The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	262324	268103	5199281	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_000697968.1|262324_263005_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000555736.1|262997_264479_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000790485.1|264723_265155_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_001171554.1|265412_265793_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|265789_266137_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_053888474.1|266186_267725_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	6.0e-297
WP_001381494.1|267785_268103_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	7.4e-16
>prophage 2
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	1068023	1081983	5199281		Escherichia_phage(40.0%)	12	NA	NA
WP_001295182.1|1068023_1068785_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1068778_1069405_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1069544_1070684_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_039080342.1|1070746_1071739_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|1071832_1073197_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1073285_1074062_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1074066_1074705_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590404.1|1074701_1075964_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
WP_000847985.1|1075960_1076869_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|1077064_1077832_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141339.1|1078659_1079316_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
WP_033803637.1|1079421_1081983_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 3
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	1464071	1558606	5199281	holin,coat,head,tRNA,portal,tail,integrase,terminase,transposase,lysis	Enterobacteria_phage(60.0%)	115	1537392:1537411	1557473:1557492
WP_085947771.1|1464071_1465233_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001300996.1|1466201_1467137_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_001163428.1|1467320_1467521_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001277767.1|1467652_1467832_-	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_101979626.1|1467928_1468696_-	DUF551 domain-containing protein	NA	A0A222YWE8	Escherichia_phage	91.7	1.6e-56
WP_021523215.1|1468706_1469462_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	93.2	6.5e-143
WP_101979627.1|1469463_1469871_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	98.5	8.7e-70
WP_000215167.1|1469872_1470172_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	99.0	1.3e-57
WP_001214451.1|1470168_1470336_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	3.6e-22
WP_101979628.1|1470352_1470667_-	hypothetical protein	NA	K7P7J8	Enterobacteria_phage	98.1	1.3e-49
WP_000041326.1|1470678_1471161_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.9	3.5e-78
WP_101979629.1|1471144_1472056_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.3	3.7e-169
WP_000604108.1|1472052_1472361_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	97.1	4.8e-52
WP_101979630.1|1472445_1472721_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	96.7	4.2e-44
WP_000167595.1|1472810_1473281_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_101979631.1|1473359_1473548_-	hypothetical protein	NA	K7PMF8	Enterobacteria_phage	88.6	3.3e-16
WP_000088203.1|1473606_1473879_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_016242500.1|1474225_1474921_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
WP_000067727.1|1474996_1475212_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000189606.1|1475352_1475649_+	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
WP_000166207.1|1475681_1475828_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_021552862.1|1475820_1476720_+	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	99.3	1.0e-163
WP_000131492.1|1476709_1478146_+	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_000736913.1|1478222_1478663_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_073461864.1|1478659_1479187_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	98.9	1.8e-99
WP_001254255.1|1479183_1479360_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_001363895.1|1479362_1479722_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	74.2	2.6e-41
WP_000950973.1|1479714_1479891_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_016242496.1|1479883_1480153_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	98.9	9.3e-44
WP_000002243.1|1480152_1480443_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001008200.1|1480439_1480802_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|1480798_1480987_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000027543.1|1480983_1481502_+	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	98.8	5.9e-95
WP_000783734.1|1481963_1482287_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229389.1|1482270_1482747_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_101979632.1|1482743_1483181_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	97.9	5.5e-70
WP_021571390.1|1483168_1483321_+	hypothetical protein	NA	K7PHR3	Enterobacteria_phage	96.0	8.1e-21
WP_001016386.1|1483524_1484043_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
WP_097491682.1|1484395_1484638_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	98.8	1.7e-36
WP_000729920.1|1484673_1485162_+	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_101979633.1|1485139_1486636_+|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	93.6	1.8e-282
WP_101979634.1|1486635_1488837_+|portal	portal protein	portal	A5VW74	Enterobacteria_phage	96.7	0.0e+00
WP_063102866.1|1488927_1489821_+	hypothetical protein	NA	A0A088CPT0	Enterobacteria_phage	98.7	1.7e-129
WP_101979635.1|1489839_1491093_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	98.3	6.5e-233
WP_001389518.1|1491134_1491323_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_001140510.1|1491303_1491765_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_101979636.1|1491774_1493193_+	hypothetical protein	NA	Q716G7	Shigella_phage	98.7	1.5e-273
WP_101979637.1|1493192_1493894_+|tail	phage tail protein	tail	G5DA78	Enterobacteria_phage	97.9	7.4e-117
WP_000627632.1|1493893_1494349_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	100.0	1.8e-87
WP_000964882.1|1494351_1495044_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_101979638.1|1495053_1496394_+	DNA injection protein	NA	Q9AYZ0	Salmonella_phage	74.4	4.0e-172
WP_101979639.1|1496393_1498562_+	DNA transfer protein	NA	Q9AYY9	Salmonella_phage	93.2	0.0e+00
WP_000895335.1|1498562_1498892_-	hypothetical protein	NA	Q9AYY8	Salmonella_phage	99.1	1.7e-52
WP_001461300.1|1499048_1500035_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	47.6	2.7e-72
WP_042100707.1|1500050_1500302_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	7.6e-08
WP_047668238.1|1500416_1500569_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_047668240.1|1500565_1500748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101979640.1|1500810_1501713_+	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.7	2.2e-169
WP_097455537.1|1503863_1505759_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	48.3	4.8e-78
WP_097432450.1|1505962_1506940_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	40.8	7.0e-57
WP_096324793.1|1507066_1507456_+	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	86.7	7.8e-60
WP_101979641.1|1507462_1508620_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	4.1e-221
WP_000368117.1|1508931_1509864_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.3e-166
WP_000776768.1|1510157_1510913_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_001295701.1|1512519_1513860_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296261.1|1514231_1514516_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531952.1|1514696_1516007_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426161.1|1516006_1518151_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|1518353_1518839_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033319.1|1519522_1520086_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001281607.1|1522831_1523584_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000789849.1|1523600_1524107_+	fimbrial protein	NA	NA	NA	NA	NA
WP_033803098.1|1524103_1524583_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000197766.1|1524579_1525131_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001400721.1|1525132_1525957_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730816.1|1526082_1526634_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001459941.1|1526799_1527732_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918470.1|1527766_1528852_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001043792.1|1528855_1529680_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|1529679_1530489_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089250.1|1530488_1531037_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1531070_1531349_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683789.1|1531469_1533476_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1533634_1534855_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127781.1|1535119_1536298_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615834.1|1536294_1537290_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
