The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024141	Escherichia coli strain 14EC029 chromosome, complete genome	4981062	1088606	1101789	4981062		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1088606_1089368_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1089361_1089988_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1090127_1091267_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1091329_1092322_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1092415_1093780_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1093868_1094645_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1094649_1095288_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1095284_1096547_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1096543_1097452_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1097647_1098415_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|1098465_1099122_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1099227_1101789_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP024141	Escherichia coli strain 14EC029 chromosome, complete genome	4981062	1181859	1188675	4981062		Enterobacteria_phage(100.0%)	9	NA	NA
WP_101968729.1|1181859_1184193_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|1184207_1184528_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_073527944.1|1184663_1185119_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244665.1|1185111_1185399_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_047088325.1|1185391_1185982_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	88.8	4.5e-59
WP_001149160.1|1185978_1186245_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283018.1|1186797_1187532_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	3.6e-130
WP_000638636.1|1187528_1188029_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446132.1|1188102_1188675_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
>prophage 3
NZ_CP024141	Escherichia coli strain 14EC029 chromosome, complete genome	4981062	1249623	1289700	4981062	integrase,tail,terminase,head,holin	Salmonella_phage(57.5%)	49	1249362:1249379	1291324:1291341
1249362:1249379	attL	TTCACACATATCACAATT	NA	NA	NA	NA
WP_042043893.1|1249623_1251021_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001291430.1|1251017_1251218_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077897296.1|1251214_1252609_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.1	1.6e-208
WP_001127518.1|1252682_1253480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312942.1|1253492_1253780_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	66.3	4.5e-28
WP_000065111.1|1253779_1253974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073488396.1|1254208_1254970_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_101968732.1|1255034_1257098_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.1	3.3e-274
WP_000551020.1|1257144_1257774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000769005.1|1257826_1258375_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_042106484.1|1258390_1259692_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.7	1.4e-132
WP_000051353.1|1259694_1260597_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_096852019.1|1261376_1262000_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	4.3e-36
WP_000170998.1|1262120_1262333_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_096852020.1|1262336_1264523_+	replication protein	NA	B6SCY1	Bacteriophage	72.7	1.4e-174
WP_089180304.1|1264812_1265235_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	4.0e-41
WP_001174014.1|1265266_1265608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781776.1|1266053_1266395_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194119.1|1266398_1266875_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000779566.1|1266858_1267383_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_000162796.1|1267444_1268017_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_101968733.1|1268019_1269642_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000113490.1|1269641_1271108_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
WP_158298094.1|1270998_1271733_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	85.6	4.0e-97
WP_021548388.1|1271747_1272968_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.8	2.6e-202
WP_101968735.1|1272971_1273478_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	78.7	9.2e-69
WP_000627472.1|1273489_1274431_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.8e-155
WP_001107515.1|1274472_1274694_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_096852025.1|1274659_1275067_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	93.3	1.4e-67
WP_096852026.1|1275063_1275618_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	70.7	3.0e-65
WP_096852027.1|1275604_1275994_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
WP_001298391.1|1275968_1276532_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_021572531.1|1276535_1277681_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	1.8e-160
WP_000109249.1|1277691_1278132_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393958.1|1278135_1278588_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.0	1.8e-55
WP_101968736.1|1278765_1280751_+	lytic transglycosylase catalytic	NA	A0A0M4REK7	Salmonella_phage	53.5	2.6e-175
WP_101968737.1|1280750_1281338_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	87.4	1.3e-82
WP_000155119.1|1281337_1281640_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_000081732.1|1281642_1282707_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	3.2e-156
WP_001551482.1|1282706_1283042_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	71.2	1.7e-23
WP_044190155.1|1283038_1283551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016233437.1|1283611_1284364_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	2.2e-87
WP_096851916.1|1284363_1284717_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	1.2e-54
WP_085445815.1|1284716_1285916_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	84.1	3.4e-186
WP_101968738.1|1285912_1286593_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	1.9e-101
WP_101968739.1|1286574_1287660_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	68.7	6.0e-57
WP_101968740.1|1287659_1288073_+|tail	phage tail protein	tail	U5P0S4	Shigella_phage	77.3	1.4e-22
WP_096851921.1|1288558_1289224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096851922.1|1289385_1289700_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	91.0	4.3e-40
1291324:1291341	attR	TTCACACATATCACAATT	NA	NA	NA	NA
>prophage 4
NZ_CP024141	Escherichia coli strain 14EC029 chromosome, complete genome	4981062	1758127	1767568	4981062		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569358.1|1758127_1759054_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1759058_1759790_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1759770_1759878_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1759937_1760669_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1760890_1762576_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1762572_1763292_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1763338_1763809_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1763848_1764310_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|1764434_1766435_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1766431_1767568_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 5
