The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	1099891	1107031	4883927		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1099891_1100530_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001521147.1|1100526_1101789_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847993.1|1101785_1102694_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001295181.1|1102889_1103657_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141345.1|1103707_1104364_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272917.1|1104469_1107031_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 2
NZ_CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	1143332	1230667	4883927	portal,tail,terminase,holin,plate,integrase,capsid,head,tRNA,lysis	Erwinia_phage(22.92%)	91	1167834:1167848	1213450:1213464
WP_000047170.1|1143332_1145963_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1146197_1146383_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_001521122.1|1147674_1148241_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287454.1|1148237_1148666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521120.1|1148738_1150295_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130211.1|1150444_1150960_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1151023_1152562_-	multidrug effux MFS transporter subunit EmrB	NA	NA	NA	NA	NA
WP_020233875.1|1152578_1153751_-	multidrug export protein EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1153877_1154408_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000119745.1|1154498_1154834_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1154823_1155561_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000165699.1|1155684_1156869_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216531.1|1157321_1158314_-	proline/glycine betaine ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774965.1|1158371_1159436_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_000985494.1|1159428_1160631_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_001327587.1|1160620_1160869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001521117.1|1160987_1161947_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.0e-134
WP_020233016.1|1161956_1164101_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.2e-196
WP_001521113.1|1164082_1164484_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	3.4e-18
WP_001223227.1|1164480_1164726_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001316582.1|1164973_1165303_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1165454_1165799_+	DUF2002 family protein	NA	NA	NA	NA	NA
WP_000492658.1|1165835_1166285_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1166951_1167356_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229454.1|1167402_1167927_-	rhodanese-like domain-containing protein YgaP	NA	NA	NA	NA	NA
1167834:1167848	attL	GAAGATATTCATCAG	NA	NA	NA	NA
WP_000137280.1|1167936_1168236_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1168418_1168577_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522417.1|1168660_1169110_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
WP_000156814.1|1169110_1169773_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|1169793_1171194_-	GABA permease	NA	NA	NA	NA	NA
WP_000097652.1|1171431_1172712_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
WP_000772878.1|1172725_1174174_-	NADP-dependent succinate-semialdehyde dehydrogenase I	NA	NA	NA	NA	NA
WP_020233013.1|1174196_1175465_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001521107.1|1175484_1176462_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_001521106.1|1176798_1179051_-	alpha-amylase	NA	NA	NA	NA	NA
WP_023223216.1|1179843_1180062_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
WP_052935598.1|1180101_1181295_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.4	1.3e-166
WP_052935599.1|1181297_1181762_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	74.8	1.7e-61
WP_052935600.1|1181773_1184203_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	67.8	7.6e-270
WP_000763326.1|1184195_1184315_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_023223220.1|1184347_1184629_-|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
WP_052935601.1|1184691_1185210_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
WP_052935602.1|1185222_1186410_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	80.5	2.6e-183
WP_052935603.1|1186541_1186955_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	45.7	4.0e-22
WP_052935604.1|1188123_1188735_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	83.1	1.8e-95
WP_052935605.1|1188727_1189636_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.5	3.0e-134
WP_052935606.1|1189640_1189988_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	71.3	4.3e-41
WP_052935607.1|1189984_1190626_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.1	1.5e-95
WP_071940771.1|1190741_1191827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052935783.1|1191832_1192282_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	72.7	8.5e-50
WP_052935784.1|1192274_1192742_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	1.7e-56
WP_072129562.1|1192704_1192950_-|holin	holin	holin	S4TNY4	Salmonella_phage	71.8	9.4e-27
WP_052935785.1|1192849_1193263_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	67.2	5.4e-43
WP_000534554.1|1193259_1193769_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000524754.1|1193752_1193974_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|1193964_1194168_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177981.1|1194167_1194668_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	2.9e-59
WP_052935786.1|1194765_1195524_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	66.3	1.3e-79
WP_052935787.1|1195527_1196688_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	63.1	2.5e-130
WP_052935788.1|1196709_1197573_-|capsid	capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.2	3.4e-103
WP_052935789.1|1197737_1199507_+	oxidoreductase	NA	A0A0M4RE51	Salmonella_phage	80.5	1.9e-286
WP_052935790.1|1199506_1200544_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.0	5.9e-163
WP_071940769.1|1201010_1202228_-	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	29.6	4.4e-32
