The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	48236	58210	5084741	integrase	Enterobacteria_phage(100.0%)	12	47736:47758	58371:58393
47736:47758	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_001685687.1|48236_50570_-	P4-specific DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
WP_001685686.1|50584_50905_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459298.1|51040_51496_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244670.1|51488_51776_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980227.1|51768_52368_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001149161.1|52364_52631_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.8e-44
WP_101972776.1|53182_53917_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.4	2.3e-129
WP_095501464.1|53913_54414_+	transactivation protein	NA	NA	NA	NA	NA
WP_001685684.1|54487_55060_+	phage polarity suppression family protein	NA	Q7M2A1	Enterobacteria_phage	95.2	7.2e-94
WP_001335488.1|55356_56442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000281857.1|56448_56976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218974.1|57022_58210_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	91.2	1.5e-207
58371:58393	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	98930	107150	5084741	transposase	Synechococcus_phage(16.67%)	7	NA	NA
WP_000587748.1|98930_99863_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	6.5e-36
WP_053887456.1|100076_101273_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	3.8e-36
WP_000646007.1|101282_102308_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_087899328.1|102661_103934_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_101972778.1|103954_104917_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	30.6	1.5e-06
WP_000483848.1|104903_105863_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|105866_107150_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
>prophage 3
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	1073833	1087016	5084741		Escherichia_phage(40.0%)	12	NA	NA
WP_001295182.1|1073833_1074595_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1074588_1075215_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1075354_1076494_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1076556_1077549_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|1077642_1079007_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1079095_1079872_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1079876_1080515_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590404.1|1080511_1081774_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
WP_000847985.1|1081770_1082679_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|1082874_1083642_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141339.1|1083692_1084349_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
WP_001272907.1|1084454_1087016_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 4
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	1672445	1681887	5084741		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|1672445_1673372_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1673376_1674108_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1674088_1674196_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1674255_1674987_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1675208_1676894_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1676890_1677610_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1677656_1678127_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|1678167_1678629_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|1678753_1680754_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001333512.1|1680750_1681887_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 5
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	1735889	1792477	5084741	holin,capsid,tail,head,terminase,protease,transposase	Enterobacteria_phage(36.36%)	79	NA	NA
WP_101972842.1|1735889_1735991_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	5.2e-08
WP_085947970.1|1735956_1737170_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001303849.1|1737913_1738132_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281197.1|1738237_1738582_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_001277765.1|1738682_1738862_-	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	98.3	3.3e-29
WP_000103027.1|1738958_1739606_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	50.4	1.9e-63
WP_101972843.1|1739602_1739974_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	85.2	1.9e-31
WP_000763383.1|1739970_1740192_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_077827533.1|1740290_1740572_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	96.8	6.1e-46
WP_000548522.1|1740582_1740774_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
WP_032189860.1|1740746_1740929_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	4.8e-28
WP_097485495.1|1740925_1741606_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	6.0e-132
WP_000100845.1|1741602_1742388_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|1742393_1742690_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372937.1|1742764_1742908_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1742876_1743041_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|1743113_1743482_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000167595.1|1743632_1744103_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_101972844.1|1744161_1744545_-	antitermination protein	NA	G9L671	Escherichia_phage	99.2	3.3e-63
WP_001278657.1|1745051_1745672_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
WP_001207140.1|1745668_1746103_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
WP_000885926.1|1746173_1746515_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_000428098.1|1746575_1747280_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|1747393_1747627_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_024216147.1|1747765_1748062_+	regulatory protein	NA	G9L678	Escherichia_phage	99.0	1.2e-47
WP_000185454.1|1748094_1749033_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_001510925.1|1749029_1749731_+	replication P family protein	NA	Q6H9X6	Enterobacteria_phage	99.6	1.7e-129
WP_000145908.1|1749727_1750018_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	100.0	5.7e-47
WP_001000130.1|1750088_1750367_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1750499_1750715_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1750725_1750962_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_024216032.1|1750918_1751365_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	98.6	1.2e-80
WP_000153288.1|1751361_1751889_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_001254220.1|1751885_1752062_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_000924594.1|1752064_1752466_+	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	98.5	4.6e-71
WP_072178476.1|1752425_1752644_+	protein ninF	NA	G9L691	Escherichia_phage	87.5	1.7e-19
WP_101972845.1|1752606_1753113_+	HNH endonuclease	NA	A0A248SKL5	Klebsiella_phage	47.9	1.2e-36
WP_024195586.1|1753003_1753174_+	ninF	NA	NA	NA	NA	NA
WP_001108084.1|1753166_1753733_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_044706635.1|1753707_1754310_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.1	1.2e-91
WP_001028858.1|1754306_1754978_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1754968_1755457_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_101972846.1|1757005_1758856_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411813.1|1759148_1759355_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_024216148.1|1759359_1759704_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	2.1e-56
WP_025380493.1|1759754_1760288_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.3e-100
WP_000661708.1|1760561_1761257_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.7	3.6e-124
WP_001280923.1|1761351_1761483_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012816791.1|1761705_1761891_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000828070.1|1762291_1762618_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095732.1|1762749_1762950_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
WP_025380422.1|1762991_1763357_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_000958398.1|1763646_1764210_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_101972847.1|1764206_1765868_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_044869027.1|1765931_1767869_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_001063027.1|1767913_1768135_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_000125968.1|1770661_1770988_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
WP_001007905.1|1770997_1771348_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1771344_1771791_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1771787_1772132_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_021497599.1|1772190_1772907_+|tail	phage major tail 2 family protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	2.3e-126
WP_001030063.1|1772912_1773287_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1773382_1773592_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_101972848.1|1773643_1776886_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.4	0.0e+00
WP_000807954.1|1776878_1777220_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_101972849.1|1777219_1777918_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.7	8.1e-132
WP_001302649.1|1777934_1778255_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1778362_1778536_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|1778606_1779530_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_000967281.1|1779584_1780322_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	97.1	6.1e-146
