The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	55432	128813	4914884	transposase	Stx2-converting_phage(27.27%)	56	NA	NA
WP_101980449.1|55432_56706_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	2.8e-175
WP_000792543.1|56854_58903_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
WP_025492107.1|61463_61655_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_001126822.1|62633_63200_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000991576.1|63457_64030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958152.1|64098_64335_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_065793218.1|64600_65149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016244154.1|65167_65647_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	42.5	3.5e-09
WP_016244155.1|66546_66981_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_016243920.1|69446_70331_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_001283626.1|71570_72092_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|72088_73042_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188254.1|73128_75453_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879160.1|75497_76400_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125181.1|76396_77395_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|77391_78348_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|78348_79116_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|79673_79931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|80928_82080_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000623562.1|84066_84414_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	4.4e-46
WP_000993926.1|84413_85064_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	42.7	3.4e-15
WP_000948757.1|85355_86720_-	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
WP_001317576.1|87118_88336_+	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
WP_000790444.1|88332_90342_+	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
WP_000952905.1|90331_91579_+	two-component system response regulator PgtA	NA	NA	NA	NA	NA
WP_073506891.1|91707_92235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147588.1|92252_92501_-	hypothetical protein	NA	Q2A0A1	Sodalis_phage	39.1	6.4e-07
WP_001366542.1|92569_92761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018808.1|93356_94376_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	4.3e-17
WP_001317566.1|94633_95077_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_000699820.1|95155_95428_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000470229.1|95450_96839_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001101067.1|96835_97666_+	transketolase	NA	NA	NA	NA	NA
WP_000609007.1|97658_98612_+	transketolase family protein	NA	NA	NA	NA	NA
WP_131501864.1|98874_98988_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_101980450.1|99838_100999_+	immunoglobulin-binding protein	NA	Q9MCI8	Enterobacteria_phage	76.1	4.8e-20
WP_000884153.1|101060_101516_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000760915.1|101872_102211_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000859647.1|102715_103405_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001016257.1|104953_105700_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|105714_107256_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_101980451.1|107370_107586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001293447.1|107712_108537_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000551919.1|108693_110037_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_085947917.1|110156_111430_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000803221.1|112867_114184_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_089581225.1|114354_114540_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_001313273.1|114548_114656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001313270.1|116527_118498_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000977396.1|118516_119308_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001171523.1|119887_120268_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612556.1|120264_120612_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001593684.1|120707_122300_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.9e-181
WP_000624717.1|122330_122681_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
WP_000422741.1|122677_123103_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001360336.1|125315_128813_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
>prophage 2
NZ_CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	1155681	1162821	4914884		Escherichia_phage(83.33%)	6	NA	NA
WP_001278992.1|1155681_1156320_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
WP_000590398.1|1156316_1157579_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000848000.1|1157575_1158484_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001318002.1|1158679_1159447_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	7.4e-70
WP_001141285.1|1159497_1160154_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	4.3e-50
WP_001272914.1|1160259_1162821_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	7.8e-31
>prophage 3
NZ_CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	1526282	1571441	4914884	terminase,holin,tRNA,tail,capsid,plate,portal,integrase,head	Enterobacteria_phage(90.7%)	56	1563355:1563368	1568272:1568285
WP_000683541.1|1526282_1528289_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1528447_1529668_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127769.1|1529932_1531111_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|1531107_1532103_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_021573463.1|1532360_1533254_-	type VI secretion-associated protein	NA	NA	NA	NA	NA
WP_021573462.1|1533258_1533591_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_032192010.1|1534103_1534931_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_000078916.1|1535346_1535487_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001383550.1|1535677_1535938_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032192009.1|1535980_1537090_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.8	5.3e-194
WP_000005384.1|1537247_1538432_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	4.7e-225
WP_000290462.1|1538431_1538944_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000665314.1|1538998_1539364_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333494.1|1539372_1539528_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_101980474.1|1539514_1542322_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.4	0.0e+00
