The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	1187604	1196691	5553346	integrase	Enterobacteria_phage(85.71%)	10	1192539:1192554	1204795:1204810
WP_101837368.1|1187604_1189938_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.6	0.0e+00
WP_004098169.1|1189951_1190272_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_101837369.1|1190268_1190496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077267896.1|1190492_1191041_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	65.8	9.1e-30
WP_064160085.1|1191037_1191304_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	4.4e-30
WP_101837370.1|1191843_1192581_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.8	1.7e-71
1192539:1192554	attL	TCAGCGCGAGGCTGAC	NA	NA	NA	NA
WP_004136116.1|1192577_1192823_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_101837371.1|1192840_1193407_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	3.3e-59
WP_087847021.1|1194061_1195480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065806331.1|1195491_1196691_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.6	9.1e-107
1204795:1204810	attR	TCAGCGCGAGGCTGAC	NA	NA	NA	NA
>prophage 2
NZ_CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	1646672	1653598	5553346	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_032736203.1|1646672_1647536_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_012967575.1|1647546_1648320_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-26
WP_012541062.1|1648559_1649453_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	3.6e-15
WP_008804076.1|1649698_1651060_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.0e-207
WP_004201558.1|1651376_1652099_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_008804077.1|1652095_1653598_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
>prophage 3
NZ_CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	1925970	1991774	5553346	plate,protease,integrase,capsid,tRNA,terminase,head,portal,tail	Enterobacteria_phage(39.39%)	73	1927841:1927857	1963434:1963450
WP_008804296.1|1925970_1926666_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_008804297.1|1926704_1927286_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_032701002.1|1927491_1929177_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	1.0e-34
1927841:1927857	attL	TCAACGACAGCGGCGCG	NA	NA	NA	NA
WP_032746810.1|1929246_1930374_+	ribonuclease D	NA	NA	NA	NA	NA
WP_004103270.1|1930450_1930720_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_008804300.1|1930723_1931536_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_008804301.1|1931559_1932261_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004203320.1|1932387_1932669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012967776.1|1932685_1933345_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_008804304.1|1933439_1933886_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_032733265.1|1933894_1934239_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_008804305.1|1934389_1934920_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_012967777.1|1935048_1936599_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_012541278.1|1936847_1937567_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_004203310.1|1937641_1939174_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_008804309.1|1939495_1940794_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_012967778.1|1940803_1941874_+	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_101837125.1|1942015_1942456_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_101837126.1|1942448_1942946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837127.1|1942947_1943916_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	46.0	8.4e-79
WP_101837128.1|1943980_1944280_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	56.2	4.5e-23
WP_032737939.1|1944361_1944628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837251.1|1944656_1944869_+	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
WP_101837129.1|1944885_1945428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837130.1|1945414_1945600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837252.1|1945807_1946080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837131.1|1946148_1946373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837132.1|1946369_1946948_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	41.1	1.1e-33
WP_101837133.1|1946958_1947927_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	51.5	1.4e-78
WP_101837134.1|1948228_1949245_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	52.9	8.0e-96
WP_101837135.1|1949237_1951847_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.5	2.5e-194
WP_101837136.1|1952482_1953181_+	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	72.1	2.3e-94
WP_101837137.1|1953209_1953584_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101837138.1|1953669_1953933_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	40.2	3.2e-09
WP_101837139.1|1954490_1955543_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.8	9.3e-140
WP_101837140.1|1955542_1957264_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	65.5	2.9e-223
WP_101837141.1|1957424_1958258_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.1	3.2e-95
WP_101837142.1|1958282_1959332_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.5	4.4e-105
WP_101837143.1|1959378_1960293_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	76.5	4.7e-87
WP_101837144.1|1960395_1960893_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	70.3	4.5e-60
WP_040150909.1|1960892_1961093_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	66.2	5.1e-15
WP_044784790.1|1961083_1961365_+	hypothetical protein	NA	B9A7B8	Serratia_phage	57.1	1.4e-18