1537392:1537411	attL	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_000789404.1|1537557_1538451_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_001173928.1|1538455_1538788_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000078920.1|1539049_1539190_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001372884.1|1539380_1539641_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000532200.1|1539832_1540855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132824.1|1540975_1542085_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	6.3e-195
WP_000005367.1|1542242_1543427_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	4.7e-225
WP_000290450.1|1543426_1543939_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_001603086.1|1543993_1544359_+|tail	phage tail protein E	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.9e-55
WP_000763327.1|1544394_1544523_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_069917170.1|1544509_1547317_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000979945.1|1547329_1547818_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_001165544.1|1547844_1548444_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
WP_097467737.1|1548515_1548983_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	64.8	1.7e-48
WP_001067855.1|1549153_1549858_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032329124.1|1552158_1552524_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	2.1e-59
WP_157839288.1|1552520_1553138_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	45.7	9.0e-10
WP_000104314.1|1553149_1553449_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	1.4e-40
WP_001757525.1|1553445_1553712_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	8.9e-31
WP_000985157.1|1553708_1553912_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_134894832.1|1553998_1554112_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	5.6e-11
WP_000514277.1|1554108_1554351_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158965.1|1554362_1554650_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	6.0e-33
WP_000813360.1|1554660_1555002_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	1.1e-54
WP_000200503.1|1555254_1555461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004249.1|1555467_1555755_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_001390705.1|1555868_1556189_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_032329120.1|1556285_1557290_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.4	9.9e-99
WP_000004836.1|1557448_1558606_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
1557473:1557492	attR	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	1767950	1804803	5199281	holin,transposase,integrase,protease	Enterobacteria_phage(31.37%)	54	1770425:1770444	1798968:1798987
WP_000569357.1|1767950_1768877_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1768881_1769613_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1769593_1769701_-	protein YohO	NA	NA	NA	NA	NA
WP_042101647.1|1769760_1770447_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
1770425:1770444	attL	CACGCGCGTAACGTGACAGG	NA	NA	NA	NA
WP_000063645.1|1770482_1771769_-|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	99.8	2.9e-252
WP_001193437.1|1771802_1772057_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001030159.1|1772075_1772210_-	hypothetical protein	NA	H6WZF8	Escherichia_phage	100.0	2.2e-22
WP_000457735.1|1772213_1772456_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	100.0	1.2e-37
WP_000208043.1|1772543_1773047_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	43.0	1.0e-56
WP_001289950.1|1773048_1773735_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	85.2	1.9e-117
WP_000763383.1|1773731_1773953_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001386642.1|1774051_1774333_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|1774343_1774535_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682306.1|1774507_1774690_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_032184512.1|1774686_1775367_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.1	4.6e-132
WP_016241376.1|1775363_1776149_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	3.1e-148
WP_000995439.1|1776154_1776451_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372937.1|1776526_1776670_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1776638_1776803_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065353.1|1776875_1777244_-	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	99.2	2.6e-65
WP_000095080.1|1777424_1778048_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	97.1	9.5e-108
WP_001479835.1|1778109_1778493_-	hypothetical protein	NA	A0A0P0ZBT9	Stx2-converting_phage	100.0	2.3e-64
WP_001278657.1|1779000_1779621_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
WP_001207140.1|1779617_1780052_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
WP_000885926.1|1780122_1780464_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_000428098.1|1780524_1781229_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|1781342_1781576_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438541.1|1781714_1782011_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000788928.1|1782911_1783613_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000145935.1|1783609_1783900_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|1783970_1784249_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1784381_1784597_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1784607_1784844_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814577.1|1784800_1785247_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	99.3	2.1e-80
WP_000153308.1|1785243_1785771_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_001254210.1|1785767_1785950_+	NinE family protein	NA	Q4A1A6	Enterobacteria_phage	100.0	4.3e-29
WP_064761331.1|1786453_1788226_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.3	0.0e+00
WP_001108084.1|1788789_1789356_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_024216034.1|1789330_1789933_+	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	3.9e-90
WP_001028855.1|1789929_1790601_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.6	9.2e-133
WP_000512807.1|1790591_1791080_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_158300304.1|1791721_1792186_+	DUF3927 family protein	NA	H6WZJ6	Escherichia_phage	92.5	1.1e-44
WP_158300305.1|1792385_1792529_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	89.5	3.4e-13
WP_101979651.1|1792514_1794365_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_158300306.1|1794656_1794872_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	9.4e-31
WP_000992064.1|1795264_1795798_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.4e-99
WP_000661712.1|1796071_1796767_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280923.1|1796861_1796993_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012816791.1|1797215_1797401_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_085949012.1|1797837_1798531_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_001295431.1|1799256_1800942_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
1798968:1798987	attR	CACGCGCGTAACGTGACAGG	NA	NA	NA	NA
WP_000598641.1|1800938_1801658_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1801704_1802175_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001423058.1|1802802_1804803_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
>prophage 5
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	1898711	1906307	5199281		Enterobacteria_phage(33.33%)	7	NA	NA
WP_021570381.1|1898711_1900106_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
WP_000999469.1|1900262_1901258_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183060.1|1901500_1902394_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_021570383.1|1902766_1903852_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	3.9e-101
WP_021570384.1|1903851_1904721_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	6.6e-107
WP_021570385.1|1904717_1905125_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_021570386.1|1905203_1906307_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.5	2.4e-37
>prophage 6
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	1934250	1957419	5199281	transposase,integrase	Escherichia_phage(42.86%)	24	1932514:1932527	1945748:1945761
1932514:1932527	attL	CACAGTGGGCGGCA	NA	NA	NA	NA
WP_024241377.1|1934250_1935108_+|integrase	integrase family protein	integrase	A0A2D1GLL1	Escherichia_phage	99.6	5.8e-164
WP_021570408.1|1936021_1936600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021570409.1|1936641_1937211_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000830155.1|1938498_1939665_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	6.5e-227
WP_001105412.1|1939783_1940257_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200891.1|1940483_1941542_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1941713_1942043_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001667686.1|1942143_1942326_-	ethanolamine utilization - propanediol utilization family protein	NA	NA	NA	NA	NA
WP_072170041.1|1942599_1943382_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_000255946.1|1943378_1944401_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_088491938.1|1944629_1945843_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
1945748:1945761	attR	TGCCGCCCACTGTG	NA	NA	NA	NA