WP_032192002.1|1542334_1542823_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	97.5	5.2e-85
WP_001447286.1|1543011_1543557_+	transferase	NA	NA	NA	NA	NA
WP_032192000.1|1543520_1544138_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	6.6e-85
WP_101980475.1|1544137_1546138_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	98.6	1.8e-112
WP_021293091.1|1546140_1546671_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_001111955.1|1546663_1547560_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
WP_000213447.1|1547563_1547914_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_097753605.1|1547910_1548492_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	7.3e-102
WP_097753606.1|1548488_1549124_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	97.6	2.9e-112
WP_101980476.1|1549116_1549584_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	1.3e-85
WP_097753608.1|1549721_1550129_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.1	4.6e-63
WP_000072332.1|1550125_1550518_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000104350.1|1550514_1550838_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1550840_1551041_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_101980477.1|1551040_1551535_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	4.6e-89
WP_101980478.1|1551637_1552438_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	4.2e-124
WP_101980479.1|1552483_1553536_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	96.9	2.1e-192
WP_001262657.1|1553559_1554396_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	3.0e-149
WP_101980480.1|1554550_1556302_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_000087812.1|1556301_1557348_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000711112.1|1557874_1558405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000036161.1|1558495_1558879_-	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	57.9	2.6e-31
WP_000211245.1|1558942_1559254_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	2.2e-49
WP_000686519.1|1559258_1560218_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	100.0	2.0e-181
WP_158298169.1|1560294_1563117_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.5	0.0e+00
WP_000599390.1|1563123_1563489_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
1563355:1563368	attL	AATAACAATTTTTC	NA	NA	NA	NA
WP_158298170.1|1563485_1564103_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_053881937.1|1564114_1564414_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.8	1.8e-40
WP_101980482.1|1564410_1564656_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	97.5	1.3e-39
WP_000985161.1|1564652_1564856_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000021652.1|1564942_1565056_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000514277.1|1565052_1565295_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_101980483.1|1565306_1565594_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.9e-32
WP_000813363.1|1565604_1565946_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000200501.1|1566198_1566405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004249.1|1566411_1566699_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_001390705.1|1566812_1567133_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000023402.1|1567229_1568234_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_077520339.1|1568392_1569550_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	8.7e-22
1568272:1568285	attR	AATAACAATTTTTC	NA	NA	NA	NA
WP_001289165.1|1569615_1570629_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283598.1|1570628_1571441_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	1777487	1786932	4914884		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569336.1|1777487_1778414_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1778418_1779150_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1779130_1779238_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1779297_1780029_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1780250_1781936_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1781932_1782652_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1782698_1783169_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1783209_1783671_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_101980487.1|1783828_1785799_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.5	0.0e+00
WP_023154468.1|1785795_1786932_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
>prophage 5
NZ_CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	1939637	2045957	4914884	terminase,holin,protease,capsid,tail,portal,integrase,head,transposase	Escherichia_phage(36.73%)	84	1950340:1950355	2010965:2010980
WP_085947917.1|1939637_1940910_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_021535060.1|1942339_1943362_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	9.2e-201
WP_000349537.1|1944179_1944332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|1945069_1945672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313064.1|1945765_1946044_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000221530.1|1947498_1948068_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270974.1|1948327_1948729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221623.1|1948716_1949124_+	hypothetical protein	NA	NA	NA	NA	NA
1950340:1950355	attL	TTTCAGGGAAATATCC	NA	NA	NA	NA
WP_000656344.1|1951438_1952473_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_000973176.1|1957528_1958074_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001326708.1|1958070_1958814_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001166160.1|1958825_1959905_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986321.1|1959966_1960902_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011462.1|1961359_1962277_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011017.1|1962378_1963329_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122452224.1|1963446_1965090_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532912.1|1965718_1966435_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060242.1|1966777_1968232_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378572.1|1968333_1969650_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480506.1|1969964_1971017_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001323489.1|1973234_1973945_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000784547.1|1974635_1976657_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_001088826.1|1976787_1978365_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_000194282.1|1978368_1979172_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_000982854.1|1979168_1980269_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_000369516.1|1980265_1989757_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_000623056.1|1989844_1995952_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
