The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025251	Escherichia coli strain BH100 substr. MG2017 chromosome, complete genome	5131212	136548	200456	5131212	tRNA,bacteriocin,protease,transposase	Erysipelothrix_phage(11.11%)	56	NA	NA
WP_000471925.1|136548_136833_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001311381.1|137000_137240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282227.1|137240_137531_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000085117.1|137697_137886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543774.1|137939_138230_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000331776.1|138685_139450_+	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_000003823.1|139610_142274_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_000963500.1|142288_144181_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_000102485.1|144388_145813_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
WP_000784420.1|146054_147812_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_001295775.1|148165_150763_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_001346485.1|150937_151300_+	YacL family protein	NA	NA	NA	NA	NA
WP_000734302.1|151337_152132_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000818414.1|152147_153014_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_001295568.1|153119_153467_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_001189641.1|153632_155183_+	multicopper oxidase CueO	NA	NA	NA	NA	NA
WP_099156434.1|155421_156770_-|transposase	IS3-like element IS1397 family transposase	transposase	NA	NA	NA	NA
WP_001298426.1|156875_159266_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|159471_160008_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651600.1|160048_160711_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|160819_161746_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000972203.1|161742_162513_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000901994.1|162617_163058_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000277856.1|163121_164351_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000621507.1|164354_164735_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_000339891.1|165008_165941_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.4	6.5e-60
WP_000905378.1|166294_167146_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000805441.1|167157_167952_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_000846619.1|168063_169326_-	fimbrial-like adhesin	NA	NA	NA	NA	NA
WP_001247914.1|169375_169972_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001298424.1|169998_170607_-	fimbrial-like protein YadL	NA	NA	NA	NA	NA
WP_000591066.1|170618_171185_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000153318.1|171201_173790_-	outer membrane usher protein	NA	NA	NA	NA	NA
WP_000465917.1|173824_174565_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000038450.1|174673_175264_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000215149.1|175625_176105_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000174643.1|176101_177520_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937411.1|177558_178485_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|178521_178977_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396047.1|179154_179859_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294708.1|179873_180404_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001298420.1|180477_182907_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	2.1e-41
WP_000918171.1|183000_185535_+	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_000035485.1|185754_187998_+	ferrichrome porin FhuA	NA	NA	NA	NA	NA
WP_001158929.1|188048_188846_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
WP_001298425.1|188845_189736_+	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_000044106.1|189732_191715_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_000045295.1|191749_193030_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_000845408.1|193254_194676_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_120795373.1|194699_194765_+	protein YadW	NA	NA	NA	NA	NA
WP_001295564.1|194757_195102_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
WP_000964221.1|195148_195772_-	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_001298427.1|195809_196610_-	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_000689844.1|196602_197301_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_000057086.1|197384_198902_+	dGTPase	NA	NA	NA	NA	NA
WP_000753942.1|199031_200456_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 2
NZ_CP025251	Escherichia coli strain BH100 substr. MG2017 chromosome, complete genome	5131212	266814	316154	5131212	plate,transposase	Streptococcus_phage(22.22%)	46	NA	NA
WP_000224521.1|266814_268161_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013428.1|268163_268688_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433567.1|268684_269977_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896716.1|269981_271031_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863399.1|270994_272836_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001189667.1|272841_273267_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|273271_274756_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|274778_275282_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|275987_276506_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_021573161.1|276726_278709_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	2.5e-24
WP_000571853.1|278815_279862_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528851.1|279854_281294_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|281268_281559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227712.1|282809_283313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|283406_283895_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|284165_284936_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|285089_285563_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973131.1|285605_288050_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|288289_288868_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001298195.1|289072_289840_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|289810_290551_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|290862_291612_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_000006241.1|291787_292285_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_071778446.1|292367_292577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298188.1|292604_294344_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001298192.1|294303_295074_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|295144_296200_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|296251_296545_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|296547_296946_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|296955_297408_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001335538.1|297585_298737_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.8e-31