NZ_CP024141	Escherichia coli strain 14EC029 chromosome, complete genome	4981062	1923641	2014343	4981062	transposase,integrase,capsid,terminase,tail,head,holin,portal,protease	Escherichia_phage(45.1%)	88	1954254:1954269	1985535:1985550
WP_000255926.1|1923641_1924664_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	7.0e-201
WP_097506036.1|1924660_1925443_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	1.0e-138
WP_000349537.1|1925481_1925634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|1926371_1926974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313064.1|1927067_1927346_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000221530.1|1928799_1929369_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270975.1|1929628_1930030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221617.1|1930017_1930428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774528.1|1932742_1933741_-	phosphotriesterase-related protein	NA	NA	NA	NA	NA
WP_001066368.1|1934805_1935564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973176.1|1938845_1939391_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|1939387_1940131_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193786.1|1940142_1941222_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001310930.1|1941283_1942219_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011482.1|1942676_1943594_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011039.1|1943695_1944646_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122653965.1|1944763_1946407_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|1947033_1947750_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1948092_1949547_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378594.1|1949648_1950965_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480512.1|1951279_1952332_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_021548974.1|1952593_1959013_-	adhesin	NA	NA	NA	NA	NA
1954254:1954269	attL	GGCTCTGCACTGAATG	NA	NA	NA	NA
WP_001301431.1|1961063_1961861_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533615.1|1962096_1963122_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|1963121_1963325_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000102137.1|1963383_1965825_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.8	2.9e-112
WP_001070256.1|1965918_1966110_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|1966106_1966295_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296188.1|1966694_1966859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|1966862_1967081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001384640.1|1967240_1967396_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	3.4e-06
WP_000233320.1|1967693_1968113_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|1968192_1968447_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693850.1|1968443_1968869_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262376.1|1968940_1970017_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.5e-63
WP_001151223.1|1970057_1970468_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	1.2e-63
WP_042634476.1|1970537_1970894_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_000797277.1|1971018_1971201_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	92.6	6.1e-23
WP_001384637.1|1971197_1971389_+	hypothetical protein	NA	A0A0F6R8N3	Escherichia_coli_O157_typing_phage	93.7	3.3e-27
WP_000951709.1|1971390_1971606_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	97.2	5.7e-36
WP_001142589.1|1971607_1971826_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	88.9	5.2e-29
WP_000224213.1|1971827_1972091_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	1.5e-30
WP_000206831.1|1972101_1972446_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	92.1	7.4e-54
WP_000673136.1|1972645_1972936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018425.1|1974076_1974289_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	2.0e-17
WP_000737636.1|1974432_1974825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032173433.1|1975121_1975400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015675170.1|1975401_1976451_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.1e-107
WP_001217424.1|1976463_1976823_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_001064900.1|1976819_1977509_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	5.8e-58
WP_001384627.1|1978670_1979063_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	90.0	3.4e-55
WP_000950569.1|1979052_1979328_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	7.2e-44
WP_000014549.1|1979330_1979708_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	98.4	1.3e-64
WP_134267542.1|1979722_1979902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042634360.1|1980140_1980350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140107.1|1980771_1981122_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	6.2e-64
WP_001317918.1|1981270_1981753_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_021562585.1|1981752_1983510_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_000478567.1|1983521_1983704_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_000466247.1|1983703_1984945_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_001193631.1|1984922_1985573_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
1985535:1985550	attR	GGCTCTGCACTGAATG	NA	NA	NA	NA
WP_000257489.1|1985587_1986793_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_032191505.1|1986844_1987033_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	98.4	2.7e-26
WP_001605322.1|1987044_1987350_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	80.2	1.7e-38
WP_001605323.1|1987358_1987697_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	98.2	3.5e-56
WP_032159263.1|1987693_1988143_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001605325.1|1988139_1988484_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	99.1	1.2e-56
WP_001605326.1|1988544_1989249_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	94.9	2.8e-116
WP_001312914.1|1989248_1989635_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_077763502.1|1989676_1989937_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	3.5e-40
WP_042634620.1|1989982_1993210_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
WP_040079256.1|1993187_1993544_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	1.4e-39
WP_001152456.1|1993543_1994242_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_001423886.1|1994246_1994990_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.1	6.4e-143
WP_012311734.1|1994887_1995535_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_000515626.1|1995595_1998991_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.9	0.0e+00