WP_122995614.1|1780267_1780900_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	1.2e-105
WP_101972850.1|1781135_1784615_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.2	0.0e+00
WP_089645828.1|1784681_1785281_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	3.0e-111
WP_101972851.1|1785345_1786659_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.0	3.8e-74
WP_101972852.1|1786660_1786930_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	96.6	2.4e-44
WP_101972853.1|1787139_1787787_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.8	3.7e-38
WP_101972854.1|1788484_1789879_-	type III secretion system effector NleA	NA	Q6H9S2	Enterobacteria_phage	90.8	2.8e-216
WP_001386899.1|1790471_1790528_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_085949156.1|1791264_1792477_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
>prophage 6
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	1830735	1838383	5084741		Enterobacteria_phage(42.86%)	7	NA	NA
WP_021557911.1|1830735_1832130_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
WP_001767435.1|1832304_1833198_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.2	6.6e-46
WP_101972856.1|1833569_1834655_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.5e-100
WP_072795322.1|1834654_1835554_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	5.7e-29
WP_072795324.1|1835611_1836490_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	2.5e-106
WP_072795326.1|1836494_1837034_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.4	1.1e-51
WP_072795328.1|1837078_1838383_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	28.3	6.5e-26
>prophage 7
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	1883964	1971521	5084741	integrase,portal,holin,capsid,tail,head,terminase,protease,transposase	Enterobacteria_phage(38.0%)	81	1878710:1878726	1926743:1926759
1878710:1878726	attL	CAGGTATTCACTGATAT	NA	NA	NA	NA
WP_000255944.1|1883964_1884987_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_000349537.1|1885803_1885956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|1886693_1887296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077527097.1|1887389_1887668_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001352612.1|1888303_1888480_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000221529.1|1889195_1889765_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_032186701.1|1889930_1890323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001459868.1|1891486_1891891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001459860.1|1896810_1897026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087899328.1|1897110_1898383_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_101972861.1|1898354_1899590_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000973176.1|1901640_1902186_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001326708.1|1902182_1902926_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001459858.1|1902937_1904017_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_072163087.1|1904078_1905014_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011462.1|1905471_1906389_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_033803174.1|1906490_1907441_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000943916.1|1907558_1909202_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|1909829_1910546_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1910888_1912343_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378575.1|1912444_1913761_-	shikimate transporter	NA	NA	NA	NA	NA
WP_001459817.1|1914075_1915128_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001302302.1|1922955_1923753_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533607.1|1923988_1925014_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.3	6.4e-101
WP_000094838.1|1925013_1925217_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034469.1|1925275_1927747_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	1.5e-55
1926743:1926759	attR	CAGGTATTCACTGATAT	NA	NA	NA	NA
WP_000199479.1|1927842_1928031_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1928027_1928216_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000379610.1|1928705_1928858_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000948454.1|1929176_1929653_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1929777_1930101_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693916.1|1930084_1930510_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_101972862.1|1930532_1931501_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.1	1.0e-71
WP_000788763.1|1931507_1932254_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_000451007.1|1932275_1933046_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151233.1|1933061_1933475_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1933826_1934600_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1934965_1935103_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001178384.1|1935160_1936234_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
WP_000813263.1|1936305_1936461_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1936628_1936907_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|1936908_1937958_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|1937970_1938342_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|1938331_1938703_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|1938854_1939673_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|1939959_1940157_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_119187337.1|1940294_1941008_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101972864.1|1941774_1943625_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000411814.1|1944072_1944279_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|1944535_1944808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|1944967_1945501_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|1945721_1945835_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_141029367.1|1946056_1946242_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	6.0e-18
WP_001303878.1|1946769_1947084_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1947165_1947390_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|1947792_1948302_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_101972865.1|1948273_1950202_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_000258991.1|1950185_1950392_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001430223.1|1950388_1951981_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_101972866.1|1951970_1953476_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.7	2.7e-100
WP_000256809.1|1953512_1953860_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_101972867.1|1953917_1954943_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.1e-112
WP_000201523.1|1954994_1955369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204549.1|1955361_1955715_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000975046.1|1955730_1956264_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_000683066.1|1956260_1956656_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000106789.1|1956663_1957416_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	3.2e-134
WP_000479105.1|1957429_1957861_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533425.1|1957887_1958301_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000082492.1|1958281_1960861_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.9	0.0e+00
WP_000847304.1|1960857_1961187_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001152201.1|1961186_1961885_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	4.0e-131
WP_101972868.1|1961895_1962639_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.3e-145
WP_072280596.1|1962584_1963217_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.1e-103
WP_000649829.1|1963407_1963935_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_101972869.1|1964068_1967545_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.6	0.0e+00
WP_001815756.1|1967613_1968237_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	1.9e-68
WP_101972870.1|1968301_1969615_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.6	2.4e-76
WP_001101707.1|1969616_1969886_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_000950813.1|1970062_1971043_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_095111390.1|1971389_1971521_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
>prophage 8
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	2363810	2438608	5084741	integrase,portal,lysis,tail,terminase,protease,transposase	Enterobacteria_phage(41.82%)	87	2358161:2358176	2394036:2394051
2358161:2358176	attL	TTCATAAAAATAATCC	NA	NA	NA	NA
WP_001260865.1|2363810_2364632_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2364731_2364815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101972889.1|2364907_2365243_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2365639_2366893_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2366999_2367893_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2368027_2369248_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2369372_2370068_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2370020_2371313_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2371471_2372086_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526477.1|2372128_2372983_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2372984_2373602_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072163036.1|2373612_2376036_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	1.3e-208