WP_101979662.1|1947258_1948608_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.0	4.0e-111
WP_085947970.1|1948610_1949824_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000976829.1|1949958_1950165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854765.1|1950161_1950536_-	toxin	NA	NA	NA	NA	NA
WP_001315620.1|1950625_1950994_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|1951156_1951378_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186774.1|1951440_1951917_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855059.1|1951932_1952406_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_000080195.1|1952442_1954056_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|1954086_1954437_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_001299377.1|1954433_1954796_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	100.0	5.6e-36
WP_088491938.1|1954858_1956071_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
WP_001234652.1|1956600_1957419_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
>prophage 7
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	2021856	2079313	5199281	holin,head,tRNA,tail,portal,integrase,terminase,capsid,transposase	Escherichia_phage(31.37%)	66	2003658:2003674	2032849:2032865
2003658:2003674	attL	ATCAGTCGTGAAGAGGC	NA	NA	NA	NA
WP_000480163.1|2021856_2023119_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.2e-72
WP_001300801.1|2023456_2024254_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533607.1|2024489_2025515_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.3	6.4e-101
WP_000094838.1|2025514_2025718_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034469.1|2025776_2028248_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	1.5e-55
WP_000199479.1|2028343_2028532_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|2028528_2028717_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000379610.1|2029206_2029359_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000948454.1|2029677_2030154_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2030278_2030602_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693916.1|2030585_2031011_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095676.1|2031033_2032002_+	hypothetical protein	NA	U5P0A0	Shigella_phage	52.1	7.6e-72
WP_101979665.1|2032008_2032755_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.4	9.0e-113
WP_000451007.1|2032776_2033547_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
2032849:2032865	attR	ATCAGTCGTGAAGAGGC	NA	NA	NA	NA
WP_001151233.1|2033562_2033976_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|2034327_2035101_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|2035466_2035604_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001178384.1|2035661_2036735_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
WP_000813254.1|2036806_2036962_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001302544.1|2037003_2037189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001417850.1|2037129_2037408_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265026.1|2037409_2038456_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	3.2e-108
WP_001217450.1|2038468_2038828_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	3.0e-37
WP_000640048.1|2038836_2039367_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2039608_2039806_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935546.1|2039956_2041006_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	6.8e-199
WP_101972846.1|2043736_2045587_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411804.1|2045879_2046086_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000138558.1|2046341_2046614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|2046773_2047307_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|2047527_2047641_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001208680.1|2047862_2048048_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2048575_2048890_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|2048971_2049196_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|2049597_2050107_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_101979666.1|2050078_2052007_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.6	1.3e-259
WP_000259002.1|2051990_2052197_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_053887569.1|2052193_2053786_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.0	1.0e-182
WP_001253987.1|2053775_2055281_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_000256809.1|2055317_2055665_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_101979667.1|2055722_2056751_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.7e-114
WP_000201523.1|2056802_2057177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204534.1|2057169_2057523_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	4.3e-41
WP_101979668.1|2057538_2058114_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.3e-50
WP_000683079.1|2058110_2058506_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_053893793.1|2058513_2059266_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000479105.1|2059279_2059711_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533425.1|2059737_2060151_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000082492.1|2060131_2062711_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.9	0.0e+00
WP_000847304.1|2062707_2063037_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001152185.1|2063036_2063735_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_101979669.1|2063740_2064484_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.3e-145
WP_072280596.1|2064429_2065062_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.1e-103
WP_000649830.1|2065252_2065780_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_101979670.1|2065913_2069390_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.6	0.0e+00
WP_001815756.1|2069458_2070082_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	1.9e-68
WP_000268803.1|2070146_2071460_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.3	1.2e-75
WP_001101700.1|2071461_2071731_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_012816780.1|2072492_2073128_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001434995.1|2073255_2074314_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144084.1|2074392_2075043_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	40.7	1.1e-37
WP_001132098.1|2075226_2075817_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_099561169.1|2075803_2075926_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001217551.1|2076062_2076311_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	93.9	3.8e-36
WP_000891621.1|2076664_2077231_-	hydrolase	NA	NA	NA	NA	NA
WP_001258678.1|2077540_2079313_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	2351756	2422857	5199281	protease,head,tail,portal,integrase,terminase,capsid,transposase,lysis	Enterobacteria_phage(42.0%)	82	2359332:2359347	2392109:2392124
WP_101979681.1|2351756_2352578_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2352677_2352761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033803270.1|2352853_2353189_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2353585_2354839_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2354945_2355839_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2355973_2357194_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2357318_2358014_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2357966_2359259_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2359332:2359347	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148710.1|2359417_2360032_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526477.1|2360074_2360929_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2360930_2361548_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_101979682.1|2364043_2365153_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	47.2	4.1e-85
WP_101979683.1|2365378_2366758_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_101979684.1|2367281_2367650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101979685.1|2368030_2369122_+	AP2 domain-containing protein	NA	NA	NA	NA	NA
WP_101979686.1|2369121_2369334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101979687.1|2369447_2369939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101979688.1|2370044_2371031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101979689.1|2371629_2373108_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.1	3.0e-120
WP_001295396.1|2373306_2373612_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072104773.1|2373719_2374430_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2374432_2374993_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_101979690.1|2375027_2375369_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295395.1|2375503_2375830_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_001295394.1|2376035_2377250_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836059.1|2377261_2378281_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_015953164.1|2378338_2378467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877005.1|2378468_2379749_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	2.5e-155
