The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015562	Pasteurella multocida strain USDA-ARS-USMARC-59910 chromosome, complete genome	2345801	524594	571997	2345801	transposase,terminase,integrase,tail,tRNA	Mannheimia_phage(50.0%)	66	526156:526201	572419:572464
WP_014325699.1|524594_526037_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
526156:526201	attL	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
WP_064775600.1|526305_527478_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	52.9	5.9e-111
WP_051127937.1|527853_528126_-	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	41.1	4.9e-08
WP_016533427.1|528424_528724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570062.1|528733_529267_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	36.6	1.3e-20
WP_101766465.1|529401_530001_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.0e-18
WP_014391448.1|530051_530840_-	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_016570064.1|530911_531265_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_016533530.1|531307_531499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570065.1|531510_531975_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_064775601.1|531978_532590_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016533454.1|532582_533434_-	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_016570067.1|533437_534424_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	39.9	5.8e-51
WP_016570068.1|534601_534838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|534824_535109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|535175_535487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016569990.1|535548_536184_-	antirepressor	NA	A6XMM0	Bacillus_virus	53.3	2.1e-22
WP_014391102.1|536645_537179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391456.1|537266_537530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|537754_537985_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_016533476.1|538603_538987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533477.1|538983_539463_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533478.1|539465_539729_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_064775603.1|539874_540564_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_005720263.1|540691_540901_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_014391093.1|540969_541197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775604.1|541254_541956_+	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014390722.1|541952_542306_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_016533442.1|542307_543210_+	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_016533441.1|543209_543899_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_041423202.1|543908_544439_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016569985.1|544428_544887_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_016533468.1|544960_545173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775605.1|545260_545863_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_016533470.1|545862_546228_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_143930513.1|546417_546603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391475.1|546816_547077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014667794.1|547073_547604_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	9.7e-45
WP_014667795.1|547576_547900_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_064775606.1|547805_548087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390736.1|548121_548556_-	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_016533497.1|548584_548767_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	3.8e-09
WP_014390737.1|548849_549347_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
WP_016533292.1|549330_550557_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	77.0	9.4e-192
WP_016533291.1|550571_552017_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	58.6	2.4e-146
WP_014390740.1|551970_552942_+	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
WP_016533290.1|552956_554303_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	55.3	4.0e-127
WP_016533289.1|554302_554737_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.7	1.1e-54
WP_016533288.1|554748_555747_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	74.7	9.1e-145
WP_042743192.1|556291_556660_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	4.7e-22
WP_014390746.1|556662_557007_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
WP_014390747.1|557011_557383_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
WP_016533319.1|557379_557751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390749.1|557762_558245_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
WP_016533320.1|558298_558970_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.9	1.5e-42
WP_016533321.1|559000_559465_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	50.0	5.2e-34
WP_016533322.1|559532_559928_+	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	83.2	7.7e-55
WP_042743193.1|559986_562431_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	57.0	1.6e-150
WP_014390756.1|562433_562763_+	Gifsy-1 prophage VmtM	NA	S5MW28	Escherichia_phage	37.1	3.2e-14
WP_023430089.1|562852_563566_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.9	2.1e-82
WP_016569980.1|563570_564314_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	59.6	7.4e-83
WP_014667799.1|564256_564877_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
WP_101766466.1|564880_569884_+|tail	phage tail protein	tail	A0A0M3LQ61	Mannheimia_phage	38.9	2.5e-251
WP_064775609.1|569931_570258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775610.1|570397_571534_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_005720092.1|571580_571997_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
572419:572464	attR	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP015562	Pasteurella multocida strain USDA-ARS-USMARC-59910 chromosome, complete genome	2345801	1593354	1602712	2345801		Tupanvirus(33.33%)	9	NA	NA
WP_014326205.1|1593354_1594629_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.8e-92
WP_005753554.1|1594669_1595287_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_014326206.1|1595286_1596174_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005724296.1|1596243_1597191_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
WP_005753553.1|1597266_1598820_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_010906540.1|1599054_1599846_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L3Z8	Tupanvirus	32.8	3.7e-16
WP_005724066.1|1599854_1600640_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005724065.1|1600716_1601697_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