WP_101837145.1|1961361_1961913_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	40.8	1.7e-28
WP_101837146.1|1961909_1962305_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_101837147.1|1962449_1962908_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	46.4	4.0e-31
WP_101837148.1|1962904_1963546_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.3	2.0e-44
1963434:1963450	attR	TCAACGACAGCGGCGCG	NA	NA	NA	NA
WP_063106279.1|1963545_1964130_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	63.5	1.2e-64
WP_063106280.1|1964126_1964495_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.3	8.0e-30
WP_101837149.1|1964481_1965381_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.9	2.5e-93
WP_101529203.1|1965373_1965976_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	48.1	5.1e-42
WP_101837150.1|1968402_1969476_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	47.0	4.5e-33
WP_023279573.1|1969603_1970092_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.1	6.8e-53
WP_101837151.1|1970101_1972822_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	47.7	1.2e-127
WP_071836356.1|1972802_1972979_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	3.0e-11
WP_101837152.1|1972975_1973275_-|tail	phage tail protein	tail	B9A7B2	Serratia_phage	75.8	3.7e-33
WP_063106287.1|1973329_1973845_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.2	3.4e-63
WP_101529200.1|1973844_1975026_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	68.8	2.6e-154
WP_101837253.1|1975179_1976334_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	81.2	1.3e-179
WP_087796135.1|1976378_1976627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837153.1|1976642_1976852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008804311.1|1976982_1978716_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_008804312.1|1978808_1979723_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_008804313.1|1979898_1980510_+	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
WP_048964631.1|1980558_1981383_-	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_012541282.1|1981395_1982247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086892582.1|1982426_1984547_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_048964632.1|1984807_1986541_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_072123014.1|1986539_1986767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044649605.1|1986738_1987653_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004180417.1|1987836_1989276_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_002910835.1|1989269_1990199_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_008804319.1|1990195_1991011_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_008804320.1|1991027_1991774_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	2758011	2768892	5553346		Escherichia_phage(87.5%)	9	NA	NA
WP_101837240.1|2758011_2761119_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.3	0.0e+00
WP_008804978.1|2761173_2762439_+	MFS transporter	NA	NA	NA	NA	NA
WP_023322574.1|2762469_2763558_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	98.3	6.3e-208
WP_008804980.1|2763644_2763905_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	95.3	3.0e-39
WP_023297577.1|2764199_2765060_+	class A beta-lactamase LEN-16	NA	A0A077SL40	Escherichia_phage	90.6	1.8e-144
WP_008804982.1|2765077_2765839_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
WP_008804983.1|2766099_2767002_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.7	1.1e-157
WP_023322572.1|2767013_2768279_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.6	6.8e-230
WP_012541792.1|2768271_2768892_+	aldolase	NA	A0A077SK32	Escherichia_phage	98.1	5.7e-113
>prophage 5
NZ_CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	2860194	2902502	5553346	holin,tail,integrase,head	Salmonella_phage(34.04%)	66	2858369:2858383	2862806:2862820
2858369:2858383	attL	GCGGCGATACGCGCC	NA	NA	NA	NA
WP_046619555.1|2860194_2861295_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	57.1	1.2e-116
WP_101837248.1|2861380_2861698_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	6.9e-22
WP_101837249.1|2861697_2861937_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	2.8e-15
WP_072060349.1|2862195_2862570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105322436.1|2862607_2864977_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	46.4	4.8e-19
2862806:2862820	attR	GGCGCGTATCGCCGC	NA	NA	NA	NA
WP_058343134.1|2865087_2865270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837483.1|2865269_2866151_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	61.1	4.3e-29
WP_032454856.1|2866150_2866924_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.1	1.1e-76
WP_025269941.1|2866920_2868117_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	6.6e-158
WP_004152573.1|2868116_2868470_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_101837484.1|2868471_2869125_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	5.9e-60
WP_064168817.1|2869187_2869550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064168818.1|2869553_2869790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837485.1|2869786_2870347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837486.1|2870484_2870829_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	48.7	8.8e-23
WP_046659638.1|2870825_2871854_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.8	2.3e-98
WP_004152568.1|2871856_2872159_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_101837487.1|2872159_2872759_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	7.6e-54
WP_101837488.1|2872758_2874684_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	71.3	2.1e-182