WP_001230299.1|1999059_1999659_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.0	4.8e-109
WP_000268786.1|1999723_2002999_+	hypothetical protein	NA	K7PGT9	Enterobacteria_phage	71.0	4.6e-302
WP_074152286.1|2003053_2003179_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	87.5	2.3e-13
WP_001079074.1|2004668_2005199_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001007805.1|2005541_2006192_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240091.1|2006448_2007084_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740107.1|2007084_2008089_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920120.1|2008197_2008611_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|2008743_2009415_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826790.1|2009414_2010773_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	2.3e-05
WP_000218212.1|2010870_2011722_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_001254951.1|2013191_2014343_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	1.5e-42
>prophage 6
NZ_CP024141	Escherichia coli strain 14EC029 chromosome, complete genome	4981062	2390998	2449292	4981062	transposase,capsid,lysis,tail,terminase,head,portal	Enterobacteria_phage(35.85%)	76	NA	NA
WP_000041558.1|2390998_2393425_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001307224.1|2393623_2393929_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2394036_2394747_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2394749_2395310_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2395344_2395686_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2395820_2396147_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2396352_2397567_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2397578_2398598_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|2398655_2398766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158298096.1|2398785_2400066_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	61.8	3.6e-154
WP_001296941.1|2400100_2400337_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048342.1|2400424_2402896_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|2402988_2403180_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2403176_2403365_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001329848.1|2403764_2403929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2403932_2404151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2404310_2404466_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2404632_2405040_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2405123_2405354_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705358.1|2405337_2405859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054512.1|2405839_2406805_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_001151262.1|2406845_2407268_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|2407264_2407621_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_000955178.1|2408927_2409110_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589005.1|2409287_2410601_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|2411037_2411370_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2411572_2411878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2411902_2412142_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2412141_2412429_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2412500_2412656_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2412872_2413124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2413190_2413469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2413470_2414520_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2414533_2415286_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_158298097.1|2415563_2415653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|2415707_2415920_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2416220_2416436_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2417189_2417405_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2417409_2417721_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2417717_2418251_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2418247_2418745_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2419107_2419320_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2419330_2419519_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2419521_2419587_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2419666_2419822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2419993_2420167_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2420318_2420729_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2420786_2421020_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453576.1|2421408_2421954_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027321.1|2421928_2423854_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|2423850_2424057_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001345555.1|2424053_2425655_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000123242.1|2425635_2426955_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	4.0e-233
WP_001358225.1|2426964_2427297_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_101968779.1|2427352_2428378_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	3.1e-188
WP_000158875.1|2428419_2428815_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|2428826_2429180_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|2429191_2429770_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|2429766_2430162_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001317730.1|2430169_2430910_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000479193.1|2430925_2431348_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|2431329_2431764_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_053292699.1|2431756_2434318_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.1	0.0e+00
WP_000847351.1|2434314_2434644_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.8e-57
WP_001152612.1|2434643_2435342_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_001484131.1|2435347_2436091_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	4.4e-144
WP_000090849.1|2436027_2436630_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	1.6e-88
WP_021535035.1|2436690_2440170_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_053292719.1|2440237_2440837_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	2.3e-103
WP_089570685.1|2440901_2443862_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.6	1.4e-52
WP_000885616.1|2443861_2444437_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|2444534_2445125_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|2445441_2445675_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2445743_2445857_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2446459_2447743_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527758.1|2447831_2449292_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
>prophage 7