WP_001296941.1|2379783_2380020_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000955178.1|2382319_2382502_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589009.1|2382679_2383993_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|2384429_2384762_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2384964_2385270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2385294_2385534_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2385533_2385821_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2385892_2386048_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2386264_2386516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2386582_2386861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096174476.1|2386862_2387912_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	6.3e-112
WP_001047136.1|2387925_2388678_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.4	2.7e-133
WP_120795389.1|2388955_2389045_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087757.1|2389099_2389312_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2389612_2389828_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2390581_2390797_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|2390801_2391113_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2391109_2391643_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071766.1|2391639_2392137_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.2e-06
2392109:2392124	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2392500_2392713_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2392723_2392912_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2392914_2392980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2393059_2393215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053902974.1|2393386_2393566_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_096174444.1|2393717_2394128_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	78.7	1.6e-55
WP_097747513.1|2394185_2394419_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	82.5	5.6e-21
WP_000453603.1|2394807_2395353_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_001549229.1|2395327_2397253_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|2397249_2397456_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001324962.1|2397452_2399054_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	1.9e-309
WP_000123333.1|2399034_2400354_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
WP_001549228.1|2400363_2400696_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_001552792.1|2400751_2401777_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	2.3e-191
WP_000158895.1|2401818_2402214_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	93.2	4.5e-55
WP_000752960.1|2402225_2402579_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000985123.1|2402590_2403169_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.7e-79
WP_000683143.1|2403165_2403561_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001439072.1|2403568_2404309_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_033803353.1|2404324_2404747_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	6.9e-70
WP_000459480.1|2404728_2405163_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_101979691.1|2405155_2407735_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.5	0.0e+00
WP_000847345.1|2407731_2408061_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152612.1|2408060_2408759_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_032143059.1|2408764_2409508_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	8.6e-148
WP_000090905.1|2409444_2410047_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	5.6e-89
WP_101979692.1|2410107_2413587_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.3	0.0e+00
WP_001619470.1|2413655_2414255_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	96.5	6.3e-109
WP_077890157.1|2414319_2417427_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.9	3.1e-82
WP_000885600.1|2417426_2418002_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	1.8e-105
WP_000086522.1|2418099_2418690_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|2419006_2419240_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2419308_2419422_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2420024_2421308_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527813.1|2421396_2422857_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	8.6e-43
>prophage 9
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	2528821	2586981	5199281	tail,portal,terminase,capsid,transposase	Escherichia_phage(20.0%)	54	NA	NA
WP_053894360.1|2528821_2529958_-|transposase	ISAs1-like element ISEc5 family transposase	transposase	NA	NA	NA	NA
WP_001001073.1|2530405_2530615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101979697.1|2530812_2535021_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.0	3.2e-21
WP_000103397.1|2535088_2537197_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.8e-26
WP_000882239.1|2538017_2538230_-	YncH family protein	NA	NA	NA	NA	NA
WP_000598880.1|2538305_2538923_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_001300590.1|2539189_2540689_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_000550668.1|2540801_2541863_-	YncE family protein	NA	NA	NA	NA	NA
WP_101979698.1|2542104_2544207_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.8e-134
WP_001459715.1|2544242_2544908_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001459714.1|2545105_2546143_-	NADPH-dependent curcumin/dihydrocurcumin reductase	NA	NA	NA	NA	NA
WP_000027563.1|2546323_2546842_+	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
WP_001076539.1|2546838_2547288_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000018629.1|2547288_2547522_-	YdcY family protein	NA	NA	NA	NA	NA
WP_000061178.1|2547607_2547781_-	orphan toxin OrtT	NA	NA	NA	NA	NA
WP_001303494.1|2547975_2548071_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_000867985.1|2548472_2549282_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.4	5.0e-16
WP_001163874.1|2549491_2550916_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000555471.1|2550937_2551732_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_101979699.1|2551721_2552663_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000220393.1|2552663_2553677_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047429.1|2553694_2554840_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_101979700.1|2555081_2556491_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001020593.1|2556725_2556998_+	hypothetical protein	NA	A0A1D7XF78	Escherichia_phage	52.2	1.8e-18
WP_024233973.1|2557047_2557434_+	hypothetical protein	NA	C4MZ15	Escherichia_phage	47.3	7.9e-12
WP_028132421.1|2557742_2558162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024233971.1|2558225_2559905_+	recombinase family protein	NA	Q6V7T7	Burkholderia_virus	27.8	7.9e-40
WP_000361806.1|2560249_2560447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000949339.1|2560439_2560793_-	DUF882 domain-containing protein	NA	A0A2K9VAY0	Citrobacter_phage	62.6	5.0e-37
WP_001097085.1|2560802_2561150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001767180.1|2561188_2561482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157924515.1|2561873_2562044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021515509.1|2562063_2562342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101979701.1|2566641_2567001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032216530.1|2567000_2567435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101979702.1|2567466_2568237_-	hypothetical protein	NA	A0A193GZN1	Shigella_phage	35.3	8.1e-08
WP_024190658.1|2568311_2568881_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_024233967.1|2568964_2569525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101979703.1|2569575_2572005_-	hypothetical protein	NA	A0A0M3LS69	Mannheimia_phage	33.6	1.8e-21
WP_024233617.1|2572016_2572358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021515504.1|2572387_2572696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024233618.1|2572778_2573249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021515503.1|2573303_2573606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000929469.1|2573605_2573911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000542618.1|2573913_2574210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|2574292_2575405_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_101979704.1|2575597_2579128_-|tail	tail fiber domain-containing protein	tail	K7DVC6	Escherichia_phage	46.9	5.0e-04
WP_096945306.1|2579201_2580035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881569.1|2580044_2580467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053919337.1|2580450_2580741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101979705.1|2580932_2582939_-|capsid	major capsid protein	capsid	A0A2I5ARA4	Synechococcus_phage	23.6	3.1e-27
WP_089540829.1|2582984_2584496_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	27.0	1.1e-32
WP_089540827.1|2584506_2585001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024233624.1|2585073_2586981_-|terminase	terminase	terminase	D6PFE7	uncultured_phage	30.4	2.8e-33
>prophage 10
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	2744724	2815075	5199281	holin,protease,head,tail,portal,integrase,terminase,capsid,transposase,lysis	Enterobacteria_phage(38.46%)	79	2812978:2812992	2818907:2818921
WP_000422045.1|2744724_2745774_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559274.1|2745993_2746752_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	1.5e-06