WP_001295396.1|2378626_2378932_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072104773.1|2379039_2379750_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2379752_2380313_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2380347_2380689_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|2380823_2381150_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001295394.1|2381355_2382570_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836059.1|2382581_2383601_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_021531328.1|2383658_2383769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876979.1|2383788_2385069_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	8.6e-156
WP_001296941.1|2385103_2385340_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_101972890.1|2385427_2387899_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|2387992_2388184_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2388180_2388369_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001299931.1|2388768_2388933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171952.1|2388936_2389155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379588.1|2389314_2389470_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000381212.1|2389638_2390046_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000705355.1|2390336_2390858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151262.1|2391848_2392271_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_101972891.1|2392267_2392642_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.1	2.4e-37
WP_085947970.1|2392667_2393880_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000955178.1|2395243_2395426_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
2394036:2394051	attR	GGATTATTTTTATGAA	NA	NA	NA	NA
WP_000589005.1|2395603_2396917_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_101972892.1|2397353_2397518_-	protein FlxA	NA	NA	NA	NA	NA
WP_001171554.1|2397561_2397942_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2397938_2398286_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_053888474.1|2398335_2399874_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	6.0e-297
WP_001326990.1|2400338_2400644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2400668_2400908_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2400907_2401195_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2401266_2401422_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_099949844.1|2401638_2401890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2401956_2402235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099949845.1|2402236_2403286_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	2.8e-112
WP_101972893.1|2403299_2404052_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.4	2.7e-133
WP_120795389.1|2404329_2404419_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2404473_2404686_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2404986_2405202_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2405955_2406171_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2406175_2406487_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_085949156.1|2406643_2407857_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_001071769.1|2408326_2408824_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2409185_2409398_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2409408_2409597_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2409599_2409665_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2409744_2409900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019139.1|2410071_2410245_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035576.1|2410396_2410828_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	90.6	6.6e-60
WP_099949846.1|2411128_2411335_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	89.7	1.9e-25
WP_000421825.1|2411887_2412427_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_101972895.1|2412435_2414535_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	0.0e+00
WP_001072975.1|2414531_2414744_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_061342262.1|2414743_2416252_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.8	1.2e-289
WP_101972896.1|2416196_2418224_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
WP_001097050.1|2418310_2418634_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|2418626_2418902_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|2418913_2419492_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079418.1|2419488_2419890_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.4e-72
WP_000211124.1|2419900_2420644_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	6.0e-133
WP_101973063.1|2420704_2421091_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_001161009.1|2421099_2421429_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_101972897.1|2421400_2424451_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	95.4	0.0e+00
WP_000447253.1|2424450_2424780_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152388.1|2424789_2425488_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	8.6e-134
WP_000140720.1|2425493_2426237_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
WP_000090901.1|2426173_2426806_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.9e-95
WP_101972898.1|2426866_2430169_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.3	0.0e+00
WP_158297017.1|2430910_2431165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053274246.1|2431127_2431727_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	2.8e-109
WP_101972899.1|2431791_2434815_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_000885587.1|2434814_2435390_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.0e-104
WP_000086527.1|2435487_2436078_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2436394_2436628_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2436696_2436810_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000547191.1|2437279_2438608_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	2951809	2961081	5084741		Escherichia_phage(28.57%)	12	NA	NA
WP_001189321.1|2951809_2952643_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
WP_001300785.1|2952706_2953198_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001001902.1|2953299_2953854_-	molecular chaperone	NA	NA	NA	NA	NA
WP_001342369.1|2953877_2954228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049142820.1|2954258_2954531_+	hypothetical protein	NA	A0A1D7XF78	Escherichia_phage	52.2	1.4e-18
WP_101972930.1|2954543_2954930_+	hypothetical protein	NA	C4MZ15	Escherichia_phage	47.3	6.7e-11
WP_077134559.1|2955241_2955487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101972931.1|2955552_2957232_+	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	28.5	6.4e-42
WP_101972932.1|2957305_2958481_-	hypothetical protein	NA	A7XF87	Enterobacteria_phage	29.8	1.3e-25
WP_148724785.1|2958648_2959206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101972933.1|2959205_2960696_+	DEAD/DEAH box helicase family protein	NA	A0A0B7MRL8	Enterobacteria_phage	80.6	1.0e-245
WP_000949338.1|2960727_2961081_-	DUF882 domain-containing protein	NA	A0A140XFU9	Salmonella_phage	59.8	2.9e-37
>prophage 10
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	2978601	3133995	5084741	portal,integrase,holin,capsid,lysis,tail,terminase,protease,transposase	Enterobacteria_phage(43.12%)	176	3029302:3029361	3109085:3109853
WP_101972939.1|2978601_2980605_-|capsid	major capsid protein	capsid	G8EXZ9	Synechococcus_phage	25.4	3.6e-31
WP_101972940.1|2980650_2982162_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	27.2	9.3e-32
WP_094319614.1|2982172_2982670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101972941.1|2982742_2984650_-|terminase	terminase	terminase	D6PFE7	uncultured_phage	28.0	3.3e-34
WP_101972942.1|2984735_2985338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208371.1|2985373_2985601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063078207.1|2985765_2986596_-	Rha family transcriptional regulator	NA	A0A2I7R140	Vibrio_phage	34.1	1.4e-10
WP_000657811.1|2986685_2987018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063078206.1|2987138_2987591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096216076.1|2988977_2989160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000898985.1|2989279_2990221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192671.1|2990503_2990788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000656992.1|2990882_2991437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000351315.1|2992260_2993199_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	NA	NA	NA	NA
WP_000225124.1|2993974_2994430_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000258765.1|2995244_2996309_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
WP_001199163.1|2996653_2997925_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154414.1|2997930_2999058_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|2999115_2999946_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018486.1|3000610_3002119_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|3002277_3002487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001459641.1|3002541_3006504_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|3006543_3007182_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001352489.1|3007469_3008561_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|3008560_3009253_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126772.1|3009264_3009651_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001459640.1|3009658_3010459_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001185.1|3010468_3011059_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|3011069_3011564_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001459639.1|3011584_3012913_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	6.3e-234