WP_000140405.1|1996142_1997102_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000098384.1|1997268_1999071_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.8	6.5e-32
WP_000654453.1|1999057_2000860_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	7.9e-22
WP_001286292.1|2000852_2002133_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703035.1|2002160_2003465_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_000480162.1|2003658_2004921_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	2.6e-72
WP_001300801.1|2005258_2006056_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_024247926.1|2006291_2007317_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.6	5.8e-102
WP_000096344.1|2007316_2007520_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_101980496.1|2007578_2010050_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	3.2e-58
WP_001090187.1|2010142_2010334_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001358566.1|2010330_2010519_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2010919_2011084_+	hypothetical protein	NA	NA	NA	NA	NA
2010965:2010980	attR	TTTCAGGGAAATATCC	NA	NA	NA	NA
WP_001171942.1|2011087_2011306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2011465_2011621_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000233320.1|2011918_2012338_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|2012417_2012672_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693853.1|2012668_2013094_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_021530548.1|2013165_2014236_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	1.9e-63
WP_001151253.1|2014276_2014702_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	4.1e-62
WP_000150294.1|2014876_2015542_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000935258.1|2015722_2015935_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_024193993.1|2016102_2016381_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_101980497.1|2016382_2017441_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.9	3.1e-90
WP_000140004.1|2017441_2017807_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
WP_101980498.1|2017803_2018493_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	1.8e-59
WP_000839572.1|2019305_2019521_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_059333431.1|2019525_2019876_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	92.9	5.4e-36
WP_021568386.1|2019939_2020473_+	lysozyme	NA	Q08J98	Stx2-converting_phage	91.5	3.8e-97
WP_077575695.1|2020689_2020872_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	75.0	2.7e-15
WP_001140102.1|2020976_2021327_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	90.4	1.9e-57
WP_000361881.1|2021462_2021978_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	48.8	6.3e-33
WP_001552442.1|2022206_2022689_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
WP_001140907.1|2022688_2024446_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_000923131.1|2024593_2025820_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	4.1e-203
WP_000999828.1|2025812_2026412_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_101980499.1|2026426_2027644_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	67.4	6.1e-151
WP_000719066.1|2027720_2028038_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_001147814.1|2028046_2028385_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_014639219.1|2028381_2028831_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001206306.1|2028827_2029172_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000097526.1|2029232_2029937_+	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
WP_001324129.1|2029936_2030323_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_071590020.1|2030364_2030625_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_101980500.1|2030671_2033899_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.9	0.0e+00
WP_001330090.1|2033876_2034233_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_101980501.1|2034232_2034931_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.7	1.1e-128
WP_000140743.1|2034936_2035680_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
WP_101980502.1|2035577_2036225_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	7.8e-113
WP_101980503.1|2036285_2039984_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	74.8	0.0e+00
WP_063269873.1|2040051_2040651_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	4.2e-105
WP_101980504.1|2040715_2042782_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	66.9	8.4e-161
WP_001204579.1|2042778_2043057_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	7.9e-22
WP_000355702.1|2043066_2043357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358619.1|2043856_2044570_+	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_000734593.1|2044566_2045388_+	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
WP_000859544.1|2045384_2045957_+	cytolethal distending toxin type I subunit CdtC	NA	A5LH54	Enterobacteria_phage	98.9	5.3e-105
>prophage 6
NZ_CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	2405890	2473206	4914884	terminase,lysis,protease,tail,portal,integrase	Enterobacteria_phage(39.22%)	77	2413467:2413482	2442773:2442788
WP_001254970.1|2405890_2406712_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2406811_2406895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|2406987_2407323_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091847.1|2407720_2408974_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019561.1|2409080_2409974_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039004209.1|2410108_2411329_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2411453_2412149_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071586384.1|2412101_2413394_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2413467:2413482	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148698.1|2413551_2414166_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	1.1e-28
WP_000526519.1|2414208_2415063_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2415064_2415682_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000041658.1|2418176_2420603_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