WP_001278906.1|2746748_2747339_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291217.1|2747378_2748254_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001301109.1|2748466_2750362_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2750389_2751010_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285663.1|2751006_2751888_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2752025_2752070_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194582.1|2752161_2753724_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_053273283.1|2753723_2755319_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2755322_2756681_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2756692_2757886_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_101979711.1|2757885_2758692_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2759072_2759252_+	general stress protein	NA	NA	NA	NA	NA
WP_001056490.1|2759337_2759838_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079505.1|2759883_2760390_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001296031.1|2760759_2761035_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|2761031_2761589_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000937495.1|2762000_2762270_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2762326_2762995_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885577.1|2763049_2763634_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000216507.1|2763633_2766660_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	84.7	2.2e-48
WP_001228316.1|2766811_2767411_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	2.0e-107
WP_101979712.1|2767478_2770958_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_001332187.1|2771024_2771363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090880.1|2771435_2772038_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	4.0e-87
WP_014639158.1|2771974_2772718_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	2.0e-144
WP_001152612.1|2772722_2773421_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847345.1|2773420_2773750_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_101979713.1|2773749_2776320_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.3	0.0e+00
WP_000533402.1|2776300_2776714_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479111.1|2776740_2777172_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000235110.1|2777185_2777938_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|2777945_2778341_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975009.1|2778337_2778913_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	2.1e-48
WP_001204198.1|2778927_2779281_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_096174551.1|2779273_2779642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522596.1|2779693_2780722_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000256823.1|2780779_2781127_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_016239005.1|2781163_2782669_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.1	7.9e-100
WP_101979714.1|2782658_2784251_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	1.0e-182
WP_016239003.1|2784247_2784454_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.9e-10
WP_101979715.1|2784437_2786366_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	9.7e-260
WP_001403748.1|2786337_2786754_-	DNA packaging protein	NA	A0A0U2S671	Escherichia_phage	93.6	3.9e-41
WP_087548947.1|2786825_2788038_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	1.4e-163
WP_000077907.1|2788610_2789678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654790.1|2789619_2790240_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	5.1e-53
WP_001082541.1|2790656_2791094_-|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	93.8	5.7e-67
WP_000992072.1|2791392_2791926_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_000193305.1|2791989_2792340_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.4e-37
WP_000284510.1|2792344_2792560_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_021551913.1|2792709_2794563_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_101979716.1|2795837_2796887_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000080195.1|2796950_2798564_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2798594_2798945_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2798941_2799367_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000917767.1|2799577_2799775_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000762880.1|2800001_2800823_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904113.1|2800819_2801194_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_024235394.1|2801206_2802253_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	1.3e-109
WP_001515373.1|2802254_2802533_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_000980987.1|2802599_2802851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101979717.1|2803067_2803280_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	3.1e-26
WP_000892866.1|2803965_2804661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373963.1|2804673_2805327_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000566847.1|2805641_2806541_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001151218.1|2806793_2807216_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.8	4.8e-63
WP_134894869.1|2807256_2808222_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705349.1|2808202_2808724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|2808707_2808935_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003382.1|2809012_2809420_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	3.3e-24
WP_000379575.1|2809612_2809768_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171930.1|2809927_2810146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573395.1|2810149_2810314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2810713_2810902_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2810898_2811090_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048463.1|2811182_2813654_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
2812978:2812992	attL	TCCCGAACAAGGAGT	NA	NA	NA	NA
WP_000113189.1|2813718_2813967_+	excisionase	NA	NA	NA	NA	NA
WP_000113699.1|2813944_2815075_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	2.2e-102
2818907:2818921	attR	TCCCGAACAAGGAGT	NA	NA	NA	NA
>prophage 11
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	2920555	2992683	5199281	holin,head,tRNA,tail,portal,integrase,terminase,capsid,transposase	Enterobacteria_phage(41.27%)	92	2929626:2929641	3003071:3003086
WP_001297484.1|2920555_2921662_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2921697_2922339_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2922342_2923713_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|2923880_2924552_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735411.1|2924551_2926012_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|2926613_2926895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2927151_2927694_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224606.1|2927899_2928313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|2928325_2928661_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|2928673_2929729_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
2929626:2929641	attL	AACAGCGTGGTAAACA	NA	NA	NA	NA
WP_000796963.1|2929728_2929935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|2930186_2930411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233304.1|2930537_2930810_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126687.1|2930820_2931231_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000192401.1|2931227_2931479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833618.1|2931679_2933080_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000770178.1|2933076_2933376_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204985.1|2933381_2933615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2933607_2934072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609225.1|2934061_2934274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|2934266_2934464_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953272.1|2935268_2935457_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085256.1|2935821_2937051_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001295435.1|2937299_2938421_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359441.1|2938469_2939696_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|2939945_2941082_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799400.1|2941065_2941929_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_032361507.1|2942292_2943654_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.4	2.1e-51
WP_032361506.1|2943716_2943992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101979721.1|2944071_2945052_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	1.0e-87
WP_001101707.1|2945228_2945498_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_032162956.1|2946876_2947476_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	3.7e-109
WP_101979722.1|2947542_2951022_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.5	0.0e+00
WP_071790928.1|2951082_2951715_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.1	5.7e-92
WP_000140735.1|2951651_2952395_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.4e-144
WP_001152532.1|2952399_2953098_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847345.1|2953097_2953427_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_047087948.1|2953423_2955985_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.8	0.0e+00