NZ_CP024141	Escherichia coli strain 14EC029 chromosome, complete genome	4981062	2689616	2745342	4981062	transposase,integrase,lysis,terminase,tail,tRNA	Escherichia_phage(51.06%)	58	2708529:2708545	2750943:2750959
WP_101968795.1|2689616_2692913_-|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	71.4	1.1e-298
WP_001233115.1|2692977_2693577_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.0	3.5e-107
WP_101968796.1|2693645_2697125_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_158298098.1|2697185_2697788_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_001484131.1|2697724_2698468_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	4.4e-144
WP_101968798.1|2698473_2699172_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	7.8e-127
WP_000024051.1|2699171_2699510_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_101968799.1|2699502_2702736_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.3	3.9e-104
WP_012565075.1|2703207_2703567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2703717_2704680_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000673077.1|2704706_2705099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029819.1|2705095_2705476_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_000524260.1|2705476_2705860_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|2705859_2706255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918487.1|2706477_2707617_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_101968800.1|2707715_2708480_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	1.5e-83
2708529:2708545	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_101968801.1|2708584_2709697_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000763702.1|2709680_2711087_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_077767011.1|2711089_2711623_-|terminase	terminase	terminase	A0A2P1MXD8	Escherichia_phage	61.5	1.0e-57
WP_000547191.1|2711734_2713063_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_101968898.1|2713073_2713784_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	67.4	6.8e-94
WP_000089450.1|2713809_2714904_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	1.0e-112
WP_000126788.1|2714907_2715117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204035.1|2715094_2716027_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_001291093.1|2716019_2716811_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_024165216.1|2716948_2718406_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2718602_2718788_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_101968802.1|2719004_2719538_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	95.5	1.4e-99
WP_000370551.1|2719643_2719916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193293.1|2719881_2720226_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000839596.1|2720230_2720446_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_101968803.1|2721742_2722285_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	73.4	5.4e-75
WP_000228032.1|2722281_2722572_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000940314.1|2722571_2723171_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	5.9e-107
WP_101968804.1|2725716_2727069_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	31.0	8.6e-21
WP_158298099.1|2727816_2728578_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	4.7e-117
WP_101968806.1|2728600_2729347_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.0	7.1e-110
WP_101968807.1|2729353_2730160_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	95.8	3.7e-72
WP_000010975.1|2730239_2730491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101968808.1|2730491_2730788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101968809.1|2730800_2731223_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	3.8e-68
WP_000712069.1|2731245_2731542_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2731665_2732142_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|2732594_2732750_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000887753.1|2732746_2733235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560220.1|2733675_2733897_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_101968899.1|2733896_2734067_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	4.3e-23
WP_101968811.1|2734141_2734417_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	91.2	2.4e-39
WP_101968812.1|2734518_2737119_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.5e-250
WP_000166319.1|2737111_2737921_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2737977_2738172_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2738164_2738374_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2738452_2738668_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2738669_2739905_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157405.1|2739956_2740892_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123745.1|2741020_2742394_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387395.1|2742871_2743855_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|2744109_2745342_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2750943:2750959	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 8
NZ_CP024141	Escherichia coli strain 14EC029 chromosome, complete genome	4981062	3191719	3279519	4981062	transposase,integrase,plate,capsid,lysis,tail,terminase,head,tRNA,portal,protease	Salmonella_phage(60.0%)	92	3257098:3257114	3282815:3282831
WP_000886683.1|3191719_3193012_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3193102_3194446_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3194456_3195068_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077063.1|3195222_3199329_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3199463_3199958_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3200501_3201467_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043619.1|3201589_3203356_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|3203356_3205078_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3205119_3205824_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3206108_3206327_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3207011_3209288_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3209318_3209639_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3209961_3210186_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|3210258_3212205_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746468.1|3212201_3213317_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|3213467_3214424_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|3214420_3216079_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001297311.1|3216504_3217200_+	aquaporin Z	NA	NA	NA	NA	NA