WP_071940803.1|1202516_1202699_-	Tum protein	NA	A0A218M4I0	Erwinia_phage	75.9	3.2e-16
WP_052935632.1|1202842_1205083_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	92.5	0.0e+00
WP_071940768.1|1205096_1205405_-	DUF3850 domain-containing protein	NA	A0A1S6KVH3	Escherichia_phage	43.2	1.6e-07
WP_052935633.1|1205401_1205629_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	70.7	4.8e-25
WP_052935634.1|1205628_1205856_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	90.7	2.3e-27
WP_052935635.1|1205925_1206126_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	89.4	1.1e-28
WP_052935636.1|1206112_1206340_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	92.0	1.6e-33
WP_052935637.1|1206347_1206857_-	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	1.2e-89
WP_001630878.1|1206887_1207151_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_052935638.1|1207283_1207859_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	1.2e-67
WP_052935639.1|1207858_1208863_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	97.6	2.2e-191
WP_052935640.1|1208873_1210337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001521105.1|1211383_1212838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019842420.1|1213291_1213435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001520337.1|1219860_1220343_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
1213450:1213464	attR	GAAGATATTCATCAG	NA	NA	NA	NA
WP_000600189.1|1220474_1220951_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_001117838.1|1220940_1221231_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1221292_1221634_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001520336.1|1221782_1223444_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001520335.1|1223529_1224408_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_009008281.1|1224339_1224534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296310.1|1224530_1225124_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001307349.1|1225178_1226420_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_001338897.1|1226485_1227277_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1227443_1228805_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1229053_1229302_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1229320_1229869_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264781.1|1229899_1230667_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	1514521	1602142	4883927	protease,transposase,portal,tail,terminase,holin,tRNA	Enterobacteria_phage(48.08%)	95	NA	NA
WP_000749077.1|1514521_1514713_-	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
WP_001706457.1|1514869_1515616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023149819.1|1515617_1516904_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	37.3	3.2e-65
WP_001163428.1|1517156_1517357_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206734.1|1517488_1517794_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_001242749.1|1517793_1518156_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_048949115.1|1518146_1518683_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	3.7e-100
WP_000081287.1|1518810_1519635_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|1519700_1520063_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_029379673.1|1520135_1520360_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	3.2e-13
WP_101975739.1|1520268_1520613_+	hypothetical protein	NA	U5P0J5	Shigella_phage	96.5	4.1e-60
WP_000016389.1|1520531_1520966_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_012602729.1|1520937_1521159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450735.1|1521391_1522018_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|1522115_1522316_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|1522353_1522905_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_071524868.1|1522852_1523053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001250269.1|1523080_1523260_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104942.1|1523249_1524191_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_086714481.1|1524187_1524682_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	8.6e-88
WP_077248231.1|1524648_1525008_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	3.5e-54
WP_001398927.1|1525004_1525394_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_086714479.1|1525413_1526223_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	1.8e-151
WP_065406823.1|1526230_1527220_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	5.6e-195
WP_086714417.1|1527234_1527600_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	4.5e-57
WP_086714419.1|1527804_1528800_-|protease	serine protease	protease	NA	NA	NA	NA
WP_001120496.1|1529254_1529581_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_063118736.1|1529584_1530061_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.3	1.1e-82
WP_077879380.1|1530277_1530460_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	7.2e-16
WP_021576768.1|1530550_1530844_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_077784971.1|1531524_1532064_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	4.0e-94
WP_000507030.1|1532072_1534172_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.4	0.0e+00
WP_039268529.1|1534168_1534381_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	3.2e-31
WP_001459763.1|1534380_1535856_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.0e-281
WP_086714422.1|1535833_1537861_+	peptidase S14	NA	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_001322266.1|1537902_1538271_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
WP_001283153.1|1538263_1538539_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677106.1|1538550_1539129_+|tail	tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_023148639.1|1539125_1539527_+|tail	phage tail protein	tail	K7PJP5	Enterobacteria_phage	100.0	1.1e-72
WP_000211106.1|1539537_1540281_+|tail	tail protein	tail	K7PGT7	Enterobacteria_phage	100.0	1.6e-133
WP_001298500.1|1540341_1540728_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|1540736_1541066_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_052939672.1|1541037_1544112_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	94.7	0.0e+00