WP_001273658.1|3013170_3013344_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001151437.1|3013716_3014313_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3014333_3014561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044279.1|3014598_3015840_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420621.1|3017648_3018569_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024560.1|3018568_3018874_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209894.1|3019025_3019625_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063152.1|3019621_3022168_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.4	2.2e-70
WP_001230242.1|3022167_3023340_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120125.1|3023469_3024162_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264933.1|3024134_3025163_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_021570495.1|3025639_3026293_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_101973071.1|3026305_3026533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087899328.1|3027159_3028433_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_024248136.1|3028554_3029193_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	39.6	4.5e-28
3029302:3029361	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_101972944.1|3030084_3030354_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_101972945.1|3030355_3031669_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.1	2.2e-74
WP_101972946.1|3031820_3032420_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.4	1.0e-98
WP_101972947.1|3032487_3035967_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.7	0.0e+00
WP_050575332.1|3036027_3036630_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	2.0e-86
WP_000140720.1|3036566_3037310_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
WP_001152388.1|3037315_3038014_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	8.6e-134
WP_000447253.1|3038023_3038353_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_096859573.1|3038352_3041403_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	94.9	0.0e+00
WP_001161009.1|3041374_3041704_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3041712_3042099_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_101972948.1|3042159_3042903_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001079411.1|3042913_3043315_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.4e-72
WP_101972949.1|3043311_3043890_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	92.2	3.8e-95
WP_024223043.1|3043901_3044177_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	97.8	3.3e-44
WP_001097050.1|3044169_3044493_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_096859574.1|3044578_3046606_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_024223045.1|3046550_3048059_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	8.6e-288
WP_001072975.1|3048058_3048271_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_096859575.1|3048267_3050370_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.9	0.0e+00
WP_000373425.1|3050369_3050864_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_096859577.1|3051539_3051692_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	2.8e-21
WP_101972950.1|3051679_3052117_-|lysis	lysis protein	lysis	K7P6J0	Enterobacteria_phage	97.9	5.0e-71
WP_023307783.1|3052113_3052611_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.8	2.9e-91
WP_000284524.1|3052610_3052826_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_033816266.1|3052968_3053367_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3053447_3053606_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3053691_3054435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235438.1|3054686_3055310_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	98.1	4.4e-113
WP_024232119.1|3055306_3055972_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	98.2	9.4e-130
WP_001591711.1|3055968_3056580_-	recombination protein NinG	NA	Q716C3	Shigella_phage	98.0	9.6e-97
WP_000567007.1|3056572_3056743_-	protein ninF	NA	M1FPE8	Enterobacteria_phage	100.0	1.4e-26
WP_001254251.1|3056739_3056922_-	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000255944.1|3057200_3058223_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001300609.1|3058219_3059002_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_001591709.1|3059290_3059563_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	84.3	3.8e-37
WP_000145926.1|3059633_3059924_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_024232112.1|3059920_3060622_-	hypothetical protein	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000185501.1|3060618_3061518_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	3.2e-173
WP_001177650.1|3061552_3061831_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000276886.1|3061939_3062125_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001095981.1|3062205_3062856_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_032352705.1|3063168_3063441_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	95.6	3.3e-25
WP_001066173.1|3063457_3064039_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	1.5e-91
WP_024232195.1|3064252_3064453_+	Restriction inhibitor protein ral	NA	A5VWA0	Enterobacteria_phage	93.9	6.7e-31
WP_024231983.1|3064635_3065004_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	1.7e-64
WP_101972951.1|3065076_3065226_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N7KZ85	Stx2-converting_phage	89.7	9.4e-14
WP_085948136.1|3065231_3066444_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.8e-166
WP_001702774.1|3066522_3066687_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.3	1.0e-21
WP_000995441.1|3066740_3067037_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.1e-48
WP_000100844.1|3067042_3067828_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186812.1|3067824_3068505_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_032189860.1|3068501_3068684_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	4.8e-28
WP_000548522.1|3068656_3068848_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
WP_077827533.1|3068858_3069140_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	96.8	6.1e-46
WP_000763378.1|3069238_3069460_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_074464777.1|3069456_3070146_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	56.2	1.8e-54
WP_000951713.1|3070508_3070718_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_000208005.1|3070714_3071512_+	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
WP_024231740.1|3071626_3071908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545741.1|3071996_3072164_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|3072203_3072422_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001297110.1|3072399_3073473_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.4	1.1e-199
WP_101972952.1|3073567_3076312_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_053887301.1|3076383_3077457_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3077504_3077678_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|3077667_3077898_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3077872_3078061_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3078071_3078284_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3078569_3078782_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001424190.1|3079223_3079529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247609.1|3079635_3080280_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038048.1|3080276_3081023_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742360.1|3081022_3083119_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|3083164_3084304_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057873.1|3084291_3084738_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208666.1|3084757_3086938_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|3087052_3088351_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|3088430_3088523_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_101972953.1|3088535_3089672_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263577.1|3089683_3091228_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|3091361_3092219_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063978.1|3092215_3092614_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|3092610_3093198_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3093194_3093902_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|3093920_3095714_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3095710_3096829_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001443410.1|3097446_3097830_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_101972954.1|3098275_3099310_+	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_101972944.1|3099435_3099705_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_101972955.1|3099706_3101020_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	6.9e-76
WP_101972956.1|3101837_3105317_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	88.8	0.0e+00
WP_000090894.1|3105377_3106010_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	5.0e-96
WP_000194780.1|3105946_3106690_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_101972957.1|3106695_3107394_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.1e-133
WP_000847379.1|3107393_3107723_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001300236.1|3109853_3110078_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
3109085:3109853	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACAGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGCTATGTCGGGGCTAAATCGTGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACGATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCT	NA	NA	NA	NA
WP_001303878.1|3110159_3110474_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_141029367.1|3111001_3111187_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	6.0e-18
