The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	446270	479528	5413765	integrase,tRNA,capsid,protease,tail,head,portal,terminase	uncultured_Caudovirales_phage(73.33%)	35	463878:463895	479873:479890
WP_002919147.1|446270_447218_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|447232_447742_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|447870_448995_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|448966_449440_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|449465_450008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|450012_450585_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|450588_451407_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|451403_451661_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|451636_452191_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|457986_458208_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|458501_461612_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|461624_462764_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|463142_463793_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
463878:463895	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|464068_465295_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|465387_466329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|466510_466795_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|466805_467585_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|467708_467903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|468036_468306_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|468298_468487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|468479_468794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|468790_469159_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|469155_469521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|469520_471656_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|471998_472334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|472382_472895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|473158_474325_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|474376_474937_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|474938_476180_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|476176_476512_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|476508_476808_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|476807_477251_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004198610.1|477377_477569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113647.1|477526_477883_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|477866_479528_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
479873:479890	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	1235841	1282076	5413765	integrase,coat,tRNA,capsid,lysis,tail,plate,head,portal,terminase	Salmonella_phage(83.72%)	60	1234135:1234181	1270702:1270748
1234135:1234181	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1235841_1236867_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1236869_1237499_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1237621_1237864_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1237896_1238406_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1238413_1238614_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1238577_1238916_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1238983_1239217_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1239216_1239444_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1239440_1240292_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1240288_1242673_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1242835_1243024_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1243035_1243269_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1243364_1244048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1244034_1245114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1245113_1246115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1246636_1246906_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1246962_1248006_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1248005_1249769_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1249909_1250743_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1250759_1251812_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1251815_1252469_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1252564_1253029_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1253028_1253232_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1253235_1253451_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1253431_1253941_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1253945_1254329_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1254325_1254754_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_085955118.1|1254683_1254887_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
WP_004150997.1|1254849_1255272_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1255264_1255711_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1255733_1256600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1256694_1257267_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1257263_1257626_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1257612_1258521_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1258513_1259185_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_102008978.1|1259186_1261136_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1261145_1262264_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1262315_1263389_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1263537_1264710_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1264719_1265235_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1265287_1265587_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1265601_1265721_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1265713_1268344_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1268340_1268826_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1268822_1269917_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1269983_1270202_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1270229_1270607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1271210_1271693_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1270702:1270748	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1271803_1272280_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1272269_1272560_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1272626_1272968_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1273115_1274777_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1274863_1275742_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1275866_1276457_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1276576_1277863_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1277882_1278674_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1278837_1280202_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1280461_1280710_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1280728_1281277_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1281308_1282076_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	1727294	1734199	5413765	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1727294_1728158_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1728168_1728942_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1729182_1730076_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1730321_1731683_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1732001_1732724_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_019705218.1|1732720_1734199_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