WP_012478345.1|3217571_3218546_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000491142.1|3218766_3219666_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3219809_3221462_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3221473_3222442_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3222574_3224293_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|3224329_3225331_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3225341_3226772_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3226870_3227884_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|3227880_3228711_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3228707_3229031_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270738.1|3229156_3229672_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3229889_3230618_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3230635_3231367_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3231373_3232090_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3232089_3232758_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3233049_3233781_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149732.1|3233955_3235083_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3235123_3235612_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3235671_3236517_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093864.1|3236513_3237467_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000995994.1|3237476_3238610_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000126053.1|3238704_3239817_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3240167_3240644_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3240731_3241634_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|3241694_3242417_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3242400_3242688_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3242847_3243105_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3243134_3243512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3243781_3245467_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3245702_3245921_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011783.1|3246011_3247112_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	4.9e-176
WP_000980388.1|3247108_3247594_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_101968825.1|3247590_3250668_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.4	0.0e+00
WP_000763311.1|3250660_3250780_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3250794_3251097_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207656.1|3251151_3251667_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_000046128.1|3251676_3252849_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	1.0e-203
WP_000994389.1|3252955_3253369_-|tail	tail assembly chaperone	tail	U5P0S4	Shigella_phage	74.3	1.5e-21
WP_101968826.1|3253368_3255288_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	47.4	8.0e-81
WP_001086820.1|3255284_3255890_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_000268315.1|3255882_3256791_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.4	2.2e-145
WP_000177571.1|3256777_3257137_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	2.5e-52
3257098:3257114	attL	CTTTACCGTTGGTATTG	NA	NA	NA	NA
WP_029487414.1|3257133_3257712_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	89.6	9.1e-97
WP_029487415.1|3257804_3258557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029487416.1|3258593_3259046_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.4	5.7e-62
WP_029487417.1|3259038_3259470_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.4e-70
WP_101968828.1|3259565_3259994_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	86.5	9.9e-56
WP_029487419.1|3259990_3260506_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.2	9.0e-88
WP_000171568.1|3260486_3260702_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868192.1|3260705_3260909_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_101968829.1|3260908_3261373_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	3.2e-76
WP_101968830.1|3261468_3262119_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	3.6e-110
WP_000742510.1|3262122_3263181_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000216241.1|3263197_3264031_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.5	4.5e-121
WP_001098431.1|3264173_3265940_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_063104905.1|3265939_3266971_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.7e-171
WP_029487422.1|3267050_3267566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029487423.1|3267562_3268210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087749150.1|3268218_3268914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3269251_3269485_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3269495_3269684_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_101968831.1|3269836_3272251_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_101968832.1|3272247_3273105_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.1	2.1e-158
WP_101968833.1|3273101_3273329_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	96.0	2.5e-34
WP_101968834.1|3273328_3273562_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	62.3	1.6e-15
WP_101968835.1|3273629_3273971_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	8.7e-55
WP_096252247.1|3274190_3274649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074169900.1|3274596_3274830_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	86.1	5.2e-11
WP_000460903.1|3274837_3275347_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	97.0	4.9e-86
WP_000187760.1|3275379_3275601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009713.1|3275725_3276619_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	45.5	1.9e-40
WP_000904327.1|3276627_3277827_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_074422575.1|3277823_3278375_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_101968836.1|3278466_3279519_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	8.0e-107
3282815:3282831	attR	CAATACCAACGGTAAAG	NA	NA	NA	NA
>prophage 9
NZ_CP024141	Escherichia coli strain 14EC029 chromosome, complete genome	4981062	3849834	3898535	4981062	integrase,capsid,transposase,plate	Enterobacteria_phage(33.33%)	43	3849730:3849749	3861821:3861840
3849730:3849749	attL	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_021537487.1|3849834_3851169_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_101968860.1|3851250_3851964_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	63.9	7.1e-67
WP_101968861.1|3851998_3853831_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.2	1.9e-31
WP_000452041.1|3853845_3854049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101968862.1|3854135_3855164_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_101968863.1|3855182_3855545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000898166.1|3855541_3855754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101968864.1|3856097_3856433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129161.1|3856434_3856845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097712930.1|3856974_3857250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101968865.1|3857261_3857954_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_101968866.1|3858192_3858381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000893260.1|3862011_3863265_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