WP_000675931.1|3111408_3111522_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3111742_3112276_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3112435_3112708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|3112963_3113170_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000023174.1|3113617_3115468_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000935546.1|3118198_3119248_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	6.8e-199
WP_000917750.1|3119398_3119596_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3119837_3120368_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_001217450.1|3120376_3120736_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	3.0e-37
WP_001265026.1|3120748_3121795_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	3.2e-108
WP_001417850.1|3121796_3122075_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001302544.1|3122015_3122201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|3122242_3122398_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_024248495.1|3122469_3123558_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
WP_001278454.1|3123744_3123849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|3123964_3124834_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|3124844_3125108_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|3125109_3125274_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_101972958.1|3125358_3125571_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	4.4e-33
WP_000403777.1|3125621_3125978_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_101972959.1|3125955_3126417_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266134.1|3126413_3126710_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001151153.1|3126706_3127129_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001262389.1|3127169_3128240_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693949.1|3128311_3128737_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|3128733_3128949_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103686.1|3128998_3129715_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000379580.1|3129987_3130140_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000394557.1|3130151_3130526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3131054_3131243_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3131239_3131431_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_101972960.1|3131523_3133995_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	5.0e-59
>prophage 11
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	3227345	3316039	5084741	portal,integrase,capsid,lysis,tRNA,tail,head,terminase,protease,plate	Salmonella_phage(57.63%)	93	3220308:3220323	3318984:3318999
3220308:3220323	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3227345_3228638_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3228728_3230072_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3230082_3230694_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|3230848_3234838_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3234972_3235467_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_053887426.1|3236011_3236992_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.6e-63
WP_001043578.1|3237098_3238865_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_101972962.1|3238865_3240587_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241676.1|3240628_3241333_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3241617_3241836_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3242872_3245149_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3245179_3245500_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3245822_3246047_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188140.1|3246119_3248066_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|3248062_3249178_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001380339.1|3249328_3250285_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599802.1|3250281_3251940_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3252364_3253060_+	aquaporin Z	NA	NA	NA	NA	NA
WP_001338421.1|3253554_3254454_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|3254597_3256250_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3256261_3257230_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3257362_3259081_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|3259117_3260119_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136577.1|3260129_3261560_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3261658_3262672_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255168.1|3262668_3263499_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3263495_3263819_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|3263944_3264460_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027213.1|3264677_3265406_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	4.6e-29
WP_000756569.1|3265423_3266155_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3266161_3266878_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3266877_3267546_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295339.1|3267836_3268568_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149767.1|3268766_3269894_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|3269934_3270423_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3270482_3271328_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093854.1|3271324_3272278_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|3272287_3273421_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126073.1|3273515_3274628_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3274978_3275455_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3275542_3276445_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|3276505_3277228_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3277211_3277499_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195225.1|3277658_3277916_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_000681108.1|3277945_3278323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3278592_3280278_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3280513_3280732_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_024220389.1|3280822_3281923_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	2.9e-176
WP_073535284.1|3281919_3282405_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_073535285.1|3282401_3285479_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_001513105.1|3285471_3285591_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.2e-13
WP_001281009.1|3285605_3285908_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3285962_3286478_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_033562314.1|3286487_3287660_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.3e-203
WP_033562313.1|3287802_3288369_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	2.2e-87
WP_130723473.1|3288396_3288810_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	35.6	1.3e-09
WP_089562725.1|3288811_3289252_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.4	1.1e-38
WP_089562726.1|3289223_3289826_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.9	5.0e-98
WP_094249485.1|3289825_3291325_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	83.8	4.0e-237
WP_064529899.1|3291321_3291927_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	2.6e-110
WP_089551267.1|3291919_3292828_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
WP_000177590.1|3292814_3293174_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_101972963.1|3293170_3293749_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	1.2e-93
WP_101972964.1|3293817_3294264_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_001039939.1|3294256_3294688_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_021578444.1|3294783_3295212_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.1e-46
WP_024235282.1|3295208_3295586_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	8.8e-16
WP_001341072.1|3295587_3296061_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|3296080_3296296_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3296299_3296503_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673520.1|3296502_3296967_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_001459609.1|3297062_3297713_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_000742511.1|3297716_3298775_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216237.1|3298791_3299625_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098431.1|3299767_3301534_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_101972965.1|3301533_3302559_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	1.3e-170
WP_001009569.1|3302611_3302929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135960113.1|3302928_3303579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000752436.1|3303584_3304280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029365156.1|3304672_3306565_-	NTPase KAP	NA	NA	NA	NA	NA
WP_001217575.1|3306879_3307113_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|3307123_3307312_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_029365157.1|3307465_3309880_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_101972966.1|3309876_3310734_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	8.6e-160
WP_000752613.1|3310730_3310958_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244165.1|3310957_3311191_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000963472.1|3311258_3311600_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_023150404.1|3311563_3311764_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	3.5e-32
WP_000460901.1|3311771_3312281_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_000188448.1|3312313_3312535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107902.1|3312630_3313227_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