NZ_CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	2727444	2738331	5413765		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2727444_2730552_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2730606_2731872_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2731902_2732991_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2733077_2733338_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2733635_2734496_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2734516_2735278_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2735538_2736441_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2736452_2737718_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2737710_2738331_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	2995548	3057294	5413765	integrase,holin,tail,transposase,terminase	Klebsiella_phage(22.22%)	75	2995330:2995345	3054600:3054615
2995330:2995345	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|2995548_2996220_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|2996406_2997234_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|2997309_2998575_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|2998576_2998996_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|2999075_3000560_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3000559_3000811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152776.1|3001457_3001880_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3002472_3003177_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|3003353_3004118_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001297012.1|3004205_3004319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|3004624_3005125_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|3005143_3005323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|3005252_3006092_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3006085_3006433_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3006596_3007388_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_015057121.1|3007533_3008493_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|3008383_3009088_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152703.1|3009336_3011280_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_004152702.1|3011521_3012121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152701.1|3012154_3012349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|3012345_3013077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644627.1|3013080_3016035_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152652.1|3016111_3019180_-	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_004152651.1|3019176_3019557_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152650.1|3019566_3020049_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_102009026.1|3020229_3020694_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152648.1|3021008_3021344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217331.1|3021427_3024325_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_099119318.1|3024586_3024778_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217333.1|3025002_3025359_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_004217335.1|3025435_3025612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226994.1|3025779_3026262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217341.1|3026315_3027488_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|3027511_3027904_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217343.1|3027900_3028452_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004217344.1|3028453_3028837_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|3028823_3029057_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217346.1|3029066_3029321_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004217348.1|3029322_3029718_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004190653.1|3030039_3030993_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217351.1|3031003_3031789_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_019405022.1|3032319_3033432_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004218551.1|3033415_3034816_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_004190663.1|3034815_3036123_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218556.1|3036100_3037105_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004244013.1|3037653_3037839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218558.1|3037967_3038213_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_019405025.1|3039026_3039221_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
WP_004190672.1|3039171_3039447_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|3039443_3039788_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004218565.1|3039784_3040324_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004218567.1|3040320_3040632_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
WP_022644626.1|3041098_3042145_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004218530.1|3042546_3043575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3043782_3044028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3044083_3044386_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3044382_3045231_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3045227_3046088_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3046173_3046395_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3046435_3046663_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3046774_3047473_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3047495_3047615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3047760_3048837_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3048918_3049122_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3049550_3049745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3049833_3050118_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3050133_3050979_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201102.1|3051264_3051945_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3051941_3052370_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3052366_3053029_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004190725.1|3053025_3053340_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_004153574.1|3053236_3054424_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3054600_3055491_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3054600:3054615	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3055490_3056483_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3056484_3057294_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 6
NZ_CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	3433383	3526334	5413765	tRNA,integrase,capsid,protease,lysis,tail,plate,head,portal,terminase	Salmonella_phage(56.14%)	96	3488909:3488927	3526409:3526427
WP_002898139.1|3433383_3434676_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3434766_3436110_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3436118_3436730_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3436852_3441106_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3441241_3441736_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3442268_3443237_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3443351_3445118_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3445118_3446840_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3446884_3447586_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3447939_3448158_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3448278_3450558_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3450588_3450906_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3451231_3451453_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_071528213.1|3451407_3451590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150848.1|3451529_3453470_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3453466_3454582_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3454728_3456387_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3456806_3457502_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3457617_3458517_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3458660_3460313_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3460323_3461292_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_085666582.1|3461242_3461446