WP_001317855.1|2420801_2421107_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|2421214_2421925_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2421927_2422488_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705195.1|2422522_2422864_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|2422998_2423325_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001295394.1|2423530_2424745_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836040.1|2424756_2425776_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	3.3e-17
WP_001389342.1|2425833_2425962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877006.1|2425963_2427244_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.1e-155
WP_021523104.1|2427278_2427515_-	excisionase family protein	NA	S4TND0	Salmonella_phage	49.3	3.9e-14
WP_001695751.1|2427602_2430074_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083273.1|2430167_2430359_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_086525109.1|2430355_2430544_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001328010.1|2430959_2431247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001320327.1|2431215_2431581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2431592_2431745_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000381212.1|2431913_2432321_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|2432401_2432629_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705360.1|2432612_2433134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054495.1|2433114_2434080_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_001151252.1|2434120_2434522_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	6.0e-63
WP_000547812.1|2435055_2436081_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	28.2	3.2e-28
WP_122985418.1|2436606_2436714_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000887486.1|2436758_2436971_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.9e-29
WP_000980999.1|2437187_2437439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032297225.1|2437505_2437784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696469.1|2437785_2438835_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.3	1.3e-112
WP_001047132.1|2438848_2439601_+	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	2.5e-131
WP_000066485.1|2440276_2440492_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_000839590.1|2441245_2441461_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2441465_2441777_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2441773_2442307_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2442303_2442801_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2442773:2442788	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2443164_2443377_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2443387_2443576_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2443578_2443644_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2443723_2443879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000035577.1|2444374_2444785_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031431.1|2444985_2445192_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_001696471.1|2445745_2446240_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	8.4e-83
WP_001696472.1|2446239_2448342_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|2448338_2448551_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_023908451.1|2448478_2450059_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	3.1e-288
WP_001360054.1|2450003_2452031_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097046.1|2452117_2452441_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_025492009.1|2452433_2452709_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	97.8	7.2e-44
WP_042003597.1|2452720_2453299_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	6.1e-101
WP_001079398.1|2453295_2453697_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|2453708_2454452_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001300035.1|2454512_2454899_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|2454907_2455237_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_025492007.1|2455208_2458274_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
WP_000447253.1|2458273_2458603_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152382.1|2458612_2459311_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_063116075.1|2459316_2460060_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.4e-150
WP_041498141.1|2459957_2460605_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	2.3e-112
WP_041498218.1|2460665_2464079_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_041498219.1|2464148_2464748_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	1.1e-108
WP_041498220.1|2464812_2467773_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	53.9	1.1e-55
WP_041498222.1|2467772_2468375_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.3	1.4e-103
WP_000087133.1|2468445_2469036_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000836765.1|2469354_2469588_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_120795384.1|2469656_2469770_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2470373_2471657_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527790.1|2471745_2473206_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 7
NZ_CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	3244003	3299653	4914884	terminase,lysis,protease,tail,capsid,portal,integrase,head,transposase	Enterobacteria_phage(52.24%)	81	3250670:3250686	3307599:3307615
WP_001317842.1|3244003_3244585_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	4.7e-101
WP_001695591.1|3244584_3247986_-|tail	phage tail fiber protein	tail	X2KTY7	Enterobacteria_phage	38.2	8.2e-12
WP_001695589.1|3248050_3248650_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	4.1e-108
WP_101980532.1|3248720_3252218_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.2	0.0e+00
3250670:3250686	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
WP_050541368.1|3252278_3252881_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	4.7e-88
WP_101980533.1|3252817_3253561_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.3e-147
WP_001152619.1|3253566_3254265_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847345.1|3254264_3254594_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001695584.1|3254590_3257152_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.4	0.0e+00
WP_000459480.1|3257144_3257579_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_001695582.1|3257560_3257983_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.6e-69
WP_021539112.1|3257998_3258739_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	8.9e-129
WP_001695579.1|3258746_3259142_-	MFS transporter	NA	A0A0K2FIF4	Enterobacteria_phage	98.5	5.0e-70
WP_032164853.1|3259138_3259717_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	3.9e-79