WP_101979723.1|2955965_2956379_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	79.2	8.6e-41
WP_000479108.1|2956405_2956837_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000235112.1|2956850_2957603_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000683079.1|2957610_2958006_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974986.1|2958002_2958536_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.2e-58
WP_101979724.1|2958551_2958905_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	5.7e-41
WP_000201501.1|2958897_2959281_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2959332_2960361_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256824.1|2960418_2960766_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_001253979.1|2960802_2962308_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_101979725.1|2962297_2963890_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2963886_2964093_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_101979726.1|2964076_2966005_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.4e-261
WP_001429103.1|2965976_2966483_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
WP_001300236.1|2966909_2967134_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|2967215_2967530_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2968057_2968243_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000675931.1|2968464_2968578_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003111.1|2968798_2969332_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_000138558.1|2969491_2969764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|2970019_2970226_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_101979727.1|2970674_2972525_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001368722.1|2973003_2973435_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2973885_2974599_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086163632.1|2974733_2974931_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	1.4e-28
WP_101979728.1|2975046_2975226_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.3e-06
WP_101973092.1|2975191_2976405_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
WP_000640037.1|2976468_2977023_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	3.0e-65
WP_001215507.1|2977031_2977391_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.3	4.3e-36
WP_042353497.1|2977390_2977633_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	1.6e-34
WP_000184331.1|2977644_2979045_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	94.8	5.4e-252
WP_000181080.1|2979041_2979932_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.3	2.6e-82
WP_001247847.1|2979949_2980843_-	hypothetical protein	NA	C5IHL2	Burkholderia_virus	45.9	2.1e-60
WP_000621936.1|2980829_2981063_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	50.0	9.5e-13
WP_000626792.1|2981059_2981254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587263.1|2981250_2981913_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	83.2	4.2e-98
WP_001435006.1|2982021_2982729_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	97.4	1.3e-124
WP_000867909.1|2982848_2983142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399865.1|2983212_2983485_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	89.6	2.1e-35
WP_000800135.1|2983618_2984308_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	8.0e-116
WP_012816784.1|2984452_2985145_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	69.2	1.1e-40
WP_000147365.1|2985150_2985351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312938.1|2985550_2985910_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	73.1	1.4e-42
WP_000002321.1|2985909_2986125_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	63.4	1.2e-17
WP_000566773.1|2986311_2986704_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.9	4.7e-36
WP_001091864.1|2987321_2987693_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	98.4	3.8e-64
WP_000492057.1|2987724_2987967_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	2.4e-35
WP_001030139.1|2987970_2988117_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000073102.1|2988125_2988362_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.7	8.4e-41
WP_000362001.1|2988417_2989731_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	97.0	2.8e-250
WP_049768377.1|2989712_2990483_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_074576257.1|2990535_2990931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2990971_2991715_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564726.1|2991711_2992683_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
3003071:3003086	attR	AACAGCGTGGTAAACA	NA	NA	NA	NA
>prophage 12
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	3079543	3132551	5199281	holin,head,tail,integrase,terminase,capsid,transposase,lysis	Enterobacteria_phage(33.33%)	67	3114468:3114488	3141038:3141058
WP_095111390.1|3079543_3079675_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_101979732.1|3080021_3081002_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.5e-86
WP_001023432.1|3081178_3081448_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
WP_101979733.1|3081449_3082763_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	99.1	9.7e-78
WP_001815756.1|3082827_3083451_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	1.9e-68
WP_101979734.1|3083519_3086996_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.7	0.0e+00
WP_000649830.1|3087129_3087657_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_072280596.1|3087847_3088480_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.1e-103
WP_101979669.1|3088425_3089169_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.3e-145
WP_001152185.1|3089174_3089873_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_000807964.1|3089872_3090214_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_101979735.1|3090206_3093449_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	98.5	0.0e+00
WP_000526113.1|3093576_3094035_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_001453698.1|3094212_3094422_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3094517_3094892_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275476.1|3094897_3095614_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|3095680_3096025_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3096021_3096468_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3096464_3096815_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3096824_3097151_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_053882734.1|3099677_3099899_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	91.8	5.1e-32
WP_052935700.1|3099943_3101881_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	98.6	0.0e+00
WP_053904682.1|3101944_3103606_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_024239162.1|3103602_3104166_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	91.4	2.2e-79
WP_000829192.1|3104454_3104820_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095749.1|3104861_3105089_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000736096.1|3105457_3105682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082547.1|3105678_3106173_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	100.0	1.7e-83
WP_000992129.1|3106471_3107005_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	3.6e-100
WP_000731192.1|3107055_3107400_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000411809.1|3107404_3107611_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_101979736.1|3107913_3109764_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000216623.1|3110171_3110339_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
WP_001299895.1|3110335_3110767_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.8	2.1e-66
WP_000798624.1|3111074_3111449_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000573777.1|3111509_3111770_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000248436.1|3111877_3112942_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	90.8	2.6e-190
WP_000917767.1|3113093_3113291_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000762928.1|3113517_3114339_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000904098.1|3114335_3114710_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	3.2e-34
3114468:3114488	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265175.1|3114722_3115772_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
WP_001341388.1|3115773_3116052_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000902687.1|3116219_3116432_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3116618_3116723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137957.1|3116832_3117396_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
WP_001273106.1|3117522_3117834_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001375713.1|3117830_3117983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3118015_3118372_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3118368_3118593_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450612.1|3118614_3119313_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
WP_000373320.1|3119347_3119770_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262408.1|3119801_3120839_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000693816.1|3120907_3121333_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3121329_3121557_-	cell division protein	NA	NA	NA	NA	NA