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896408.1|3461503_3461938_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3462089_3463808_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3463846_3464848_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3464858_3466301_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3466388_3467402_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3467398_3468229_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3468260_3469400_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004147767.1|3469452_3469632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896394.1|3470277_3470793_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3471019_3471748_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3471768_3472500_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3472506_3473223_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3473222_3473891_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3474074_3474806_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3474848_3476321_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3476317_3477034_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3477112_3478240_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3478281_3478770_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3478827_3479673_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3479669_3480623_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3480633_3481767_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3481930_3483043_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3483391_3483871_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3483959_3484862_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3485683_3485971_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3486173_3486437_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3486443_3486827_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3487093_3488779_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3488909:3488927	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3488998_3489217_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3489308_3490409_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3490405_3490891_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3490887_3493515_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3493507_3493627_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3493641_3493941_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3493993_3494509_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3494518_3495691_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3495829_3496906_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3496935_3497139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3497135_3497867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3497870_3500822_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3500823_3501423_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3501415_3502324_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896177.1|3502669_3503242_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3503336_3504029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3504025_3504472_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3504464_3504896_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3504991_3505420_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3505416_3505800_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3505804_3506314_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3506294_3506510_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3506513_3506717_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3506716_3507181_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3507276_3507927_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3507930_3508989_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3509005_3509839_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3509981_3511748_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3511747_3512773_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3512834_3514577_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3514852_3515530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001316229.1|3515644_3515950_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3515888_3516077_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3516230_3518645_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3518641_3519499_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3519495_3519723_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3519722_3519956_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3520023_3520365_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3520328_3520529_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3520536_3521046_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3521078_3521300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3521445_3522324_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3522335_3523280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3523378_3524863_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_009483812.1|3524862_3525114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151720.1|3525281_3526334_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3526409:3526427	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 7
NZ_CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	3970979	4019045	5413765	integrase,tRNA,lysis,head,transposase	Escherichia_phage(25.45%)	66	3964657:3964703	4016117:4016163
3964657:3964703	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_087759376.1|3970979_3972100_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_004151249.1|3972669_3975147_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|3975133_3975529_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|3975525_3975996_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004165520.1|3975995_3976415_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
WP_004151253.1|3976514_3979961_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|3980053_3980557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|3980684_3981470_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|3981535_3982249_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|3982238_3982409_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|3982508_3982868_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|3982884_3983355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|3983648_3983903_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|3983905_3984661_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|3984836_3985514_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|3985566_3986319_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|3986387_3986780_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|3986776_3987202_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|3987204_3987567_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|3987566_3987740_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|3987739_3988120_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|3988122_3988362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|3988372_3989467_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|3989478_3989907_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|3989910_3991296_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|3991368_3991845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|3991886_3992891_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|3992865_3994287_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|3994299_3995772_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|3995771_3996374_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|3996744_3997074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|3997179_3997644_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|3997640_3998171_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|3998173_3998422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644626.1|3999158_4000205_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004151283.1|4000432_4001122_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4001118_4001649_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4001641_4001779_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|4001775_4002411_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4002403_4002574_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4002573_4003029_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151290.1|4003281_4003530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151291.1|4003529_4004177_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|4004349_4005192_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_102009029.1|4005298_4005805_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	58.7	1.1e-26