WP_064165570.1|2874673_2874826_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	82.0	5.4e-17
WP_000393949.1|2874867_2875317_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	55.3	1.1e-36
WP_032454867.1|2875320_2875761_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	78.8	2.8e-61
WP_101837489.1|2875771_2876923_-	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	1.6e-177
WP_064144275.1|2876924_2877476_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	1.5e-40
WP_101837490.1|2877468_2877873_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	70.8	2.4e-43
WP_101837491.1|2877872_2878379_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	36.6	5.3e-16
WP_101837492.1|2878375_2878795_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	2.2e-39
WP_048265720.1|2878763_2879045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064162782.1|2879084_2880026_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	78.1	9.2e-139
WP_025269955.1|2880037_2880532_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.4	1.4e-50
WP_101837493.1|2880535_2881738_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	5.3e-107
WP_101837494.1|2881789_2882338_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.4e-49
WP_101837495.1|2882393_2883845_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	69.0	3.2e-191
WP_101837530.1|2883848_2885462_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	82.9	5.2e-275
WP_029498730.1|2885555_2885747_+	YegP family protein	NA	NA	NA	NA	NA
WP_101837496.1|2886006_2886480_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	68.4	3.9e-53
WP_101837497.1|2886511_2887147_-	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	2.3e-101
WP_130997663.1|2887228_2887447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837498.1|2887702_2888092_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	49.6	2.0e-23
WP_101837531.1|2888088_2888586_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	81.8	6.9e-77
WP_012542609.1|2888563_2888833_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_124060769.1|2888992_2889514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837499.1|2889882_2890461_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	7.1e-49
WP_101837500.1|2890457_2891117_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	78.1	2.2e-99
WP_023158891.1|2891113_2891419_-	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	57.4	1.2e-23
WP_046619486.1|2891940_2892186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837501.1|2892261_2892585_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	51.2	2.3e-12
WP_101837502.1|2892581_2892944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837503.1|2892936_2894001_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	72.4	7.4e-145
WP_101837504.1|2893997_2894786_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	2.9e-61
WP_046619476.1|2894778_2895000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837505.1|2894999_2895395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837506.1|2895421_2896471_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	49.6	2.7e-30
WP_101837507.1|2896467_2896722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837508.1|2896917_2897238_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	6.5e-36
WP_032428570.1|2897277_2897499_-	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	55.7	8.2e-14
WP_101837509.1|2897597_2898230_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	36.9	1.9e-34
WP_101837510.1|2898647_2898872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837511.1|2899083_2899377_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_124053771.1|2899449_2899671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837512.1|2899679_2900243_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	38.3	6.3e-26
WP_101837513.1|2900239_2900464_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	63.5	2.3e-19
WP_101837514.1|2900460_2900805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837515.1|2900797_2901421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837516.1|2901417_2902122_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.2	5.4e-27
WP_016530209.1|2902241_2902502_+	hypothetical protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
>prophage 6
NZ_CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	3021084	3080494	5553346	holin,coat,terminase,tRNA,tail	Salmonella_phage(26.92%)	74	NA	NA
WP_101837573.1|3021084_3022149_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	6.1e-14
WP_101139497.1|3022616_3024956_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	76.3	4.0e-50
WP_101837555.1|3025032_3028101_-	kinase	NA	A0A286S259	Klebsiella_phage	96.5	0.0e+00
WP_064149192.1|3028097_3028478_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	95.2	4.0e-69
WP_101837556.1|3028487_3028970_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	2.0e-81
WP_004190622.1|3029150_3029615_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.0e-58
WP_101837565.1|3029614_3032413_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.6	4.1e-94
WP_108112584.1|3033306_3033828_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	57.3	8.1e-28
WP_101837557.1|3034136_3034550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837558.1|3034549_3035284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142777051.1|3035881_3036079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026005925.1|3036216_3036699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837560.1|3036739_3037672_-	hypothetical protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	3.4e-24
WP_004190640.1|3037695_3038088_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_012967909.1|3038084_3038636_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