WP_000847345.1|1544108_1544438_+|tail	tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152612.1|1544437_1545136_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_025670561.1|1545140_1545884_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_086714477.1|1545781_1546423_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.0	7.8e-97
WP_103042706.1|1546900_1550314_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.5	0.0e+00
WP_086714457.1|1550384_1550984_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.0	2.4e-108
WP_001118619.1|1555366_1556290_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_086714430.1|1556943_1558104_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.0	2.5e-218
WP_000368131.1|1558415_1559348_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_001296263.1|1559445_1559616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|1559641_1560397_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_001520954.1|1560575_1561823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101975693.1|1562188_1563529_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001303604.1|1563564_1563816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296261.1|1563900_1564185_+	DUF406 family protein	NA	NA	NA	NA	NA
WP_000531924.1|1564365_1565676_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000425037.1|1565675_1567820_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|1568022_1568508_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
WP_000033306.1|1569169_1569736_+	fimbrial protein	NA	NA	NA	NA	NA
WP_020232969.1|1569819_1572459_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_000170521.1|1572478_1573228_+	fimbrial protein StfD	NA	NA	NA	NA	NA
WP_000826023.1|1573243_1573735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000826833.1|1573731_1574211_+	fimbrial protein SteE	NA	NA	NA	NA	NA
WP_101975692.1|1574207_1574753_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001520950.1|1574754_1575618_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730805.1|1575687_1576239_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001309606.1|1576404_1577337_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|1577371_1578457_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001043827.1|1578460_1579285_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001520948.1|1579284_1580094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001089216.1|1580093_1580642_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|1580675_1580954_+	YfcL family protein	NA	NA	NA	NA	NA
WP_001520946.1|1581009_1583016_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1583174_1584395_+	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127789.1|1584670_1585849_+	arabinose transporter	NA	NA	NA	NA	NA
WP_001520944.1|1585845_1586841_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699144.1|1586939_1588076_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.0e-23
WP_001289165.1|1588141_1589155_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|1589154_1589967_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001520941.1|1590049_1590709_+	DedA family protein	NA	NA	NA	NA	NA
WP_000118404.1|1590864_1591779_+	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
WP_001520938.1|1591848_1593117_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000157005.1|1593106_1593757_+	cell division protein DedD	NA	NA	NA	NA	NA
WP_000262113.1|1594015_1594504_+	colicin V production protein	NA	NA	NA	NA	NA
WP_000334221.1|1594540_1596058_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
WP_001520936.1|1596152_1596722_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000748261.1|1596987_1597770_+	lysine/arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000737631.1|1597990_1598773_+	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_001520934.1|1598862_1599549_+	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
WP_000569958.1|1599545_1600262_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
WP_001293612.1|1600269_1601043_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_001520932.1|1601239_1602142_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.2	2.4e-67
>prophage 4
NZ_CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	1898639	1905068	4883927		Enterobacteria_phage(33.33%)	6	NA	NA
WP_000043542.1|1898639_1900046_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_000699390.1|1900269_1901334_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	7.5e-105
WP_000676430.1|1901360_1902230_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	3.4e-111
WP_000698222.1|1902261_1903152_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	5.6e-29
WP_001021401.1|1903166_1903721_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	3.3e-51
WP_000704810.1|1903901_1905068_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	7.0e-112
>prophage 5
NZ_CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	2800548	2855633	4883927	protease,transposase,portal,tail,terminase,holin,capsid,head,tRNA,integrase	Escherichia_phage(41.67%)	68	2808740:2808754	2855735:2855749
WP_001297484.1|2800548_2801655_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2801690_2802332_+	lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2802335_2803706_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2803874_2804546_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2804545_2806006_+	sensor protein PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2806081_2807203_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
WP_000359434.1|2807251_2808478_-	peptidase T	NA	NA	NA	NA	NA
WP_001299275.1|2808533_2808749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000531594.1|2808727_2809864_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2808740:2808754	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2809847_2810711_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_041983107.1|2811307_2811934_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_085948620.1|2812048_2813262_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_042047081.1|2813484_2814015_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_085948620.1|2814016_2815229_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001233546.1|2818620_2819220_-	hypothetical protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|2819287_2822767_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_072199988.1|2822827_2823475_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	2.6e-108