WP_000752994.1|3259728_3260082_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001695575.1|3260093_3260489_-	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
WP_123001604.1|3260530_3261295_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	97.2	5.7e-139
WP_032298611.1|3261475_3262639_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	28.9	9.6e-21
WP_000389900.1|3262643_3263192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101980534.1|3263255_3263450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001178671.1|3263695_3264079_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190778.1|3264090_3264432_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228111.1|3264441_3265482_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.1	5.7e-65
WP_101980535.1|3265699_3266149_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000557480.1|3266160_3266403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761770.1|3266692_3268444_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.6	2.2e-93
WP_000425298.1|3268440_3268740_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001091145.1|3268757_3268979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|3268979_3269171_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_000920679.1|3269170_3269356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390072.1|3269348_3269546_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000179577.1|3269736_3270042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049528.1|3270392_3270929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000737991.1|3270998_3271226_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000896725.1|3271227_3272463_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	44.9	1.1e-99
WP_001365132.1|3272595_3272865_-|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	5.3e-39
WP_001338090.1|3272926_3273259_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_033556695.1|3273268_3274588_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.4e-233
WP_101980536.1|3274568_3276170_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.3	1.4e-307
WP_000198149.1|3276166_3276373_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_039004545.1|3276369_3278295_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453587.1|3278269_3278815_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001415975.1|3279203_3279398_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738421.1|3279759_3280053_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|3280143_3280326_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135252.1|3280542_3281040_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	95.8	7.9e-89
WP_000839597.1|3281039_3281255_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
WP_000737280.1|3281827_3282925_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_001204791.1|3283114_3283498_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3283583_3283724_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099702.1|3283720_3284083_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	3.6e-59
WP_000950954.1|3284102_3284297_-	protein ninF	NA	NA	NA	NA	NA
WP_000386641.1|3284289_3284631_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	95.6	6.2e-61
WP_001254223.1|3284633_3284810_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153280.1|3284806_3285334_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|3285330_3285771_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145926.1|3285844_3286135_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788877.1|3286131_3286833_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000185516.1|3286829_3287729_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	1.1e-173
WP_000251069.1|3287761_3288055_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|3288173_3288374_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|3288474_3289188_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_001189994.1|3289354_3290173_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
WP_001317717.1|3290654_3290978_+	antitermination protein	NA	K7P718	Enterobacteria_phage	100.0	1.0e-52
WP_001278766.1|3290970_3291465_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
WP_085947917.1|3291693_3292967_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000065373.1|3293057_3293426_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_001198858.1|3293498_3293639_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000358700.1|3293631_3293775_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_000995439.1|3293849_3294146_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001317715.1|3294151_3294937_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.2	4.1e-148
WP_000186851.1|3294933_3295614_+	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
WP_000149532.1|3295610_3295793_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	2.8e-28
WP_000548531.1|3295765_3295957_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001395510.1|3295967_3296249_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763363.1|3296347_3296569_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_001289879.1|3296565_3297114_+	ead/Ea22-like family protein	NA	K7PKY4	Enterobacterial_phage	58.2	7.7e-45
WP_000789830.1|3297244_3297943_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.0	1.6e-100
WP_000545745.1|3298179_3298347_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3298386_3298605_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533645.1|3298582_3299653_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
3307599:3307615	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
>prophage 8
NZ_CP024138	Escherichia coli strain 14EC020 chromosome, complete genome	4914884	4622348	4674633	4914884	terminase,lysis,holin,protease,tail,capsid,plate,portal,integrase,head	Escherichia_phage(40.43%)	65	4638283:4638329	4671845:4671891