3861821:3861840	attR	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_001285288.1|3863276_3864380_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3864667_3865723_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174677.1|3865761_3866163_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189539.1|3866220_3867465_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291992.1|3867556_3868015_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|3868275_3869733_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001295202.1|3870089_3870356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059874.1|3870662_3871115_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226155.1|3871111_3872167_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001368474.1|3872237_3873008_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001323598.1|3872967_3874707_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006256.1|3875024_3875522_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000009291.1|3875697_3876456_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	2.6e-19
WP_001225679.1|3876747_3877488_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3877458_3878226_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3878431_3879010_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973093.1|3879249_3881694_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|3881736_3882210_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118055.1|3882363_3883134_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000978828.1|3884572_3885022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000509090.1|3885033_3889287_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
WP_000535386.1|3889362_3889848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101968868.1|3889857_3891504_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.3e-26
WP_001142958.1|3891713_3892232_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037395.1|3892929_3893430_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3893464_3893689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101968869.1|3893739_3895215_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611741.1|3895221_3895635_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|3895638_3897489_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3897452_3898535_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 1
NZ_CP024142	Escherichia coli strain 14EC029 plasmid p14EC029a, complete sequence	66596	2118	57097	66596	transposase,integrase	Saccharomonospora_phage(15.38%)	57	21749:21808	57125:58195
WP_101968902.1|2118_2559_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.6	1.0e-31
WP_072210467.1|2578_3808_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	95.4	9.7e-189
WP_000673428.1|4374_4668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151456.1|5238_5481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230709.1|5477_5732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001083904.1|5728_6271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001025393.1|6374_6890_-	J domain-containing protein	NA	A0A0G2YAM9	Acanthamoeba_polyphaga_mimivirus	40.6	7.3e-05
WP_000855119.1|7293_7623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532148.1|8210_8876_+	P-loop NTPase	NA	A0A0A8IL09	Aurantimonas_phage	31.3	5.0e-06
WP_000186151.1|9063_9234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356710.1|9251_9824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775236.1|9997_10159_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_072210467.1|10880_12110_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	95.4	9.7e-189
WP_101968902.1|12129_12570_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.6	1.0e-31
WP_001481829.1|12953_13136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833470.1|13693_13876_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000466318.1|13900_14338_+	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	34.7	9.5e-14
WP_063078684.1|14468_14795_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	90.3	2.4e-25
WP_089569054.1|14814_15546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000797966.1|15523_16276_-	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_021575837.1|16293_16695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000730722.1|17062_17404_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_034169409.1|17400_21714_+	hypothetical protein	NA	NA	NA	NA	NA
21749:21808	attL	AGCTGAATTTACAATCCAAGTGCAACAAAAAAAGAAGTACTCATCAACTAGAATATAATT	NA	NA	NA	NA
WP_012478345.1|21835_22810_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_049589868.1|23005_24631_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_063101822.1|24702_25449_+	PAP2 family protein	NA	NA	NA	NA	NA
WP_000666084.1|25429_25870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000850854.1|26215_26422_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_063078686.1|26490_28656_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	26.6	3.5e-32
WP_001303470.1|28660_29236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000289347.1|29405_31082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000698398.1|31176_31692_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.1	2.0e-18
WP_034169411.1|31738_32164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000486716.1|32403_33528_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	40.1	3.0e-43
WP_001356717.1|33850_34048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000934977.1|35776_36412_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_001258095.1|36415_36898_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000095048.1|36963_37521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974903.1|37565_38675_-	type II secretion protein F	NA	NA	NA	NA	NA
WP_000466225.1|38665_40204_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_000912553.1|40228_40723_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_000454142.1|40706_42029_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_001035592.1|42067_43711_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_001220543.1|43703_44240_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_015059539.1|44286_46245_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_001059977.1|46260_47316_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_000790640.1|47334_48474_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000274524.1|48463_49165_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000432282.1|49230_49965_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000548955.1|50130_52488_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000362080.1|52493_52814_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_020314919.1|52884_53025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177113.1|53174_53759_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_001153665.1|53779_54178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000539665.1|54296_54734_-	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_015059538.1|54739_55975_-	IncI1 plasmid conjugative transfer protein PilL	NA	NA	NA	NA	NA