WP_000602124.1|298733_299348_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|299404_300862_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291991.1|301122_301581_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189578.1|301672_302917_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|302974_303376_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749900.1|303414_304470_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
WP_001285288.1|304758_305862_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893298.1|305873_307127_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_001335540.1|307627_308224_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.4	1.7e-98
WP_000258743.1|308310_309948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266639.1|310639_310867_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000120393.1|310972_311200_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335706.1|311448_312882_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282079.1|313851_314415_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_089644009.1|314622_316154_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	2.8e-44
>prophage 3
NZ_CP025251	Escherichia coli strain BH100 substr. MG2017 chromosome, complete genome	5131212	965149	972872	5131212	integrase	uncultured_Caudovirales_phage(50.0%)	10	959136:959150	971476:971490
959136:959150	attL	GCTCACGGGCCAGAT	NA	NA	NA	NA
WP_000188148.1|965149_967096_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|967168_967393_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000085201.1|967797_969036_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	2.0e-125
WP_001206970.1|969445_969655_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
WP_000103622.1|969793_969973_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
WP_021527564.1|970106_970304_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609226.1|970296_970608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543626.1|970600_970828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791981.1|970833_971121_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761778.1|971117_972872_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.8	2.2e-93
971476:971490	attR	ATCTGGCCCGTGAGC	NA	NA	NA	NA
>prophage 4
NZ_CP025251	Escherichia coli strain BH100 substr. MG2017 chromosome, complete genome	5131212	1228337	1273440	5131212	capsid,integrase,tRNA,lysis,head,terminase,tail,portal	Enterobacteria_phage(55.77%)	60	1220972:1220987	1280617:1280632
1220972:1220987	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_001298466.1|1228337_1229444_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1229497_1229959_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248675.1|1229968_1230622_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1230793_1232044_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741330.1|1232157_1233300_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.4	3.1e-205
WP_000088653.1|1233289_1233526_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|1233665_1233905_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763364.1|1233952_1234171_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_001308571.1|1234269_1234551_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000548537.1|1234561_1234753_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682300.1|1234725_1234908_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|1234904_1235585_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|1235581_1236367_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995491.1|1236372_1236669_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000233576.1|1236743_1236950_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1237425_1237803_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1237780_1238842_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_001337214.1|1238922_1239615_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|1239725_1239953_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182882.1|1239983_1240523_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_001546578.1|1240609_1241539_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	5.6e-112
WP_000788796.1|1241535_1242249_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
WP_000608370.1|1242327_1242756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182282.1|1242752_1243130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053041.1|1243397_1243853_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
WP_000224917.1|1243852_1244023_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
WP_000774485.1|1244015_1244306_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
WP_001099712.1|1244302_1244665_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971056.1|1244661_1244802_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204776.1|1244887_1245271_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1245459_1246542_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1247130_1247346_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135283.1|1247345_1247843_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_001228695.1|1248059_1248242_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1248332_1248626_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1249106_1249433_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881607.1|1249639_1249822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|1250385_1250934_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001304453.1|1250905_1252834_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_023151962.1|1252817_1253024_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831760.1|1253020_1254613_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_001253894.1|1254602_1256108_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.2	1.3e-99
WP_000256813.1|1256144_1256492_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522651.1|1256549_1257578_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|1257629_1258004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1257996_1258350_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_001007375.1|1258361_1258940_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
WP_000683149.1|1258936_1259332_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.0e-70
WP_001577918.1|1259339_1260080_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000479163.1|1260095_1260518_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_000459487.1|1260499_1260934_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	6.5e-63
WP_023151960.1|1260926_1263488_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.0	0.0e+00
WP_000847349.1|1263484_1263814_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	2.8e-58
WP_016230622.1|1263813_1264512_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
WP_044869897.1|1264516_1265260_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	7.7e-149
WP_000090917.1|1265196_1265829_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_052991286.1|1265889_1269288_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
WP_023152091.1|1269354_1269954_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.3e-111
WP_024179053.1|1270018_1272859_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	92.3	2.5e-54