WP_004151295.1|4005801_4006095_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151296.1|4006094_4007525_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151297.1|4007514_4008414_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_001548453.1|4008638_4008860_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4008900_4009134_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4009261_4009951_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4010301_4010517_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151303.1|4010616_4010811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4010899_4011184_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|4011199_4012045_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|4012041_4012722_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4012718_4012877_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4012873_4013530_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4013526_4014294_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4014290_4014509_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4014510_4014726_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4014727_4015063_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_071531173.1|4015059_4016103_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.2	2.5e-177
WP_004143017.1|4016533_4017400_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4016117:4016163	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4017401_4017614_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4017659_4019045_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 8
NZ_CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	4228600	4240254	5413765	integrase	Enterobacteria_phage(70.0%)	13	4229050:4229064	4252107:4252121
WP_004144574.1|4228600_4229704_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4229050:4229064	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4229714_4230968_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4231320_4232511_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4232498_4233449_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4233448_4233874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4234442_4235009_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4235026_4235272_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4235268_4236006_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4236547_4236814_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4236810_4237368_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4237364_4237592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4237588_4237909_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4237920_4240254_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4252107:4252121	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 9
NZ_CP028783	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 chromosome, complete genome	5413765	5226954	5303850	5413765	tRNA,integrase,capsid,protease,tail,plate,head,portal,terminase	Enterobacteria_phage(35.71%)	84	5264391:5264432	5299628:5299669
WP_002883023.1|5226954_5228055_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_002883021.1|5228106_5228466_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_004151856.1|5228481_5229117_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_002883016.1|5229313_5230714_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_002883015.1|5230696_5231614_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_004146283.1|5231872_5233246_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_020314726.1|5233204_5233387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955164.1|5233345_5234122_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_002883013.1|5234128_5235133_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_002883011.1|5235246_5236398_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_004151857.1|5236656_5239308_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_002882986.1|5239351_5240002_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_002882984.1|5240149_5241013_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002882982.1|5241218_5241881_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	1.0e-27
WP_004146274.1|5241935_5243039_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_002882956.1|5243102_5243984_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002882952.1|5244127_5245015_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_002882948.1|5245243_5246152_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002882947.1|5246243_5246615_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_002882946.1|5246652_5248209_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	5.6e-08
WP_002882945.1|5248347_5249484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002882944.1|5249458_5251891_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_002882943.1|5251893_5253054_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_002882924.1|5253321_5253639_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_002882922.1|5253740_5253953_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_004151858.1|5254205_5256401_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_002882921.1|5256551_5257580_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_002882919.1|5257673_5258642_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002882918.1|5258733_5259264_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002882917.1|5259273_5260608_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
WP_085352923.1|5260671_5261598_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002882913.1|5261690_5262176_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002882911.1|5262237_5263200_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002882907.1|5263396_5264299_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
5264391:5264432	attL	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_004187281.1|5264655_5264901_+	hypothetical protein	NA	A0A0A7NPW2	Enterobacteria_phage	57.5	4.2e-19
WP_071526719.1|5264901_5265117_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_102009012.1|5265144_5265393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102009011.1|5265438_5266593_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	73.6	3.9e-163
WP_032414459.1|5266744_5267926_+|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.6	6.1e-156
WP_004187274.1|5267926_5268442_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
WP_032723923.1|5268493_5268793_+|tail	tail protein	tail	B9A7B2	Serratia_phage	72.7	2.2e-30
WP_050554917.1|5268813_5268966_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	1.5e-11
WP_102009010.1|5268955_5271691_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	79.0	5.6e-237
WP_064182245.1|5271702_5272191_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	60.5	7.5e-52
WP_102009009.1|5272288_5273362_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	45.5	2.5e-31
WP_102009008.1|5273376_5276712_-	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	31.7	1.5e-98
WP_064184526.1|5276708_5277317_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	45.9	4.7e-43
WP_064184509.1|5277309_5278209_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.5	4.3e-93