WP_012478345.1|56122_57097_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
57125:58195	attR	AATTATATTCTAGTTGATGAGTACTTCTTTTTTTGTTGCACTTGGATTGTAAATTCAGCTGATATTAAAGAAGTCCTTTTCGGCGCTTTTGCATTCGCTCCCGCCGCCGCTACCGATAGCTTTACCGTACAGACAAAGAACGGAAGCACACGGATCAGACGCATATACGGGGGCAGTGAGTGCGATAGCACTTGCGGCAACCATCGATAAAATGATGGATTTCATGGTGTTCCTCCATATTTCAGGCAAAAGAAAACCCGCACGAGGCGGGTTACTTGACAGGTTTAAAATATCAGCGGGTATCTGCCATGTGATAGACGTCGCTGCCTTCTCTTTTTCCCACAGAAATCACAAGCAAAACGACCTTCTCATCAATTACCTGATAAACGAGCCTGTAACCGGATGCGCGAAGCTTAATTTTGTAACGGTCAGTATGACCATGTAGCTTGGCTGCGGGGACGCGTGGATTTATCAGGCGTTCTGACAGTTTCTTTTTGAATTGCTCACGAACAGTGTGACCGAGTTTTTGCCATTCCTTCAGTGCTCTGTGGTCAAATGCCAGTTCATAAATCATCCAGGTTAACCCTTACAATGTCTGGATTTTTCATTCTTTCATCAGCAATTGCGTTGAGTTCAGCGTCTTCAGCGAGTTCCCGGTAGTAGGCATAAAGTTCTGGTGGGACACAGTAGAACGCTGGTTCATTTCGGTTCAGGATTGCGACGGCATCCCCTTCTCCTTCGGCTACAGTTCCCATAGGATTTTTTTTCAGGTCAGTAATACTGGCTGCTGTCGTAGTCAGAATTTGGTAGCTCATAAGTCCTCCATTTGTATCATGGAGATTGTAGCACCTTAAAAAGACTTTTAAAGGTGCTTTTGATTGTGGGGAACGACAAAAATGATCCGGGGTTGGGAATCAACGCACGTGTGGCGTAATGATGACAATCCGGTTCTCACTTTGGCTATCAGCATTAACTCCAGTAAAACCACTCACGATAAGGGGCTGGTCCGGTTTGAGTAAAATATTCTGCTTGACAGTCAGTTTCCGTATCGGGTCAGTGGTTGTGAGTAGC	NA	NA	NA	NA
>prophage 1
NZ_CP024143	Escherichia coli strain 14EC029 plasmid p14EC029b, complete sequence	254423	57807	97358	254423	transposase,integrase,protease	Escherichia_phage(30.77%)	43	52756:52769	62666:62679
52756:52769	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_012478345.1|57807_58782_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_001424615.1|58956_59160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795947.1|59181_60357_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|60527_60740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|61100_62183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|62349_63849_-	kinase	NA	NA	NA	NA	NA
62666:62679	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|63874_65512_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|65511_66552_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|66637_67276_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|67275_67917_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|67939_68578_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|69040_69508_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|69525_70734_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_101968905.1|70744_71701_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042634304.1|71700_72780_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|72781_73555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|73547_74690_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|74699_75758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|76081_76663_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|76662_77820_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|77842_78298_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_062914744.1|78320_79361_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|79409_79988_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|80055_80631_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|81059_82301_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|82863_83145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|83194_83386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|83477_83849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|84191_84584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|85187_85481_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|85485_86811_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|86871_87078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|87179_87590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053276223.1|87602_88418_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_001043843.1|88671_89097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|89645_89954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|89969_90827_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_152921942.1|91675_92143_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	47.2	4.9e-08
WP_063120614.1|92800_93934_-	permease	NA	NA	NA	NA	NA
WP_001175593.1|94039_94363_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|94905_95610_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067858.1|95721_96426_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389365.1|96593_97358_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 2
NZ_CP024143	Escherichia coli strain 14EC029 plasmid p14EC029b, complete sequence	254423	100696	158208	254423	transposase,integrase	Escherichia_phage(33.33%)	56	94843:94902	169008:169829
94843:94902	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|100696_101401_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000105383.1|101667_103104_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000427623.1|103521_104526_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032193599.1|105098_105803_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067858.1|105832_106537_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_152921935.1|106548_106704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|107346_108165_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|108161_109367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|109646_110966_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833382.1|111216_112644_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|112858_113374_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|113376_114273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|114494_114728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|115389_115620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|115956_116418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|116447_116855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|116905_117223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|117599_117950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|119639_120344_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001617865.1|120646_121522_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_014839980.1|122133_122550_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|122554_123073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071448054.1|123072_123819_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|123824_124529_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|124642_125419_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000602738.1|126969_127722_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|129532_130018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|130214_131305_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|131394_132210_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|132296_132599_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|132492_132744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|132774_134268_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|134379_134685_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