WP_023152094.1|1272858_1273440_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.6e-101
1280617:1280632	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 5
NZ_CP025251	Escherichia coli strain BH100 substr. MG2017 chromosome, complete genome	5131212	2775692	2817155	5131212	terminase,tail,holin,integrase	Salmonella_phage(53.19%)	53	NA	NA
WP_000904982.1|2775692_2776247_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	3.7e-87
WP_001115569.1|2776276_2776771_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	92.8	1.1e-79
WP_000805550.1|2776770_2777364_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.9	4.5e-59
WP_001106827.1|2777335_2777776_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_001096981.1|2777802_2778492_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	70.0	3.7e-28
WP_000049952.1|2778491_2779172_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	3.4e-103
WP_001197080.1|2779168_2780368_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	1.7e-185
WP_001270631.1|2780367_2780721_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
WP_000301073.1|2780720_2781473_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	2.5e-86
WP_000718774.1|2781914_2782688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824896.1|2782783_2783116_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.5	1.1e-22
WP_000081732.1|2783115_2784180_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	3.2e-156
WP_000155120.1|2784182_2784485_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	6.3e-49
WP_001298404.1|2784484_2785072_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_000990889.1|2785071_2787057_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
WP_000393960.1|2787234_2787687_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
WP_000109249.1|2787690_2788131_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000046934.1|2788141_2789287_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	5.2e-160
WP_001298391.1|2789290_2789854_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_001142475.1|2789828_2790218_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
WP_000008727.1|2790204_2790759_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	1.7e-79
WP_001125664.1|2790755_2791163_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	4.3e-69
WP_001107515.1|2791128_2791350_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_000627477.1|2791391_2792333_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.3	3.2e-155
WP_001066729.1|2792344_2792851_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
WP_000873175.1|2792854_2794075_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	3.2e-200
WP_000184961.1|2794089_2794824_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	85.6	1.8e-97
WP_000113489.1|2794714_2796181_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
WP_001130788.1|2796180_2797803_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_000162795.1|2797805_2798378_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
WP_000779565.1|2798439_2798964_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_001194119.1|2798947_2799424_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000781776.1|2799427_2799769_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001174015.1|2800214_2800556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|2800587_2801010_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001337135.1|2801291_2803484_-	replication protein	NA	B6SCY1	Bacteriophage	71.3	1.2e-173
WP_000170998.1|2803487_2803700_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_000049986.1|2803820_2804444_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000051353.1|2805223_2806126_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_001113502.1|2806128_2807430_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	7.2e-134
WP_000769011.1|2807445_2807994_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_001298623.1|2808045_2808684_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	68.8	3.9e-72
WP_000490741.1|2808751_2809021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065468.1|2809077_2811141_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	8.7e-275
WP_000216034.1|2811146_2811350_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	55.4	3.2e-12
WP_000008824.1|2811355_2811577_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000128190.1|2811566_2812049_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.6	3.6e-70
WP_000312950.1|2812048_2812342_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	5.0e-27
WP_085961393.1|2812311_2813343_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	53.0	1.1e-100
WP_000212683.1|2813339_2813660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127138.1|2813694_2815089_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.7	7.3e-217
WP_001138328.1|2815282_2816680_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000054755.1|2816894_2817155_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 6
NZ_CP025251	Escherichia coli strain BH100 substr. MG2017 chromosome, complete genome	5131212	3026330	3089063	5131212	tRNA,plate,transposase	uncultured_Caudovirales_phage(28.57%)	50	NA	NA
WP_099156434.1|3026330_3027678_+|transposase	IS3-like element IS1397 family transposase	transposase	NA	NA	NA	NA
WP_000098258.1|3027854_3029195_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000211785.1|3029215_3030556_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000097082.1|3030557_3031910_-	MFS transporter	NA	NA	NA	NA	NA
WP_000807752.1|3032343_3032793_-	flavodoxin	NA	NA	NA	NA	NA
WP_000889999.1|3032810_3033593_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_000206984.1|3033592_3033922_-	YqcC family protein	NA	NA	NA	NA	NA
WP_000342431.1|3034543_3035089_-	SecY-interacting protein	NA	NA	NA	NA	NA
WP_000100429.1|3035156_3036005_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
WP_000627996.1|3036116_3037481_+	nucleotide 5'-monophosphate nucleosidase	NA	NA	NA	NA	NA
WP_000450473.1|3038037_3039327_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_000626404.1|3039384_3040752_+	L-serine ammonia-lyase II	NA	NA	NA	NA	NA
WP_001298168.1|3040863_3041619_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
WP_001541711.1|3041723_3042872_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_000440772.1|3042899_3043547_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000528587.1|3044093_3045410_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000724159.1|3045442_3047218_+	L-fucose isomerase	NA	NA	NA	NA	NA
WP_099989771.1|3047353_3048701_+|transposase	IS3-like element IS1397 family transposase	transposase	NA	NA	NA	NA
WP_000808355.1|3048762_3050181_+	L-fuculokinase	NA	NA	NA	NA	NA
WP_000920840.1|3050182_3050605_+	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_000642344.1|3050662_3051394_+	L-fucose operon activator	NA	NA	NA	NA	NA
WP_001045128.1|3051437_3052538_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_000203905.1|3052530_3052926_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_000044401.1|3052944_3053862_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_000750398.1|3054212_3054440_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_001298157.1|3054631_3055837_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.5	1.2e-74