WP_001333568.1|2823372_2824116_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|2824121_2824820_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|2824819_2825176_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|2825153_2828381_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|2828427_2828688_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|2828729_2829116_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097535.1|2829115_2829820_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|2829880_2830225_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|2830221_2830671_-	hypothetical protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2830667_2831006_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|2831014_2831332_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|2831408_2832626_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|2832640_2833240_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923134.1|2833232_2834459_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|2834606_2836364_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2836363_2836846_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2836992_2837343_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_071586179.1|2837635_2837776_-	Rz1 lytic protein	NA	U5P461	Shigella_phage	84.6	1.0e-09
WP_000738421.1|2837868_2838162_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2838252_2838435_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_075202332.1|2838487_2838715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992097.1|2838651_2839185_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2839248_2839599_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2839603_2839819_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001333561.1|2839968_2840130_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000874243.1|2840126_2840315_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2840575_2840911_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2840981_2841194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2841682_2841769_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_000762879.1|2842163_2842985_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|2842981_2843362_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2843362_2844421_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2844422_2844701_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2844868_2845081_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000786213.1|2845283_2845463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224662.1|2846115_2846298_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000403785.1|2846391_2846748_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|2846805_2847228_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_086714375.1|2847268_2848339_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	56.1	7.4e-52
WP_000693850.1|2848410_2848836_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2848819_2849062_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_014639888.1|2849267_2849792_+	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	28.0	2.2e-12
WP_032159761.1|2850003_2850162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042046576.1|2850145_2850445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2850516_2850735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014640381.1|2850699_2850954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2851303_2851492_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2851488_2851680_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2851773_2854215_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2854276_2854546_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|2854514_2855633_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2855735:2855749	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
NZ_CP025950	Escherichia coli strain SCEC020023 chromosome, complete genome	4883927	3748549	3848683	4883927	transposase,portal,tail,terminase,holin,integrase,capsid,head,lysis	Enterobacteria_phage(30.3%)	108	3792948:3792995	3844780:3844827
WP_096058015.1|3748549_3749822_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.3e-177
WP_000960228.1|3750085_3750826_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000569129.1|3750971_3751319_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000375614.1|3751409_3752528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000263653.1|3753389_3754565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063109629.1|3754941_3755172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333636.1|3755128_3755524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333633.1|3756254_3756470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249442.1|3756944_3757562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021517769.1|3757640_3757847_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001333629.1|3757818_3758016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103042710.1|3758518_3758707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032143699.1|3759400_3759772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587127.1|3760065_3761589_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
WP_000623302.1|3762682_3762823_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001332841.1|3762909_3763032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071530062.1|3763118_3763310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587127.1|3764921_3766445_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
WP_032143699.1|3766738_3767110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032329763.1|3768607_3768997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013303.1|3768993_3769419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032143699.1|3770871_3771243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587127.1|3771536_3773060_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
WP_077879130.1|3773588_3773807_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	5.6e-07