WP_000208242.1|4622348_4622879_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293344.1|4622888_4624220_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4624286_4625213_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872909.1|4625305_4625791_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4625875_4626121_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4626546_4627392_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|4627414_4628923_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4629093_4630104_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796345.1|4630200_4630947_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|4630951_4631380_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4631406_4631706_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4631917_4632358_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802221.1|4632458_4633058_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4633165_4633933_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|4633987_4634743_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045701.1|4634849_4635839_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001318165.1|4636158_4637121_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|4637301_4638204_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4638283:4638329	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4638440_4638659_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_033560207.1|4638740_4639904_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.9	6.3e-206
WP_001471798.1|4639903_4640383_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.1e-84
WP_073534974.1|4640397_4642845_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.8	0.0e+00
WP_053879341.1|4642837_4642957_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	4.0e-15
WP_001031303.1|4642989_4643265_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|4643321_4643840_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286680.1|4643852_4645043_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_024210490.1|4645362_4646262_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.3	2.0e-167
WP_000972099.1|4646477_4647005_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
WP_101980557.1|4647006_4649028_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.6	9.2e-261
WP_001563620.1|4649038_4649569_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	4.3e-101
WP_101980558.1|4649561_4650470_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	5.7e-162
WP_101980559.1|4650474_4650822_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	98.3	3.2e-57
WP_101980560.1|4650818_4651454_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	3.8e-112
WP_001695630.1|4651537_4652323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001695629.1|4652394_4652847_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_000917155.1|4652839_4653307_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_101980561.1|4653269_4653443_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	1.3e-22
WP_033549336.1|4653414_4653840_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	8.0e-66
WP_101980562.1|4653827_4654253_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	94.3	1.4e-57
WP_053894519.1|4654267_4654765_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	6.9e-93
WP_000123123.1|4654764_4655046_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|4655049_4655253_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|4655252_4655762_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_016242011.1|4655861_4656605_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	99.6	4.9e-127
WP_039023456.1|4656608_4657682_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.4	1.5e-201
WP_001085948.1|4657740_4658595_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156861.1|4658768_4660541_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038165.1|4660540_4661575_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	4.2e-201
WP_000368931.1|4661990_4663064_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000570053.1|4663056_4664094_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
WP_001143634.1|4664090_4665029_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000554771.1|4665271_4665478_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001696366.1|4665477_4665930_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.0e-79
WP_084818495.1|4665929_4668215_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.2	0.0e+00
WP_000027664.1|4668204_4668480_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113269.1|4668476_4668701_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	5.0e-35
WP_001277957.1|4668700_4669003_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_000557703.1|4669002_4669227_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|4669290_4669791_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000453534.1|4669960_4670233_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001192857.1|4670385_4670679_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000023386.1|4670748_4671729_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001223800.1|4671914_4672415_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4671845:4671891	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033720.1|4672564_4673263_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4673259_4674633_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
NZ_CP024140	Escherichia coli strain 14EC020 plasmid p14EC020b, complete sequence	166233	16321	60641	166233	bacteriocin,integrase,transposase	Escherichia_phage(37.5%)	46	39803:39862	65905:66727
WP_001312845.1|16321_17137_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|17186_17540_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|17717_18509_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000796228.1|18505_19195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493380.1|19238_19589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|20270_21266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991830.1|21269_22202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952231.1|22499_23588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000253407.1|23589_24459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741348.1|24515_26081_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001261287.1|26388_26619_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|26615_27032_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000350635.1|27193_29332_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000343085.1|29685_29943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194575.1|29942_30533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024126035.1|30795_32352_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000521603.1|32541_33159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063117293.1|33451_34531_-	permease	NA	NA	NA	NA	NA
WP_001175594.1|34635_34959_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071819239.1|35119_35602_+	hypothetical protein	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	2.9e-40
WP_001067834.1|35492_36197_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_001067855.1|37656_38361_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|38900_39716_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