WP_101837561.1|3038637_3039021_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	46.0	2.4e-21
WP_101837562.1|3039022_3039433_-	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	39.0	1.0e-09
WP_072122527.1|3039436_3039649_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	53.7	1.2e-09
WP_101837563.1|3039688_3040825_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	76.2	5.3e-157
WP_004184465.1|3040912_3041677_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	59.4	1.1e-76
WP_101837564.1|3041783_3042896_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.3	3.4e-108
WP_040217570.1|3042879_3044304_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.5	1.3e-192
WP_064142012.1|3044308_3045613_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.3	1.7e-146
WP_101139502.1|3045590_3046586_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.8	3.8e-34
WP_016160813.1|3047146_3047392_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	5.5e-35
WP_077249691.1|3047546_3047738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042921403.1|3048666_3049026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139015922.1|3049579_3049699_+	small membrane protein	NA	NA	NA	NA	NA
WP_133124690.1|3050007_3050280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032735912.1|3050377_3050662_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	74.5	8.6e-32
WP_012967895.1|3050747_3050930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101139504.1|3051135_3051762_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.8	9.9e-89
WP_015958299.1|3051761_3052043_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	2.2e-32
WP_004213330.1|3052029_3052425_-	membrane protein	NA	G8C7V8	Escherichia_phage	73.1	1.5e-45
WP_050888101.1|3053116_3053503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099761808.1|3053527_3053749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101139505.1|3053877_3054675_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	77.0	5.4e-116
WP_105322434.1|3054677_3054809_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	73.7	2.3e-08
WP_101837395.1|3054805_3055162_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	66.9	4.7e-43
WP_101139507.1|3055158_3055455_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	3.5e-36
WP_073984484.1|3055457_3055664_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	74.2	2.1e-24
WP_015958295.1|3055663_3056260_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.6	4.2e-89
WP_050888087.1|3056295_3056529_-	hypothetical protein	NA	A0A0M4R5D9	Salmonella_phage	54.5	2.9e-17
WP_132349619.1|3056625_3056892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179624.1|3057008_3057452_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101139508.1|3057605_3059591_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.5	2.2e-206
WP_050888085.1|3059587_3059845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073984483.1|3059844_3060423_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_050888084.1|3060445_3060682_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	51.5	5.1e-14
WP_101139509.1|3061267_3061603_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
WP_101139510.1|3061610_3062360_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	81.1	1.3e-116
WP_041937713.1|3062362_3063202_-	hypothetical protein	NA	Q8HA96	Salmonella_phage	51.3	1.5e-23
WP_101837396.1|3063267_3064062_-	ParB/RepB/Spo0J family partition protein	NA	C7BGF1	Burkholderia_phage	51.3	1.8e-63
WP_101139512.1|3064190_3064727_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	72.3	5.0e-65
WP_023322439.1|3064717_3064957_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	79.2	4.4e-29
WP_101139513.1|3065060_3065447_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	92.1	4.7e-57
WP_133124691.1|3065597_3066506_+	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	47.4	1.6e-71
WP_133124692.1|3067014_3067278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064142429.1|3067241_3067511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004179600.1|3067801_3067993_+	YebW family protein	NA	NA	NA	NA	NA
WP_101139515.1|3068001_3068157_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	71.2	9.8e-14
WP_101139516.1|3068294_3071399_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	58.5	1.1e-292
WP_071582744.1|3071411_3072500_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	53.0	6.1e-102
WP_085848752.1|3072534_3072888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101139518.1|3072880_3073492_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	74.2	3.2e-39
WP_101139519.1|3073488_3073797_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
WP_004179594.1|3073804_3074044_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	84.6	9.4e-32
WP_004179593.1|3074108_3074321_+	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	71.8	8.4e-24
WP_101139520.1|3074321_3075560_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	67.1	4.6e-162
WP_004203988.1|3075608_3076544_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.1	1.4e-139
WP_101837397.1|3076589_3077963_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	6.6e-53
WP_008805152.1|3078488_3079472_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_071787535.1|3079516_3079732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086893113.1|3079750_3080494_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	3.2e-17
>prophage 7
NZ_CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	3394230	3423055	5553346	protease,holin,terminase,capsid,head,portal,tail	Enterobacteria_phage(24.14%)	35	NA	NA
WP_105322435.1|3394230_3396576_-	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	73.6	6.0e-46