WP_004187254.1|5278195_5278564_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	57.4	2.3e-29
WP_064184510.1|5278560_5279145_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.6	9.6e-62
WP_102009007.1|5279144_5279786_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.8	1.4e-45
WP_004187249.1|5279782_5280241_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.8	3.1e-31
WP_064184512.1|5280385_5280781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102009006.1|5280777_5281329_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	6.8e-33
WP_102009005.1|5281325_5281607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064184514.1|5281597_5281798_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	64.6	2.3e-15
WP_102009004.1|5281797_5282295_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	69.7	2.2e-59
WP_064184516.1|5282397_5283258_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	68.4	1.0e-83
WP_064184517.1|5283304_5284354_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.9	2.3e-106
WP_102009003.1|5284377_5285211_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	1.1e-95
WP_060528038.1|5285371_5287093_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.5	4.3e-227
WP_032723905.1|5287113_5288148_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.9	3.1e-140
WP_047049910.1|5288580_5289414_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	83.4	6.7e-133
WP_047049912.1|5289410_5289626_-	hypothetical protein	NA	A0A1J0I2F3	Salmonella_phage	86.2	1.1e-18
WP_064172686.1|5289880_5290576_-	hypothetical protein	NA	A0A0M4S5U3	Salmonella_phage	69.8	1.2e-90
WP_047049914.1|5290679_5290895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102009002.1|5290891_5293519_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	53.6	1.3e-195
WP_102009001.1|5293511_5294516_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	58.6	2.3e-103
WP_102009000.1|5294816_5295704_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.2	9.1e-80
WP_102008999.1|5295696_5295891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102008998.1|5295887_5296115_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.6	1.4e-05
WP_048299728.1|5296123_5296672_-	3'-5' exoribonuclease	NA	NA	NA	NA	NA
WP_019724780.1|5296668_5296893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187204.1|5296962_5297235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032705924.1|5297249_5297480_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	68.6	1.5e-23
WP_048299726.1|5297495_5297714_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	9.6e-07
WP_032723883.1|5297740_5298013_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	84.4	1.1e-39
WP_004187199.1|5298166_5298460_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	58.8	7.3e-26
WP_102008997.1|5298529_5299510_+|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	83.3	2.4e-153
WP_002882903.1|5299694_5300198_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
5299628:5299669	attR	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_002882901.1|5300347_5301046_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_002882898.1|5301042_5302416_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882896.1|5302482_5303157_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882894.1|5303229_5303850_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
>prophage 1
NZ_CP028781	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence	159394	1727	66699	159394	protease,integrase,transposase	uncultured_Caudovirales_phage(26.32%)	58	NA	NA
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152067.1|4961_5885_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
WP_004197688.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|7416_8871_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004152071.1|11193_13197_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17548_19024_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19016_19697_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19886_21272_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21300_21654_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21767_23060_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23070_26217_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_102009024.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26870_29318_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29589_30327_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33115_34012_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34051_34432_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34436_35366_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35420_36101_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36097_37498_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37714_38149_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40302_40812_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41690_42017_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085903505.1|42016_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42735_43281_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43356_43719_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46184_46610_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46622_47912_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47959_49711_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49728_50091_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50140_50491_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53920_54403_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|54614_55961_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|57803_58766_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|58752_59502_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|59739_59937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59936_62732_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62846_63416_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|63450_63732_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_000019473.1|65718_66699_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
NZ_CP028781	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence	159394	71485	125678	159394	transposase	Escherichia_phage(25.0%)	60	NA	NA
WP_004153729.1|71485_72313_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|73168_73873_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044117068.1|75176_75845_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000018329.1|76034_76850_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|77000_77705_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004199403.1|77738_78095_-	hypothetical protein	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
WP_001549892.1|78097_78337_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_000343760.1|78438_79659_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549893.1|79747_80410_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|80790_81453_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001185481.1|81552_81837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000469598.1|82042_82354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043731.1|82389_82674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877224.1|82694_83048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001074369.1|83235_83679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348704.1|83687_84701_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001025390.1|86053_86569_+	DnaJ domain-containing protein	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
