	83.2	7.7e-55
WP_016533321.1|1790290_1790755_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	50.0	5.2e-34
WP_016533320.1|1790785_1791457_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.9	1.5e-42
WP_014390749.1|1791510_1791993_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
WP_016533319.1|1792004_1792376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390747.1|1792372_1792744_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
WP_014390746.1|1792748_1793093_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
WP_042743192.1|1793095_1793464_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	4.7e-22
WP_101766867.1|1793444_1793831_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	73.9	4.2e-13
WP_016533288.1|1793841_1794840_-	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	74.7	9.1e-145
WP_016533289.1|1794851_1795286_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.7	1.1e-54
WP_016533290.1|1795285_1796632_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	55.3	4.0e-127
WP_014390740.1|1796646_1797618_-	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
WP_016533291.1|1797571_1799017_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	58.6	2.4e-146
WP_016533292.1|1799031_1800258_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	77.0	9.4e-192
WP_014390737.1|1800241_1800739_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
WP_016533497.1|1800821_1801004_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	3.8e-09
WP_014390736.1|1801032_1801467_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_064775606.1|1801501_1801783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014667795.1|1801688_1802012_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_014667794.1|1801984_1802515_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	9.7e-45
WP_014391475.1|1802511_1802772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016569984.1|1803130_1803286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533470.1|1803360_1803726_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_064775605.1|1803725_1804328_-	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_016533468.1|1804415_1804628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016569985.1|1804701_1805160_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_041423202.1|1805149_1805680_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016533441.1|1805689_1806379_-	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_016533442.1|1806378_1807281_-	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_014390722.1|1807282_1807636_-	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_064775604.1|1807632_1808334_-	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014391093.1|1808391_1808619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720263.1|1808687_1808897_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_064775603.1|1809024_1809714_+	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_016533478.1|1809859_1810123_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016533477.1|1810125_1810605_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533476.1|1810601_1810985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|1811603_1811834_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_014391456.1|1812058_1812322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391102.1|1812409_1812943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016569990.1|1813404_1814040_+	antirepressor	NA	A6XMM0	Bacillus_virus	53.3	2.1e-22
WP_014390710.1|1814101_1814413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|1814479_1814764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570068.1|1814750_1814987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101766859.1|1815164_1816145_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	40.1	3.4e-51
WP_016533454.1|1816148_1817000_+	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_064775601.1|1816992_1817604_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016570065.1|1817607_1818072_+	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_016533530.1|1818083_1818275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570064.1|1818317_1818671_+	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_014391448.1|1818742_1819531_+	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_101766465.1|1819581_1820181_+	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.0e-18
WP_016570062.1|1820315_1820849_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	36.6	1.3e-20
WP_016533427.1|1820858_1821158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051127937.1|1821456_1821729_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	41.1	4.9e-08
WP_064775600.1|1822104_1823277_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	52.9	5.9e-111
1823382:1823427	attR	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATG	NA	NA	NA	NA