WP_000597528.1|3774225_3774576_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000057773.1|3774588_3776181_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_024176379.1|3776280_3777237_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001178466.1|3777486_3779040_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	22.2	2.9e-12
WP_000911138.1|3779033_3780080_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000197460.1|3780079_3781078_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000155278.1|3781104_3782127_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774153.1|3782155_3783031_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558519.1|3783079_3783370_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001081495.1|3783380_3784124_+	epimerase	NA	NA	NA	NA	NA
WP_001333700.1|3784498_3784756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086353665.1|3784977_3785106_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000920172.1|3787380_3788451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132880.1|3788428_3790135_-	membrane protein	NA	NA	NA	NA	NA
WP_001087767.1|3790127_3791336_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_000772656.1|3791577_3792786_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.5	7.7e-130
3792948:3792995	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000904676.1|3793060_3793213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118619.1|3793932_3794856_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_103042711.1|3794892_3795654_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	33.2	2.2e-21
WP_001041461.1|3795646_3796045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957441.1|3796044_3796710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023149734.1|3797505_3799077_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000624622.1|3799096_3799444_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3799443_3800121_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000834404.1|3800347_3802237_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001185479.1|3802839_3803871_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	37.3	1.2e-11
WP_061363451.1|3807728_3808328_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	98.0	7.5e-110
WP_061363450.1|3808394_3811793_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.1	0.0e+00
WP_072292469.1|3811853_3812495_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	7.3e-95
WP_061363449.1|3812392_3813136_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	2.6e-144
WP_032271385.1|3813141_3813840_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.0	2.2e-129
WP_000847352.1|3813839_3814169_-|tail	tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	1.1e-57
WP_000840239.1|3814165_3816727_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.4	0.0e+00
WP_000459458.1|3816719_3817154_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000479155.1|3817135_3817558_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_001446995.1|3817573_3818314_-|tail	tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	2.1e-130
WP_000683105.1|3818321_3818717_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975085.1|3818713_3819292_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	5.9e-80
WP_000753001.1|3819303_3819657_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.4e-62
WP_000158886.1|3819668_3820064_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.9	1.2e-52
WP_000063273.1|3820105_3821131_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_001380322.1|3821186_3821519_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_000123280.1|3821528_3822848_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.5e-232
WP_001446996.1|3822828_3824430_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	9.4e-309
WP_000198149.1|3824426_3824633_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027290.1|3824629_3826555_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453576.1|3826529_3827075_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_077874690.1|3827214_3827358_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001663509.1|3827463_3827697_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|3827753_3828164_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001390120.1|3828209_3828374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139678.1|3828514_3828667_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001446997.1|3828654_3829092_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	95.9	3.0e-68
WP_001197767.1|3829088_3829565_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.5	1.9e-84
WP_001120502.1|3829568_3829904_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_076604570.1|3829980_3831033_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.0	2.4e-204
WP_000917724.1|3831183_3831387_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000868396.1|3831651_3832578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086714489.1|3832564_3833113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|3833125_3833467_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001390267.1|3833484_3834474_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.4e-193
WP_001061403.1|3834481_3835279_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.0e-150
WP_000767135.1|3835298_3835688_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	98.4	1.0e-67
WP_077816369.1|3835684_3836044_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	1.7e-53
WP_086714483.1|3836010_3836505_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	96.3	2.8e-86
WP_001406328.1|3836501_3837443_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	5.6e-152
WP_001250269.1|3837432_3837612_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|3837787_3838339_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|3838331_3838592_-	XRE family transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|3838689_3839382_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_012602729.1|3839706_3839928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3839899_3840334_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_101975739.1|3840252_3840597_-	hypothetical protein	NA	U5P0J5	Shigella_phage	96.5	4.1e-60
WP_029379673.1|3840505_3840730_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	3.2e-13