WP_000792381.1|86627_86864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000662998.1|86923_87475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004208549.1|87540_87753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000008707.1|87742_87985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001099725.1|88078_88417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016197627.1|88790_89006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348698.1|89250_89796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199101.1|89798_90959_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_000455437.1|91311_91821_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_001348696.1|91771_92008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953538.1|92053_92698_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000916156.1|92681_92972_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_015060057.1|92996_95750_+	type IV secretion/conjugal transfer ATPase PilX3-PilX4	NA	NA	NA	NA	NA
WP_000716326.1|95759_96530_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_000759841.1|96539_96797_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_000235886.1|96808_97864_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_004199085.1|98058_98787_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000783386.1|98792_99722_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_001295060.1|99718_100933_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000629109.1|100934_101132_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000650512.1|101128_102163_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_004208539.1|102159_104001_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_000738524.1|103997_104390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000754496.1|104477_104792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004208538.1|104877_105204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001215543.1|105200_105695_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
WP_000517490.1|105777_107040_+	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
WP_004199098.1|107043_109371_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
WP_001293458.1|109382_109838_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000351937.1|109875_110526_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_023408316.1|110798_110978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196235.1|110974_111796_+	sprT domain-containing protein	NA	NA	NA	NA	NA
WP_000510385.1|111905_112160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000557557.1|112177_112453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004221700.1|112515_112728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004221702.1|112685_112871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124025.1|117473_120461_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.4e-294
WP_000470623.1|120628_121264_+	recombinase family protein	NA	NA	NA	NA	NA
WP_047671991.1|121291_122128_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_008813494.1|122191_122590_-	VOC family protein	NA	NA	NA	NA	NA
WP_000842086.1|122631_123741_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
WP_001141270.1|123771_124047_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_023408311.1|124676_125678_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	2.6e-51
>prophage 1
NZ_CP028782	Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence	74017	6388	64447	74017	integrase,transposase	Escherichia_phage(33.33%)	54	8114:8173	60106:60927
WP_000227969.1|6388_7465_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
8114:8173	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|8177_8882_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023145375.1|9319_9634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|9572_10586_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|10877_11432_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001749986.1|11528_11981_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_001749985.1|12113_12587_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
WP_001749984.1|12767_13613_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
WP_000679427.1|13729_14077_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|14070_14910_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|15314_16856_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003833285.1|18162_18615_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_063866158.1|18656_19301_-	quinolone resistance pentapeptide repeat protein QnrB52	NA	NA	NA	NA	NA
WP_000259031.1|19791_20631_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|20560_20740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|20758_21259_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001297012.1|21564_21678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|21765_22530_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_024139167.1|22571_22784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749969.1|22796_24005_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|24038_25472_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|25853_26060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102009031.1|26064_26577_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|26601_27306_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071549086.1|27251_27512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039463.1|28057_28444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|28452_28644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|29655_30411_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_001327128.1|30411_30606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032445200.1|31089_31278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568020.1|31983_33399_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_023292098.1|33395_35123_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000608644.1|37252_38515_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_032277257.1|38764_39640_+	class A extended-spectrum beta-lactamase CTX-M-27	NA	A0A1B0VBP7	Salmonella_phage	100.0	1.2e-153
WP_012579081.1|39719_40643_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001141270.1|43219_43495_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842086.1|43525_44635_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
WP_008813494.1|44676_45075_+	VOC family protein	NA	NA	NA	NA	NA
WP_047671991.1|45138_45975_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000470623.1|46002_46638_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000124025.1|46805_49793_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.4e-294
WP_001138064.1|50127_53094_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_046788546.1|53102_53504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|53588_54293_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|55217_56102_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|56318_57533_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_000743213.1|57806_58031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|58027_58765_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001550559.1|58871_59363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|59396_60101_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000113282.1|60112_60769_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|60864_62049_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
60106:60927	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTAAGCTGCACCTCAAACCCCCGGATCAGGCTCTCCAGGCCATGCAGAAAGGCCTGCTCACCATCATCACTGTCCATAATCTGCAGCGCTTCCCGCAATAGCGGCGGCAGGTTTTCGTCCGGTGCTGCAGGGCGGTCGGTCAGGGCGGCAGTATGCTCCTGCTGCTCCAGTACGGCACCAAGGGTAAAATGACTGACCGCTGAAATCGCATATAACCCGTCGCGCAGTGAAAAGCCGTTTTCTGTCATAAAGCGTAACTGGGTTTCCACCGTATCATACTGTTTTTCATCAGGGCGGGTGCCGAGGTGCACTTTTGCCCCGTCACGGTAACGCAGCAGCGCCCGGCGGAAACTCATTGCATTATTGCGCAGAAATGACTGCCAGGATTCCCCCGCCGCAGGCAGTGAATAATCATGATGACGCGCCAGGATCTCCACCGCCAGCGCATCCAGTAACGCCCGTTTATTTTTCACATGCCAGTAAAGTGTCGGCTGTTCTATTCCCAGCTTCTGCGCCAGCTTGCGGGTCGTCAGCCCGTCAATCCCTGTCTCATTCAGCAGTTCCAGTGCCGCATCAATAACCGATTCTCTGTTCAGCCGTGCCATGACCGTCTCCTCCGATTTTCAGATTGACACTCTATCATTGATAGGGATATATTCCAACTCTATCAATGATAGGGAATTAACACAGGATCTGAAAAATGAATAAACCCGCTGTCATCGCGCTGGTGATTACACTGCTGGACGCGATGGGAATTGGTCTG	NA	NA	NA	NA
WP_000842134.1|62143_63253_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001067855.1|63742_64447_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