WP_101837568.1|3396650_3399728_-	kinase	NA	A0A286S259	Klebsiella_phage	62.0	0.0e+00
WP_063105766.1|3399724_3400105_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	2.7e-57
WP_021441639.1|3400117_3400594_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	3.7e-51
WP_004884312.1|3400580_3401054_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_101837569.1|3401075_3404462_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	2.5e-303
WP_016530182.1|3404522_3404756_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_023317588.1|3404829_3405135_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_101837570.1|3405137_3405542_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	52.3	1.7e-28
WP_101837571.1|3405572_3406277_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	65.7	1.6e-79
WP_025713381.1|3406333_3406681_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.9	1.8e-31
WP_040241939.1|3406677_3407127_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	5.1e-63
WP_072071528.1|3407123_3407462_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	1.2e-37
WP_032734570.1|3407474_3407807_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_038808150.1|3407812_3408067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063105769.1|3408112_3409333_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	1.7e-140
WP_025713387.1|3409342_3410050_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
WP_038808148.1|3410025_3411345_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	3.8e-138
WP_025713389.1|3411351_3413088_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
WP_038808146.1|3413041_3413506_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	4.8e-48
WP_063105770.1|3413685_3414027_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	2.1e-48
WP_065908532.1|3414719_3414965_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	95.1	4.6e-34
WP_077249691.1|3415119_3415311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065908530.1|3416235_3416601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063105772.1|3416809_3417160_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	37.7	1.1e-09
WP_065908528.1|3417156_3417654_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	86.4	2.3e-80
WP_017880269.1|3417653_3417869_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_141691361.1|3418905_3419025_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3419789_3419993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837299.1|3420236_3420839_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.5	1.2e-75
WP_101837298.1|3420855_3421887_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	6.2e-96
WP_101837297.1|3421886_3422090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837296.1|3422086_3422479_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	34.7	1.5e-10
WP_101837295.1|3422519_3422810_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
WP_012542186.1|3422821_3423055_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
>prophage 8
NZ_CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	3684082	3693530	5553346	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_086893000.1|3684082_3685804_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	2.0e-14
WP_008805841.1|3685843_3686548_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3686899_3687118_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012542332.1|3687236_3689516_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
WP_002896520.1|3689546_3689864_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3690189_3690411_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_008805839.1|3690477_3692418_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	2.9e-38
WP_008805838.1|3692414_3693530_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 9
NZ_CP027064	Klebsiella variicola strain WCHKV030666 chromosome, complete genome	5553346	4197110	4210998	5553346	integrase	Morganella_phage(20.0%)	16	4208299:4208312	4209622:4209635
WP_101837451.1|4197110_4197779_+	dTMP kinase	NA	G3MB74	Bacillus_virus	36.4	9.4e-29
WP_148253307.1|4197781_4198702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148253309.1|4198706_4199333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837452.1|4200342_4203099_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	54.8	1.5e-285
WP_101837453.1|4203091_4203442_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	68.2	6.4e-37
WP_101837454.1|4203452_4204097_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.2	1.5e-28
WP_100697858.1|4204089_4204305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101837455.1|4204310_4204622_-	ubiquinol-cytochrome C reductase	NA	NA	NA	NA	NA
WP_101837470.1|4204618_4205323_-	ash family protein	NA	Q8SBF3	Shigella_phage	57.3	9.9e-21
WP_100697854.1|4205454_4205634_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_101837456.1|4205626_4206469_-	antA/AntB antirepressor family protein	NA	A0A1U9AJ93	Stx1_converting_phage	44.0	1.2e-20
WP_101837457.1|4206482_4206914_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	44.7	5.0e-23
WP_101837458.1|4206913_4207111_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.6	3.0e-07
WP_101837459.1|4207310_4208192_-	hypothetical protein	NA	NA	NA	NA	NA
4208299:4208312	attL	GTCTACTATCGTCT	NA	NA	NA	NA
WP_101837471.1|4208323_4209550_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.9	2.8e-127
WP_004143017.1|4210131_4210998_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4209622:4209635	attR	AGACGATAGTAGAC	NA	NA	NA	NA
>prophage 1
NZ_CP027063	Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence	236161	162735	223885	236161	transposase,integrase	Shigella_phage(40.0%)	55	175623:175682	201062:202291