WP_134894985.1|3121654_3122299_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3122574_3122727_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449192.1|3123216_3123405_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3123401_3123593_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_101979738.1|3123685_3126157_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.7	1.1e-58
WP_000003742.1|3126218_3126488_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|3126456_3127575_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000580316.1|3127741_3128536_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759317.1|3128532_3129579_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_101979739.1|3129636_3130053_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000422741.1|3130134_3130560_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3130556_3130907_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|3130937_3132551_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
3141038:3141058	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 13
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	3497612	3546109	5199281	holin,protease,head,tail,portal,integrase,terminase,capsid,lysis	Enterobacteria_phage(56.9%)	66	3490918:3490932	3554595:3554609
3490918:3490932	attL	CAGGCCATCTTCCAG	NA	NA	NA	NA
WP_001247928.1|3497612_3498311_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3498541_3499423_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3499591_3499753_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_001592261.1|3500248_3501268_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_101979732.1|3501301_3502282_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.5e-86
WP_001023432.1|3502458_3502728_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
WP_072179282.1|3502729_3504043_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	99.1	9.7e-78
WP_101979755.1|3504107_3504707_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.5	1.7e-109
WP_101979756.1|3504773_3508172_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	87.8	0.0e+00
WP_071781836.1|3508232_3508865_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.6e-94
WP_032144726.1|3508801_3509545_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.9e-147
WP_001152612.1|3509549_3510248_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847345.1|3510247_3510577_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_053896164.1|3510573_3513153_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.7	0.0e+00
WP_000479105.1|3513572_3514004_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001143019.1|3514017_3514770_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000683065.1|3514777_3515173_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_053896163.1|3515169_3515703_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.3e-57
WP_001204560.1|3515717_3516071_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_033803395.1|3516063_3516447_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_101979757.1|3516498_3517527_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	2.3e-114
WP_000256821.1|3517584_3517932_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_024236278.1|3517968_3519474_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.5	9.3e-101
WP_053896161.1|3519463_3521056_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	2.2e-185
WP_000259002.1|3521052_3521259_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_101979758.1|3521242_3523171_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.9e-261
WP_000235436.1|3523142_3523652_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|3524046_3524241_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881338.1|3524428_3525046_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	1.2e-91
WP_024223034.1|3525195_3525633_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	99.3	8.5e-71
WP_000075135.1|3525629_3526127_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_024164617.1|3526126_3526342_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_101979759.1|3526780_3528631_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000499454.1|3528929_3529088_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3529173_3529917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3530101_3530791_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3530805_3530928_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3531266_3532226_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028841.1|3532437_3533103_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_089623417.1|3533099_3533711_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.0	1.3e-98
WP_000566868.1|3533703_3533874_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254222.1|3533870_3534053_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000153262.1|3534049_3534577_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
WP_000736898.1|3534573_3535014_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_000145926.1|3535087_3535378_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_052896138.1|3535374_3536076_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_053896809.1|3536072_3536972_-	replication protein	NA	M1FN81	Enterobacteria_phage	99.3	1.4e-173
WP_001177650.1|3537006_3537285_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000276886.1|3537393_3537579_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001095981.1|3537659_3538310_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_033803619.1|3538623_3538896_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	95.6	1.1e-25
WP_000167595.1|3538954_3539425_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065384.1|3539575_3539944_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_001198860.1|3540016_3540181_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372923.1|3540149_3540293_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995439.1|3540368_3540665_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3540670_3541456_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_101979760.1|3541452_3542133_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	97.8	2.5e-130
WP_024236336.1|3542129_3542288_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	98.1	4.0e-23
WP_101979761.1|3542284_3543037_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	99.6	1.9e-150
WP_000151207.1|3543044_3543260_+	hypothetical protein	NA	M1FPM2	Enterobacteria_phage	97.2	8.5e-32
WP_000763367.1|3543358_3543580_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000120064.1|3543790_3544393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3544635_3544803_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3544842_3545061_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|3545038_3546109_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3554595:3554609	attR	CAGGCCATCTTCCAG	NA	NA	NA	NA
>prophage 14
NZ_CP024134	Escherichia coli strain 14EC017 chromosome, complete genome	5199281	4010571	4078422	5199281	holin,transposase,protease	Streptococcus_phage(18.18%)	53	NA	NA
WP_000131044.1|4010571_4012605_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|4012733_4013321_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|4013334_4014807_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159095.1|4014820_4016491_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|4016703_4017372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|4017614_4018310_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|4018302_4019730_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|4019740_4020460_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|4020986_4021841_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|4022066_4023392_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|4023500_4023737_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|4023748_4024342_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000068158.1|4025184_4026351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567940.1|4026844_4027420_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000288254.1|4027561_4027768_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001247777.1|4030333_4030597_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001295708.1|4030611_4030875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643630.1|4031096_4031378_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350438.1|4031412_4031982_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_000101616.1|4032272_4035122_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.2e-128
WP_001446316.1|4035121_4035313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001723519.1|4037180_4037639_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_001723518.1|4037661_4038570_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001723517.1|4038672_4039560_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001090783.1|4039656_4040268_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_001723515.1|4040347_4041493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786816.1|4041482_4041923_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	4.5e-11
WP_001567932.1|4041926_4043642_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000843381.1|4043638_4044136_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_000323729.1|4045104_4046256_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