WP_000135682.1|3840802_3841165_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|3841230_3842055_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_048949115.1|3842182_3842719_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	99.4	3.7e-100
WP_001242749.1|3842709_3843072_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3843071_3843377_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000433939.1|3843376_3843727_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_064734231.1|3843828_3844767_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
WP_000893278.1|3844971_3846225_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3844780:3844827	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3846236_3847340_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749867.1|3847627_3848683_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
>prophage 1
NZ_CP025944	Escherichia coli strain SCEC020023 plasmid pOXA10_020023, complete sequence	89048	9872	65839	89048	transposase,integrase	Escherichia_phage(40.91%)	53	NA	NA
WP_001118624.1|9872_10796_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	1.8e-171
WP_101975747.1|11153_11675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118297.1|13188_14673_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.8e-32
WP_072143941.1|14672_14924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776034.1|15081_15513_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_101975725.1|15512_16784_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	1.1e-150
WP_012600007.1|16865_17843_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|17839_19045_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_072656591.1|19459_19729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362086.1|20085_20913_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000957857.1|21051_21240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|23142_23400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|23457_24234_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|24230_24974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|25024_25375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077890912.1|25768_26842_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_052686739.1|27134_28049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261276.1|28303_28534_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044864680.1|28530_28947_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_072692516.1|28992_29118_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	3.9e-13
WP_001310555.1|29155_30172_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000002334.1|30336_33402_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.0	3.6e-06
WP_044864557.1|33394_34417_-	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_077910396.1|34417_35170_-	tetrathionate reductase subunit TtrB	NA	NA	NA	NA	NA
WP_080950116.1|35379_37113_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000974596.1|37087_37672_+	two-component system response regulator TtrR	NA	NA	NA	NA	NA
WP_000528119.1|37764_37968_+	fumarate hydratase FumD	NA	NA	NA	NA	NA
WP_053897648.1|38981_40538_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
WP_004202492.1|41329_41671_-	RamA family antibiotic efflux transcriptional regulator	NA	D0R0F8	Streptococcus_phage	29.8	2.0e-06
WP_074156915.1|42135_42333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114481148.1|42334_43912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061456205.1|44011_44251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000583524.1|44227_44824_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.7	7.1e-36
WP_001067855.1|44880_45585_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001317540.1|47312_48029_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
WP_004201280.1|48263_48737_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001209508.1|48811_49603_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000846390.1|49619_50420_-	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_012300772.1|50684_51944_-	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_000237816.1|52264_52717_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_112917708.1|52889_53534_+|integrase	DNA integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	36.9	2.5e-18
WP_001067855.1|53424_54129_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|55612_55855_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015058875.1|55886_56564_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804064.1|56642_57842_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|57873_58758_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001067858.1|58849_59554_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000743213.1|59626_59851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114481149.1|60061_61555_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|61585_62470_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_058100717.1|62686_63901_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|63928_64234_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_114481149.1|64345_65839_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP025949	Escherichia coli strain SCEC020023 plasmid pRmtB_020023, complete sequence	73313	1796	16481	73313	protease,transposase	Escherichia_phage(42.86%)	14	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012602143.1|2669_3134_+	Plasmid stable inheritance protein	NA	NA	NA	NA	NA
WP_012602142.1|3130_3235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|4463_5663_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|5672_5861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572405.1|7439_8234_+	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
WP_001067858.1|8540_9245_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001235713.1|9549_10107_+|transposase	transposase	transposase	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|10289_11150_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|11319_12075_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_001067855.1|12200_12905_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013023839.1|13956_14433_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_015387340.1|14479_15355_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001067858.1|15776_16481_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