WP_014326208.1|1601713_1602712_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
>prophage 3
NZ_CP015562	Pasteurella multocida strain USDA-ARS-USMARC-59910 chromosome, complete genome	2345801	1953735	2011673	2345801	transposase,terminase,integrase,tail,holin,head	Mannheimia_phage(36.17%)	74	1959615:1959665	2012125:2012175
WP_014326374.1|1953735_1956567_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.3	0.0e+00
WP_005719438.1|1956738_1957239_+	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
WP_014325726.1|1957421_1957886_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_005725034.1|1958462_1959317_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
1959615:1959665	attL	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
WP_014391441.1|1959691_1960747_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.9	1.6e-62
WP_075271365.1|1960650_1960953_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014391442.1|1961136_1961859_-	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
WP_064775645.1|1961869_1962091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691048.1|1962335_1963244_-	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	36.1	2.5e-40
WP_064775646.1|1963347_1963836_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	51.2	3.2e-34
WP_080637896.1|1963847_1964060_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_016533502.1|1964047_1964413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775647.1|1964409_1965009_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.9e-18
WP_014391448.1|1965059_1965848_-	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_016570064.1|1965919_1966273_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_016533530.1|1966315_1966507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570065.1|1966518_1966983_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_064775601.1|1966986_1967598_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016533454.1|1967590_1968442_-	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_016570067.1|1968445_1969432_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	39.9	5.8e-51
WP_016570068.1|1969609_1969846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|1969832_1970117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|1970183_1970495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570070.1|1970556_1971204_-	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	64.2	3.5e-36
WP_016533491.1|1971469_1972015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|1972606_1972837_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_016533476.1|1973455_1973839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533477.1|1973835_1974315_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533478.1|1974317_1974581_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_064775603.1|1974726_1975416_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_005720263.1|1975543_1975753_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_014391093.1|1975821_1976049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775604.1|1976106_1976808_+	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014390722.1|1976804_1977158_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_016533442.1|1977159_1978062_+	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_016533441.1|1978061_1978751_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_041423202.1|1978760_1979291_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016569985.1|1979280_1979739_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_016533468.1|1979812_1980025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775605.1|1980112_1980715_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_016533470.1|1980714_1981080_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_143930513.1|1981269_1981455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533461.1|1981668_1982034_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_016533462.1|1982005_1982590_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.3	6.5e-58
WP_016569983.1|1982592_1982916_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_064775648.1|1983194_1983551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775649.1|1983680_1983935_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064775650.1|1983922_1984303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775651.1|1984441_1985143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533416.1|1985129_1985558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081273988.1|1985873_1986464_+	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	39.5	4.9e-21
WP_064775652.1|1986466_1987738_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	61.7	8.6e-148
WP_064775653.1|1987747_1989151_+	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	59.6	4.4e-153
WP_064775738.1|1989140_1990742_+|head	phage head morphogenesis protein	head	A0A0M3LQ07	Mannheimia_phage	52.1	3.3e-152
WP_015691070.1|1990744_1990963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691071.1|1990937_1991372_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	61.2	3.1e-41
WP_015691073.1|1991707_1992478_+	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.2	1.5e-25
WP_015691074.1|1992495_1993653_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	43.3	8.3e-81
WP_015691075.1|1993709_1993946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691076.1|1993962_1994430_+	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
WP_015691077.1|1994431_1994806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691078.1|1994807_1995209_+	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
WP_015691079.1|1995208_1995601_+	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
WP_016533104.1|1995613_1996630_+	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	69.9	7.6e-131
WP_016533103.1|1996702_1997119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533102.1|1997488_1997818_+|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	49.1	4.8e-26
WP_064775655.1|1998122_1998818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775657.1|2001651_2002356_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.1	1.6e-82
WP_101766477.1|2002358_2003099_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	60.0	8.7e-84
WP_014667799.1|2003041_2003662_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
WP_081317749.1|2003665_2009560_+	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	36.1	1.6e-257
WP_064775609.1|2009607_2009934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775610.1|2010073_2011210_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_005720092.1|2011256_2011673_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
2012125:2012175	attR	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