WP_023150405.1|3313247_3314924_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
WP_000290938.1|3315007_3316039_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.9e-105
3318984:3318999	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 12
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	3372617	3444386	5084741	portal,integrase,holin,capsid,lysis,tail,head,terminase,transposase	Enterobacteria_phage(44.9%)	76	3382811:3382845	3445820:3445854
WP_000547191.1|3372617_3373946_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_101972972.1|3373744_3375949_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990183.1|3375990_3376668_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|3376741_3377008_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3377272_3377533_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443530.1|3377761_3378847_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|3378987_3379950_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|3379977_3382128_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145126.1|3382247_3382730_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
3382811:3382845	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_063502032.1|3382961_3384326_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|3384554_3385226_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_053887327.1|3385228_3386224_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_101972973.1|3386216_3387953_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|3387945_3389079_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|3389089_3390196_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3390157_3390568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113347.1|3390700_3391462_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650318.1|3391458_3392700_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045450.1|3392699_3393656_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446895.1|3393691_3394405_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373627.1|3394609_3395314_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852290.1|3395449_3395902_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|3395903_3396149_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3396141_3396627_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|3396629_3397142_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001340186.1|3397163_3398153_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|3398549_3399458_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|3399649_3401671_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044843.1|3402249_3402927_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246761.1|3402919_3403675_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118797.1|3403661_3404816_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_101972974.1|3404812_3405853_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_072024508.1|3405939_3407229_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	3.8e-18
WP_000767389.1|3407287_3407764_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_101972975.1|3408509_3409841_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_001657981.1|3409914_3410499_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
WP_101972976.1|3410498_3413846_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001619152.1|3413910_3414510_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.8e-109
WP_101972977.1|3414576_3418059_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.6	0.0e+00
WP_000090894.1|3418119_3418752_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	5.0e-96
WP_000194780.1|3418688_3419432_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_101972957.1|3419437_3420136_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.1e-133
WP_000847379.1|3420135_3420465_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_053900208.1|3420461_3423023_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.1	0.0e+00
WP_000459457.1|3423015_3423450_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_101972978.1|3423431_3423854_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	3.3e-72
WP_024198747.1|3423869_3424610_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.4	4.3e-131
WP_032316772.1|3424617_3425013_-	hypothetical protein	NA	A0A2R9YJI2	Escherichia_phage	98.5	1.9e-69
WP_000975081.1|3425009_3425588_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|3425599_3425953_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_077483093.1|3425964_3426360_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_049025584.1|3426401_3427427_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	5.8e-187
WP_101972979.1|3427482_3427815_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	4.2e-54
WP_000123305.1|3427824_3429144_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_101972980.1|3429124_3430726_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	7.2e-309
WP_000198149.1|3430722_3430929_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_097497873.1|3430925_3432851_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|3432825_3433371_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001663509.1|3433759_3433993_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|3434049_3434460_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001283921.1|3434746_3435004_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_095762192.1|3435000_3435327_-	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.0e-57
WP_095762191.1|3435245_3435497_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.3e-27
WP_001619137.1|3435701_3436139_-|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	95.9	3.0e-68
WP_001197767.1|3436135_3436612_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.5	1.9e-84
WP_001120502.1|3436615_3436951_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_095762190.1|3437027_3438080_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	97.7	7.0e-204
WP_032192725.1|3438229_3438424_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	93.8	3.7e-26
WP_095762509.1|3438998_3440081_+	porin	NA	Q1MVN1	Enterobacteria_phage	80.3	2.0e-166
WP_001204774.1|3440269_3440653_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	5.2e-56
WP_032270810.1|3440738_3440879_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	4.2e-08
WP_095762513.1|3440875_3441238_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000950954.1|3441257_3441452_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|3441444_3441786_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_085947970.1|3441951_3443164_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000533645.1|3443315_3444386_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
3445820:3445854	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 13
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	3907803	3969836	5084741	portal,integrase,holin,capsid,tail,head,terminase,plate,protease,transposase	Shigella_phage(54.84%)	74	3924543:3924589	3965934:3965980
WP_087899328.1|3907803_3909077_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_120795374.1|3909298_3909373_-	protein YahV	NA	NA	NA	NA	NA
WP_000131044.1|3909678_3911712_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3911840_3912428_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3912441_3913914_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159095.1|3913927_3915598_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3915810_3916479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3916721_3917417_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3917409_3918837_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3918847_3919567_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3920093_3920948_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|3921173_3922499_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
3924543:3924589	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_101973002.1|3925165_3926500_+	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	2.6e-06
WP_077890891.1|3926701_3928192_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_089578513.1|3928181_3928799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072644925.1|3929133_3929688_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.3	1.7e-87
WP_101973003.1|3929718_3930207_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	99.3	4.8e-83
WP_000368070.1|3930206_3930809_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	98.5	5.9e-107
WP_001045290.1|3930780_3931224_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.4	3.3e-22
WP_101973004.1|3931228_3931909_-	hypothetical protein	NA	U5P0I1	Shigella_phage	62.2	4.6e-63
WP_024228552.1|3931912_3932497_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_101973005.1|3932487_3933546_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.3	1.8e-199
WP_000424728.1|3933532_3933958_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_001259088.1|3933957_3934506_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_000999527.1|3934505_3935585_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	6.9e-207
WP_044722826.1|3935581_3936910_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	1.2e-245
WP_101973006.1|3936970_3938806_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	1.7e-306
WP_000661047.1|3938947_3939217_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|3939216_3939573_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_101973007.1|3939572_3941069_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	97.6	3.5e-273