WP_000184272.1|3055836_3056280_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117716.1|3056330_3057137_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
WP_000678650.1|3057213_3058311_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_001298136.1|3059447_3059948_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001298151.1|3060006_3061545_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000690892.1|3061562_3062900_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_023152194.1|3062896_3063562_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001246523.1|3063574_3065227_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000997068.1|3065284_3065776_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000147336.1|3065967_3068604_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	6.4e-97
WP_001298160.1|3068615_3071105_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.5	1.7e-22
WP_000236948.1|3071098_3071989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541715.1|3072002_3072596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024965.1|3072643_3075160_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.9	4.8e-17
WP_000063939.1|3075152_3075941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001536259.1|3076025_3076946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145237.1|3077202_3078417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298149.1|3078473_3081800_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_001298123.1|3081792_3083403_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001298162.1|3083408_3084839_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000342489.1|3085310_3087071_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000373316.1|3087034_3088114_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000484008.1|3088094_3088631_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000235155.1|3088634_3089063_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 7
NZ_CP025251	Escherichia coli strain BH100 substr. MG2017 chromosome, complete genome	5131212	4120302	4131864	5131212	integrase	Enterobacteria_phage(88.89%)	13	4120120:4120142	4130754:4130776
4120120:4120142	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218974.1|4120302_4121490_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	91.2	1.5e-207
WP_000281857.1|4121536_4122064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001335488.1|4122070_4123156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446153.1|4123452_4124025_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000638629.1|4124098_4124599_-	transactivation protein	NA	NA	NA	NA	NA
WP_001279711.1|4124595_4125330_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	96.3	1.1e-126
WP_001149160.1|4125882_4126149_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980256.1|4126145_4126736_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	89.6	2.0e-59
WP_001244665.1|4126728_4127016_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459296.1|4127008_4127464_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4127599_4127920_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783690.1|4127934_4130268_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_001280586.1|4130826_4131864_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
4130754:4130776	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 8
NZ_CP025251	Escherichia coli strain BH100 substr. MG2017 chromosome, complete genome	5131212	5036567	5103166	5131212	protease,holin,integrase,lysis,transposase,terminase,tail,portal	Enterobacteria_phage(46.81%)	71	5024608:5024642	5112017:5112051
5024608:5024642	attL	GTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
WP_099156434.1|5036567_5037916_-|transposase	IS3-like element IS1397 family transposase	transposase	NA	NA	NA	NA
WP_001298085.1|5038021_5040172_-	pyruvate/proton symporter BtsT	NA	NA	NA	NA	NA
WP_000919563.1|5040548_5042213_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000118642.1|5042255_5043527_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001235678.1|5043523_5043997_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000034589.1|5044060_5045032_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_001298060.1|5045722_5047375_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_000091596.1|5047545_5048451_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106005.1|5048589_5049612_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001292636.1|5049751_5052043_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_001385190.1|5052296_5052791_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_000799911.1|5052839_5053577_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001298056.1|5053579_5054119_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
WP_000538188.1|5054226_5054700_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_001340933.1|5054690_5055461_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_000936639.1|5056080_5056806_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001298690.1|5056763_5057441_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_000331596.1|5057478_5058267_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001350368.1|5058407_5058644_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_001272356.1|5059204_5060236_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204030.1|5060338_5060752_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092461.1|5060720_5061167_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870712.1|5061181_5061859_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_001218287.1|5062244_5063459_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653746.1|5063834_5064830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206728.1|5065397_5066018_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.6	1.2e-118
WP_001242728.1|5066017_5066380_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
WP_000008232.1|5066370_5066907_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081256.1|5067034_5067859_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000135680.1|5067924_5068287_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000500990.1|5068755_5069268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298691.1|5069583_5070276_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	7.3e-125
WP_001191672.1|5070373_5070634_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	9.3e-41
WP_000515840.1|5070626_5071178_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
WP_001087311.1|5071174_5072011_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	92.4	1.1e-138
WP_024179079.1|5072015_5072240_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	9.1e-37
WP_000061519.1|5072236_5073055_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_001315196.1|5073051_5073546_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_000066917.1|5073545_5074199_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210180.1|5074195_5074522_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