39803:39862	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|39866_40571_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000612791.1|40831_41695_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|41732_41978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|42446_43238_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001067855.1|44928_45633_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|45702_46176_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_101980574.1|46331_47231_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.8	9.0e-59
WP_001067834.1|47277_47982_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000147565.1|47872_48466_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	92.7	3.3e-33
WP_000454193.1|48591_48942_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|49144_50158_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|50324_51167_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_001067855.1|51467_52172_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|52177_52318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|52803_53541_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|53537_53762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|53972_55466_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|55496_56381_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214121.1|56597_57812_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001255015.1|57839_58145_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804063.1|58411_59611_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|59716_60367_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|60398_60641_-|transposase	transposase	transposase	NA	NA	NA	NA
65905:66727	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCGTCGGCTTGAGATGCACATGTTGGCTGAGGTCGCCGGGTAGCGTGAACAGGCGCGGACCGTCCCGAAACTGGAACACGCGATACAGATGGAATTGATCGCCCGCCTCCTTGGAGAATTCGAGTTCGTTGTGGCTGACCAAGAAAGACGAGCCTACCCCGCCATTGGTGGTTTTCACCTCGATGAAGCGCTCATGGGCGTCCTCTTCGAACGACAGGATGTCGAACCCCGCACCGTCTCCCTGGGTGTCGGACACCCAATCCAGCCGCTGAAAAAGCTCTGGGTGGCCGAGCTCGGTCAGGCGTTGCTGTTCGTAGCCAATCACCCACTGCTCCCCTGCCCGGCCCAGCTTGCGGTTGGCTTCATCGCGAGCGGCATAATCGAACTTTCGCGGTAGGCGTTGCCGTAGAGATGCCGGGGTACGCACAAGCACTTCACGGGCGGGTGGTTCTACCAAAGCCGCTCGGTAGGTTTTGTCACCCGGAAGTTTTACCTCCTCCAGGGCATCGACAAGAGCGCCGACCGTCTGCTGATGTTCCAGAACGTAGGCGTGTACGGATTTACGCAGCAGCAGTTGGCTGTTGCCGCGTGGCTTGTAGCCGTTGATATAGGGCAGGCCCAGGGCATCGAGTACGGCGCTAATGTTCTGGTGCTTGAGCTCGACTGAAGACTTGCTGCGACCGTTCAGCAGTTGGCGCAGTGCCTGGTTGTGCTCGGACTTGTTGTACGGCTCCCCAGCCGCCTCGGCACGCAGCATGTCGAAAT	NA	NA	NA	NA
>prophage 2
NZ_CP024140	Escherichia coli strain 14EC020 plasmid p14EC020b, complete sequence	166233	65195	113911	166233	protease,tRNA,transposase	Stx2-converting_phage(33.33%)	52	NA	NA
WP_001067855.1|65195_65900_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014837927.1|65936_67064_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|67114_67360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|67365_67557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|68038_68581_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|68593_69454_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|70550_71255_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_072834372.1|71313_74313_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_000429836.1|74507_74942_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001398199.1|75337_75739_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|75671_75929_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|76021_76675_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000422741.1|77396_77822_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624717.1|77818_78169_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
WP_001593684.1|78199_79792_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.9e-181
WP_000612556.1|79887_80235_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_001171523.1|80231_80612_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000774297.1|81388_82246_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_085704288.1|82238_82733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442103.1|82713_82788_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083845.1|83019_83277_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001312851.1|83560_83710_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001299730.1|84390_84603_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139315.1|84738_85299_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704514.1|85401_86262_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_000205749.1|86320_87067_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_000986962.1|87086_92357_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_077944073.1|92435_92666_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911313.1|92665_93064_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000009324.1|93072_95226_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_023565183.1|95478_96210_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000605857.1|96241_96739_-	entry exclusion protein	NA	NA	NA	NA	NA
WP_001007018.1|96754_99577_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000982840.1|99573_100950_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001324104.1|100946_101360_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_001443031.1|101313_101655_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000059851.1|101584_102130_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_000624109.1|102116_102401_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_001324103.1|102481_102796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287910.1|102797_103145_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_001030393.1|103160_103904_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_000864318.1|103896_104154_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_000821841.1|104180_105989_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000777700.1|105985_106624_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000830183.1|106632_107625_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_001203720.1|107621_108254_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000099686.1|108250_108637_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001064245.1|108633_111261_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_001278689.1|111420_111642_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
WP_000809838.1|111776_112292_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001038342.1|112288_112540_-	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_085947772.1|112697_113911_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