214121.1|134712_135927_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001447541.1|136143_137028_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|137952_138657_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_065800308.1|138741_139131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|139395_140400_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_015344976.1|140478_143430_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|143432_143993_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_081316080.1|144118_144703_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|144671_145685_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|145829_146327_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|146438_146729_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|146734_147526_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|147787_149047_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|149139_149931_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|150100_150433_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000034420.1|151612_152404_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|152871_153117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|153154_154018_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001067855.1|154248_154953_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|155103_155919_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|156108_156813_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|157037_157241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|157368_158208_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
169008:169829	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCAACGTAACCATGAGTGATGTTTCAATCCCGTTCAGGAAGCTCGTACAGGCCGGTATCCATAGTTCGTGATGCAACGCCTCGGTTGCTTGTTTAAAGAACCAGTCAATCACGGGGACAGTGTGATAATCATAATAGTGATTTATCTCGCTGAATCTTGACATATAAGCATCGTACTCAGCCTGGTCTTCAGGAGATAAAAAATTTGGTGGGAGGGGCATCAGAATCCTTTCATCCTAGCTTGTATACCTTCTTCGTAGGCCAGCTCGCCATTATCGGTAAAAGATGGTTTTTGGTGTTTGTGACAAAGCTTAATTTTTCGTCAGGCTCGATAGCGTTACCGGAGAGATTTGATCTTTTCTCTGTAACTCGCAATACTGTTTATACATACAGTATGAGAATTCGAGTGTAGCTATGTCTGTTATCCTTGAGCACATTAGCAACAAGCCTTACGAAATGGCACCTTTTTTCAGTGATTTACTGAGCTGTGGAGTGATGAGTCCGTGCGCCGGGCATGAAGATAATGAATTAAATTTGCATGAATATGTAGTCCGTAACCGCCCCTCAACCTTCTTTGTCAGGGCGGCGGGCCTCAGTATGATCAATGCCGGTATCAATGATGGCGCTATTCTGGTTGTGGATCGGTCTTTAACGGCACGACACGGCTCTATCGTCGTTGCGCTGGTGGATGGAGAGTTCACGGTAAAGATCTTACACACGTATCCTGAGCTGCTTTTGATGCCTTCTAATCCAGCCTATAAGCCG	NA	NA	NA	NA
>prophage 1
NZ_CP024144	Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence	96973	18387	66332	96973	integrase,transposase	Escherichia_phage(43.75%)	46	36112:36128	71171:71187
WP_000844627.1|18387_18630_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067855.1|19566_20271_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_101968908.1|20377_20968_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|21104_21677_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_001493761.1|21713_23105_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001516695.1|23884_24541_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067855.1|26647_27352_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001083725.1|28554_29052_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|29163_29454_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|29459_30251_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|30512_31772_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|31864_32656_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|32825_33158_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000034420.1|34337_35129_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|35597_35843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|35880_36744_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
36112:36128	attL	CAGCTCATCGCGCAGTG	NA	NA	NA	NA
WP_032492336.1|36889_38119_-	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_001067855.1|38568_39273_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|39423_40239_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067834.1|40428_41133_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000935452.1|41179_42484_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_101968909.1|42522_43230_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|43226_43463_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|43459_43822_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|43839_45534_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|45585_46008_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|46043_46319_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|46332_46683_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|46754_47189_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|47235_47940_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_061602529.1|47986_48259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|48554_48785_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|48781_49198_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000343085.1|51850_52108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194575.1|52107_52698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818556.1|52960_54517_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000521603.1|54708_55326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058650130.1|55618_56752_-	permease	NA	NA	NA	NA	NA
WP_001175593.1|56857_57181_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057102336.1|57281_57992_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	2.1e-95
WP_001067858.1|60430_61135_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063107378.1|61193_61472_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_001452736.1|61507_61819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084745.1|63573_63966_+	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_063102497.1|65062_65449_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_101968911.1|65642_66332_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.4	2.2e-89
71171:71187	attR	CACTGCGCGATGAGCTG	NA	NA	NA	NA
>prophage 1
NZ_CP024146	Escherichia coli strain 14EC029 plasmid p14EC029e, complete sequence	88553	79296	88228	88553	transposase	Stx2-converting_phage(44.44%)	10	NA	NA
WP_001760842.1|79296_79644_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.3e-45
WP_101968936.1|79663_81235_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_001610319.1|81418_81979_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704522.1|82081_82942_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_101968937.1|83000_83708_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	1.8e-09
WP_001760842.1|85359_85707_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.3e-45
WP_096101123.1|85706_86384_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_101968938.1|86433_87546_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.9	1.7e-123
WP_000109071.1|87545_87983_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618111.1|87979_88228_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	49.3	1.1e-14