WP_000767113.1|5074518_5074908_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061422.1|5074927_5075770_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
WP_001540821.1|5075777_5076767_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001205460.1|5076784_5077126_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|5077138_5077687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|5077673_5078600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917727.1|5078864_5079068_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
WP_000799673.1|5079218_5080271_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
WP_001120490.1|5080347_5080674_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_001197768.1|5080677_5081154_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
WP_001298489.1|5081150_5081594_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	93.9	1.5e-70
WP_000084843.1|5081632_5082007_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	87.9	2.5e-55
WP_000373423.1|5082645_5083140_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000934116.1|5083139_5085242_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|5085238_5085451_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072134767.1|5085378_5086959_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001136583.1|5086903_5088931_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|5089017_5089341_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|5089333_5089609_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677099.1|5089620_5090199_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	2.1e-101
WP_001298485.1|5090195_5090597_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	1.6e-71
WP_000211128.1|5090607_5091351_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298500.1|5091411_5091798_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|5091806_5092136_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372054.1|5092107_5095173_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
WP_000447254.1|5095172_5095502_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
WP_001152410.1|5095511_5096210_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.9e-133
WP_000194752.1|5096215_5096959_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.2e-151
WP_032143682.1|5096856_5097504_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	3.0e-112
WP_021518114.1|5097564_5101047_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_021518115.1|5101105_5103166_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
5112017:5112051	attR	GTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 1
NZ_CP025252	Escherichia coli strain BH100 substr. MG2017 plasmid pApR, complete sequence	33924	0	3312	33924	transposase	Escherichia_phage(100.0%)	3	NA	NA
WP_000376623.1|340_841_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|1016_1799_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|1788_3312_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
>prophage 2
NZ_CP025252	Escherichia coli strain BH100 substr. MG2017 plasmid pApR, complete sequence	33924	8963	10658	33924		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000105636.1|8963_10658_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
>prophage 3
NZ_CP025252	Escherichia coli strain BH100 substr. MG2017 plasmid pApR, complete sequence	33924	18440	23208	33924	transposase	Enterobacteria_phage(100.0%)	3	NA	NA
WP_001143775.1|18440_21446_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_001217881.1|21607_22165_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|22347_23208_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 4
NZ_CP025252	Escherichia coli strain BH100 substr. MG2017 plasmid pApR, complete sequence	33924	26631	31853	33924	integrase,transposase	Salmonella_phage(66.67%)	4	NA	NA
WP_001138064.1|26631_29598_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|29600_30161_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|30286_30637_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|30839_31853_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
>prophage 1
NZ_CP025253	Escherichia coli strain BH100 substr. MG2017 plasmid pBH100-1, complete sequence	105801	33	42997	105801	integrase,transposase	Escherichia_phage(37.5%)	41	3416:3430	38149:38163
WP_000179844.1|33_1713_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000344784.1|1715_2576_+	AAA family ATPase	NA	NA	NA	NA	NA
3416:3430	attL	GCGCGCCAGCTTCAG	NA	NA	NA	NA
WP_001324342.1|4293_5817_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|5806_6589_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|6764_7265_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|7392_8232_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|8225_8573_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|8736_9528_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845048.1|9676_10690_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|10892_11243_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|11368_11929_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|11931_14898_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|14964_15342_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|15542_16202_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_001333089.1|18988_19270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|19392_19743_-	protein stbB	NA	NA	NA	NA	NA
WP_000959884.1|19745_20708_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|20854_21148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|21224_21908_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|21908_22130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|22143_22578_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001333091.1|23277_23850_+	YubH family protein	NA	NA	NA	NA	NA
WP_001671341.1|23945_24248_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271762.1|24294_24717_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027493.1|24713_24905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|25942_26173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|26224_27586_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001298559.1|27632_28196_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
WP_000290834.1|29050_29578_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|29635_29869_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117321.1|29929_31351_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	1.2e-20
WP_001352368.1|31420_32629_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|32994_34200_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|34643_34964_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_039025567.1|35149_36130_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.7e-183
WP_011152973.1|36589_37141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014229371.1|37137_38481_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
38149:38163	attR	GCGCGCCAGCTTCAG	NA	NA	NA	NA
WP_080528056.1|38613_39471_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014229374.1|39800_40241_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000018326.1|40871_41687_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_039025567.1|42016_42997_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.7e-183