WP_048264963.1|162735_164266_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	5.9e-50
WP_000994210.1|167655_168198_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_048264961.1|168211_168709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048265023.1|168705_170469_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_048264960.1|170470_171718_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_077258344.1|171714_172890_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_077258367.1|173287_173485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048264996.1|173817_174087_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_072198182.1|174094_174622_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_064167953.1|174705_175014_+	hypothetical protein	NA	NA	NA	NA	NA
175623:175682	attL	TGAATCGCCACGGATAATCTAGACACTTCCGAGCCGTTGATAATACTGGTTTTCATATTC	NA	NA	NA	NA
WP_088476848.1|175640_176788_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	5.9e-148
WP_088476847.1|176807_177173_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_126034233.1|177321_177627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048291886.1|177948_178734_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	1.0e-50
WP_004197633.1|180107_180413_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_015632547.1|180414_180633_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_072060593.1|180684_180870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048265005.1|180911_182285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088476846.1|182373_182589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023345594.1|182626_183055_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_023345593.1|183167_184013_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023345592.1|184115_184511_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023345591.1|184622_185207_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048291887.1|185274_186117_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023345588.1|186534_186765_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023345587.1|186761_187178_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_023345586.1|187269_188673_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_048291888.1|188682_190557_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_023345584.1|190945_191581_-	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_077258347.1|191619_192825_-	MFS transporter	NA	NA	NA	NA	NA
WP_023345582.1|192909_193680_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023345581.1|194033_195473_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_023345580.1|195533_196430_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023345579.1|196529_197711_+	MFS transporter	NA	NA	NA	NA	NA
WP_023345578.1|197829_198438_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_048265000.1|198535_199438_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088476848.1|199955_201102_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	5.9e-148
WP_004181920.1|203280_204636_-	hypothetical protein	NA	NA	NA	NA	NA
201062:202291	attR	GAATATGAAAACCAGTATTATCAACGGCTCGGAAGTGTCTAGATTATCCGTGGCGATTCAAACTGTCAGAATTAGAGAACCCATTCTGTATCACATTAGACTCAAGCTTTGCTATGTCTTTGGCAAATCCATCACCATTTTTCATCGCACTTAACAGATTGTCAGTTAAGCCTTTTTTTACCCTATCAGATAGTTGACTGTTATTTTGTATGCTAGCCGCTATGTTTCCAACCAAATTACCTACAGAGCCACTCCCACCTCCTCCTTTAGCTTTACCTCCTAGGCTAAAACCTAAGCTAGCCATACCACCAAGTACAGCTGCAGCTGCCATAGATTGGAGAGCTTCCGCGGATACTCCAACGTCTTTCCCGAGACTACCGGTCATTGCGGCCGCAACGTCAGTAACAGCCTTCATTCCACCCTGGTTTGTTGAGCCTGCTGTTTGCGTTCGACTGCCTTGCATTCCACTGGTCCAAGCTTCATTAAAAGCCTGCCTTGAGCTGAGCGTGGACAATCTGTCGGTCCCTATCGAGTGCTGCCCTGCTGCGTTAACGGTATCACTTAACGATGACCCCAACCCAAGCGTTGGCATCATCCTGGTCGGAGAATCCAGAAGCCCGCCAGATGATATACCTCCACCGGTTGCAGTGGCTGCTGTGTGTGTCTGGTCACCAAAGGACTGTTTACCCGCATTACCCGCCGACCACACTTCTGGTGTGACATGTCCAGTATTGGCAGGAGCATCCGGAGTCACATTTTTCAACGCCCCCATCATCGGGTGGATGCTGGTGGTCAACAGGAACAGCGTCAGCATCGGCACCATGCAATACAGCGCTGAAGCTACTGACAGGTAGCTGCCGTACGTCTCCTGAATACTCCCCATATTCGCCCAGTTCATAGTGGTCTGTACACCCAGCGATGACCATGTGTCAAACTGCTGATTCAATACCATTTTTACGTATGCGTTGACCATGACCGCCGTTATCGGCCACATGTTAACGAATACAATCAGCTGCAGATACTTTGCTGCTGAAGTTATACCTTCCCCCCCTAAAAACAGGATCGCAATCAGGGCAAAGGGGGCAACCATGTAGCTGAACATTTCCAGAAACGATATTGCAGCGCCTGAGATGTTCAGCCAGAGTTGCCCCTGACTGACCATGGCGTTGGTACGTTTCATGCTCGCTTCGAAAAGCTGGTAGTCAGCCGCTATACCCAACGACTTGCGAT	NA	NA	NA	NA
WP_048291881.1|204679_205717_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_072060590.1|206082_206625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065809520.1|208706_209171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048291879.1|209170_209959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065809521.1|209972_212915_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_004181906.1|213383_213740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065809522.1|214581_214929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126034224.1|215011_215449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048291875.1|215544_216612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048291874.1|216680_216977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032719541.1|217210_217588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118124.1|219363_219525_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_021312536.1|219867_220353_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|220340_220607_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_101837567.1|220739_221201_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_088476786.1|222597_222753_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101837575.1|222765_223885_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