WP_001254932.1|4048207_4049359_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_101979780.1|4049346_4050294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101979781.1|4050636_4054659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101979782.1|4055836_4056190_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_020244701.1|4056472_4056754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158300309.1|4057675_4057903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001460375.1|4062307_4063294_-	ATP-binding protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	27.6	4.8e-13
WP_000893279.1|4063948_4065202_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	2.2e-95
WP_001285288.1|4065213_4066317_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|4066604_4067660_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000174677.1|4067698_4068100_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|4068157_4069402_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4069493_4069952_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|4070212_4071670_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001329160.1|4071726_4072263_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001321003.1|4072195_4072462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059847.1|4072695_4073148_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263493.1|4073157_4073556_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4073558_4073852_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|4073903_4074959_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_033802998.1|4075029_4075800_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_033802984.1|4075759_4077499_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_033802985.1|4077924_4078422_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP024136	Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence	93781	14959	67451	93781	integrase,protease,transposase	Escherichia_phage(35.71%)	48	20140:20199	61854:62674
WP_000971921.1|14959_16330_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000080861.1|16444_17581_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|17631_17877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|17882_18074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|18555_19098_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|19110_19971_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
20140:20199	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|20203_20908_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001206316.1|21320_22112_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|22204_23464_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|23725_24517_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845048.1|24662_25676_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|25878_26229_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|26404_26965_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000844627.1|29979_30222_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001493764.1|30253_30904_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|31009_32209_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|32240_33125_-	EamA family transporter	NA	NA	NA	NA	NA
WP_052247502.1|33262_33655_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_034167712.1|35642_36050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032482496.1|36111_36309_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|36695_37400_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032482493.1|39596_40568_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	38.1	2.4e-49
WP_000034420.1|41903_42695_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|43163_43409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|43446_44310_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|44455_44695_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001067855.1|44767_45472_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|45821_46223_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|46155_46413_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616800.1|46505_47159_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_158297019.1|48096_48954_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|48946_49021_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083830.1|49258_49513_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766814.1|49752_50343_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_072078460.1|50381_50525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139345.1|51306_51867_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_072672439.1|51921_52668_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.6	1.2e-08
WP_101979827.1|52687_57958_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000850424.1|60396_61128_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_001299727.1|61159_61657_-	type IV secretion-like conjugative transfer system protein TraS	NA	NA	NA	NA	NA
WP_101979828.1|61677_61893_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001067855.1|61917_62622_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001083725.1|63327_63825_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
61854:62674	attR	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_001336345.1|63936_64227_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|64232_65024_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000084745.1|65508_65901_+	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_063102497.1|66220_66607_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_001067858.1|66746_67451_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP024137	Escherichia coli strain 14EC017 plasmid p14EC017c, complete sequence	107279	4636	72492	107279	transposase	Stx2-converting_phage(28.57%)	46	NA	NA
WP_000839179.1|4636_5041_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|5037_5385_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099202.1|5433_6972_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
WP_134895005.1|7206_11109_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	38.5	1.4e-220
WP_087548947.1|11735_12948_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	1.4e-163
WP_101979829.1|12914_13016_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.2	5.7e-07
WP_000222766.1|14897_15185_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	5.8e-20
WP_001132900.1|15181_15433_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_085947970.1|16363_17576_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001222320.1|18400_18802_-	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000088802.1|18895_19729_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_000998852.1|19780_20296_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_071526091.1|20282_21455_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000842183.1|21493_22471_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000082784.1|22467_23067_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_001420206.1|23063_23411_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082928.1|23425_23977_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001231213.1|23973_24408_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173149.1|24438_25662_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001418198.1|25663_27166_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_013009342.1|27162_29133_-	variant type II secretion system secretin EtpD	NA	A7BJX1	Enterobacteria_phage	27.6	2.0e-26
WP_001368871.1|29133_30009_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000770132.1|30092_32753_-	peptidase M66	NA	NA	NA	NA	NA
WP_001490748.1|33349_33664_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_085947970.1|33748_34962_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000592771.1|35140_37351_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|37394_37784_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_101973092.1|37895_39108_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
WP_001340790.1|39158_39656_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	52.7	3.5e-28
WP_024227774.1|42651_43977_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	84.1	5.5e-222
WP_101973092.1|44963_46177_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
WP_001302199.1|47651_48473_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|48472_49579_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|49672_51394_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_077629919.1|51467_52466_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_101979831.1|54920_55271_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	6.9e-39
WP_000422741.1|55267_55693_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000612591.1|56896_57244_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|57240_57621_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000139321.1|57770_58331_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704529.1|58433_59294_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000205715.1|59352_60099_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	1.2e-08
WP_101979833.1|60118_65389_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_101979834.1|65388_67668_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000850424.1|67921_68653_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_101973092.1|71278_72492_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	1.0e-166