WP_000497757.1|3941052_3941223_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000779279.1|3941231_3941792_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000213502.1|3941788_3942295_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_024234445.1|3942269_3942680_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	99.3	1.5e-74
WP_101973008.1|3942676_3943000_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.8e-55
WP_000601365.1|3943002_3943203_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000257507.1|3943251_3944457_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_001193631.1|3944471_3945122_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466255.1|3945099_3946341_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605613.1|3946340_3946523_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	96.7	1.1e-24
WP_143370350.1|3946534_3948031_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.2	6.3e-299
WP_000929175.1|3948264_3948759_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_101973009.1|3948884_3949235_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	96.6	7.5e-62
WP_001089762.1|3949385_3949721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063501624.1|3949821_3950391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356320.1|3950554_3950947_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.6	9.3e-53
WP_027661775.1|3950930_3951407_-	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	96.2	2.3e-85
WP_101973010.1|3951410_3951746_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	98.2	4.4e-59
WP_000799659.1|3951823_3952876_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.1	6.8e-207
WP_000917724.1|3953026_3953230_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001433853.1|3953490_3954519_+	hypothetical protein	NA	S5FNT5	Shigella_phage	57.6	3.3e-113
WP_000623433.1|3954526_3955102_+	hypothetical protein	NA	S5FXQ0	Shigella_phage	64.4	3.6e-61
WP_001205463.1|3955094_3955457_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.1	6.4e-56
WP_021530631.1|3955474_3956464_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	2.5e-195
WP_001061449.1|3956471_3957281_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.3	1.2e-150
WP_000767105.1|3957300_3957690_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_000210170.1|3957686_3958013_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_021576995.1|3958009_3958663_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	1.6e-126
WP_101973011.1|3958662_3959157_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	1.2e-86
WP_000104972.1|3959153_3960095_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	8.6e-153
WP_001250269.1|3960084_3960264_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_101973012.1|3960439_3960991_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.9	1.7e-100
WP_000649477.1|3961034_3961235_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3961325_3962000_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001083098.1|3962171_3962375_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	75.5	2.0e-14
WP_001514782.1|3962383_3962659_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_000008235.1|3963335_3963872_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|3963862_3964225_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3964224_3964530_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000433939.1|3964529_3964880_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051887.1|3964756_3965920_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893279.1|3966124_3967378_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	2.2e-95
3965934:3965980	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3967389_3968493_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3968780_3969836_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 14
NZ_CP024131	Escherichia coli strain 14EC007 chromosome, complete genome	5084741	4223732	4307270	5084741	portal,integrase,holin,capsid,tRNA,tail,lysis,head,terminase	Enterobacteria_phage(50.79%)	89	4244784:4244799	4314666:4314681
WP_001223181.1|4223732_4224419_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4224818_4224959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4225054_4225771_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920337.1|4225830_4227183_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219614.1|4227240_4228665_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188663.1|4228664_4229354_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|4229366_4229840_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4230050_4230920_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4230916_4231564_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001341279.1|4231615_4232137_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4232221_4232548_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409442.1|4232637_4234575_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4234785_4236453_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093813.1|4236759_4237992_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_001029698.1|4238012_4239395_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132956.1|4239443_4240412_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|4240517_4241162_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105851.1|4241189_4242206_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566141.1|4242237_4242501_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000224879.1|4242661_4243381_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_101973021.1|4243437_4244661_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|4244712_4246035_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
4244784:4244799	attL	TCACCGCTTTCGCCGC	NA	NA	NA	NA
WP_001295412.1|4246161_4246941_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143237.1|4247198_4248749_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_032200579.1|4248720_4249584_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563058.1|4249898_4250681_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001543400.1|4250677_4251751_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4251872_4252034_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4252160_4252766_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202563.1|4253158_4254745_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217539.1|4254964_4255213_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_015987614.1|4255320_4255893_-	cytolethal distending toxin type I subunit CdtC	NA	A5LH54	Enterobacteria_phage	100.0	2.8e-106
WP_000734593.1|4255889_4256711_-	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
WP_000358619.1|4256707_4257421_-	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_122995517.1|4257894_4257963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052931319.1|4258652_4259504_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	99.6	8.3e-155
WP_052931318.1|4259727_4260609_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	99.7	5.0e-163
WP_001023428.1|4260715_4260985_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
WP_101973022.1|4260986_4262300_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.0	3.4e-75
WP_021580692.1|4262364_4262964_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	5.0e-106
WP_096912371.1|4263031_4266427_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.5	0.0e+00
WP_052931387.1|4266487_4267090_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	9.5e-89
WP_064759399.1|4267026_4267770_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.0e-149
WP_052913732.1|4267774_4268473_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847401.1|4268472_4268802_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_101973023.1|4268798_4271360_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.4	0.0e+00
WP_032329097.1|4271352_4271778_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	8.3e-63
WP_032329098.1|4271759_4272182_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_032330267.1|4272197_4272938_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.7	4.0e-129
WP_032330264.1|4272945_4273341_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	96.9	4.2e-69
WP_032330265.1|4273337_4273916_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.1e-78
WP_101973024.1|4273927_4274281_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.8	6.9e-39
WP_000201526.1|4274273_4274648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522628.1|4274700_4275729_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	1.3e-114
WP_101973025.1|4275786_4276134_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_101973026.1|4276170_4277676_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_101973027.1|4277665_4279258_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	2.5e-184
WP_000258991.1|4279254_4279461_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_101972865.1|4279444_4281373_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_000235436.1|4281344_4281854_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001443307.1|4282248_4282443_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	3.3e-27
WP_000881324.1|4282630_4283248_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	1.5e-92
WP_032330226.1|4283397_4283835_-|lysis	lysis protein	lysis	K7P6J0	Enterobacteria_phage	95.2	1.8e-68
WP_059242542.1|4283831_4284365_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	97.2	7.4e-101
WP_001315200.1|4284470_4284743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101973076.1|4284708_4284909_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	65.5	1.8e-15
WP_101973028.1|4286161_4286365_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	83.1	5.7e-22
WP_001382056.1|4286369_4286585_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.0e-32
WP_101973029.1|4286806_4288657_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	93.7	0.0e+00
WP_052913711.1|4288821_4289871_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.1	2.8e-205
WP_000917724.1|4290021_4290225_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_052931289.1|4290477_4291230_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	5.3e-137
WP_064758716.1|4291243_4292233_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.6e-194
WP_052914030.1|4292240_4293050_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.3	1.4e-151
WP_032330024.1|4293455_4293782_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	97.2	2.9e-52
WP_072131177.1|4293781_4294276_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	98.8	5.6e-87
WP_000061525.1|4294272_4295091_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	1.2e-121
WP_000620696.1|4295087_4295312_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_052914027.1|4295308_4296457_-	peptidase	NA	A5LH69	Enterobacteria_phage	97.4	3.3e-207
WP_000526665.1|4296453_4297005_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_052914026.1|4296997_4297258_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	3.5e-40
WP_001020632.1|4297355_4298048_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135682.1|4298749_4299112_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_052931290.1|4299177_4300002_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	3.9e-149
WP_000008183.1|4300130_4300667_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242723.1|4300657_4301020_+	phage protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
WP_000206803.1|4301019_4301640_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_052913475.1|4302036_4305864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218277.1|4306046_4307270_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
4314666:4314681	attR	TCACCGCTTTCGCCGC	NA	NA	NA	NA
>prophage 1
NZ_CP024133	Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence	190293	59	54461	190293	protease,integrase,transposase	Escherichia_phage(26.67%)	39	6:65	39255:40564
6:65	attL	TGAACCGCCCCGGGAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085947970.1|59_1272_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001490748.1|1357_1672_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000770132.1|2254_4915_+	peptidase M66	NA	NA	NA	NA	NA
WP_001368871.1|4998_5874_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_013009342.1|5874_7845_+	variant type II secretion system secretin EtpD	NA	A7BJX1	Enterobacteria_phage	27.6	2.0e-26
WP_001418198.1|7841_9344_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173149.1|9345_10569_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231213.1|10599_11034_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082928.1|11030_11582_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001420206.1|11596_11944_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082784.1|11940_12540_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000842183.1|12536_13514_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071526091.1|13552_14725_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000998852.1|14711_15227_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000088802.1|15278_16112_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_001222320.1|16205_16607_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000083841.1|17717_17966_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001132900.1|19049_19301_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000222766.1|19297_19585_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	5.8e-20
WP_101973080.1|19861_21075_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.0	1.5e-165
WP_001045657.1|21701_25604_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	38.5	1.4e-220
WP_085949156.1|26060_27274_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_001312823.1|27457_27616_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001332050.1|28395_28785_-|protease	outer membrane protease	protease	NA	NA	NA	NA
WP_000280980.1|28888_29842_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_087899328.1|29979_31253_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_014640565.1|32386_32575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066954.1|32695_33436_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_000361611.1|33720_34698_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_101973083.1|38497_39283_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.4	2.7e-136
WP_085947970.1|39308_40521_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000949004.1|40949_41864_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
39255:40564	attR	TGAACCGCCCCGGGAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACTAAAAATACACGTTTTTCCCCCGAGGTCCGTCAACGGGCAGTTCGTATGGTTCTGGAAAGTCAGGGCGAATATGACTCTCAATGGGCGGCAATTTGTTCCATTGCCCCAAAGATTGGCTGTACACCAGAGACTCTGCGTGTGTGGGTTCGTCAGCATGAGCGGGATACCGGGAGTGGTGATGGTGGACTCACCACCGCTGAACGTCAGCGTCTGAAAGAGCTGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAATAATGCCGCTGCTGGATAAGCTGCGTGAGCAGTACGGGGTCGGACCGGTATGCAGTGAACTGCATATTGCCCCGTCAACGTATTACCACTGTCAGCAACAGCGACATCATCCTGATAAACGCAGTGCCCGTGCTCAGCGCGATGACTGGCTGAAGAGAGAGATACAGCGCGTATACGATGAAAATCATCAGGTGTACGGTGTGCGTAAAGTCTGGCGCCAGTTGTTACGCGAAGGTATCAGGGTGGCCAGATGTACAGTGGCGCGCCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCGGGGTAAAAAGGTCCGTACTACCGTCAGCCGGAAAGCCGTTTCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAGAACGTCCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCAGGGCTTCGTCTATGTGGCGTTCATCATTGATGTGTTTGCCGGATGTATCGTGGGGTGGCGAGTCTCATCGTCTATGGAAACGACATTCGTGCTGGATGCACTGGAGCAGGCGTTGTGGGCCCGTCGGCCGTCCGGCACAGTCCATCACAGTGATAAAGGTTCTCAGTATGTATCACTGGCCTATACGGAGCGACTAAAAGAAGCAAAACTGCTGGCATCAACAGGGAGTACAGGTGACTCGTATGACAACGCGATGGCGGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTCACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGGAAGGCTGGGTCATATCCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCAGAAACGATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAAACCGGGGCGGTTCA	NA	NA	NA	NA
WP_000983710.1|41863_42691_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000992806.1|42687_43545_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|43541_44399_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001238646.1|46947_48114_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000817028.1|48113_49085_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_000092896.1|53016_53229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082154.1|53489_54461_-|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
>prophage 2
NZ_CP024133	Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence	190293	103185	129623	190293	protease,integrase,transposase	Escherichia_phage(38.46%)	29	96137:96154	130586:130603
96137:96154	attL	GGCCGGTGAGCTGGGAAA	NA	NA	NA	NA
WP_000616800.1|103185_103839_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|103931_104189_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|104121_104523_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001262766.1|104807_106580_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000427620.1|107516_108521_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|108599_109034_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|109105_109456_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|109469_109745_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|109780_110203_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|110254_111949_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|111966_112329_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|112325_112562_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|112558_113266_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|113304_114609_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|114655_115360_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011264039.1|115432_115672_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|115817_116681_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|116718_116964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|117432_118224_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_032482493.1|119559_120531_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	38.1	2.4e-49
WP_001067858.1|121520_122225_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_074172008.1|122279_122510_+	umuDC operon-like protein	NA	I6S1S3	Salmonella_phage	58.8	1.3e-14
WP_000457559.1|122509_123781_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	4.9e-151
WP_006797589.1|123862_124840_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_000368714.1|124836_126042_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|126456_126726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|126902_127769_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|128531_128789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|128846_129623_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
130586:130603	attR	TTTCCCAGCTCACCGGCC	NA	NA	NA	NA
>prophage 3
NZ_CP024133	Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence	190293	140936	153400	190293	transposase	Enterobacteria_phage(28.57%)	10	NA	NA
WP_011251357.1|140936_144083_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	1.2e-60
WP_000758221.1|144169_144610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001398208.1|144707_147185_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000843496.1|147225_147423_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287499.1|147456_148194_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_000027057.1|148418_149279_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_014343468.1|149461_149935_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_001067858.1|149985_150690_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001516695.1|150961_151618_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_086525284.1|152695_153400_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
