The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	7509	60932	4705038	transposase,protease	Leptospira_phage(28.57%)	38	NA	NA
WP_024744592.1|7509_8346_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024744593.1|8530_9337_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024744594.1|9613_10807_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_053513954.1|10960_11629_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014501265.1|11713_12475_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12521_12944_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743315.1|12947_13361_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743314.1|13656_14424_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_024743313.1|14434_14704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743312.1|14778_16239_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_101807019.1|17384_18761_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	4.1e-63
WP_101807304.1|18989_19874_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.0e-87
WP_107490060.1|19890_20992_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_024744007.1|21252_22380_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_024744008.1|23450_24791_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_010364746.1|25008_25701_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_008572943.1|25817_26138_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_024744009.1|27435_28959_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
WP_033003570.1|29063_30299_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_024744011.1|30459_31116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053512972.1|31278_33090_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_024744014.1|33237_33588_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024744015.1|33894_35025_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003577.1|35807_36860_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003579.1|37560_38634_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_024744018.1|38942_40001_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_101807021.1|42408_43038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490044.1|43087_44119_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_024744291.1|44200_45682_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024744290.1|45876_50349_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_024744289.1|50550_50931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324081.1|51077_52265_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.3e-41
WP_024744287.1|52467_52773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324376.1|53959_55099_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_024744284.1|55412_56198_-	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_033003662.1|56208_58797_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744282.1|58969_60127_+	ROK family protein	NA	NA	NA	NA	NA
WP_101807022.1|60169_60932_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	322159	388884	4705038	transposase	Leptospira_phage(37.5%)	49	NA	NA
WP_107490044.1|322159_323191_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807309.1|323226_324666_-	HpaF protein	NA	NA	NA	NA	NA
WP_024744915.1|325730_328139_-	serine kinase	NA	NA	NA	NA	NA
WP_107490032.1|329605_330708_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.8e-43
WP_082324345.1|331574_332021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744340.1|334790_335261_-	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
WP_130625300.1|335315_335597_-	serine kinase	NA	NA	NA	NA	NA
WP_024744341.1|335677_335920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744342.1|335929_336868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744343.1|336864_337692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744344.1|337688_337949_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744345.1|337953_338598_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744346.1|338584_339538_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_053513737.1|339630_340272_-	type III secretion protein HpaP	NA	NA	NA	NA	NA
WP_053513739.1|340271_342194_-	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_024744349.1|342202_343276_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_011257083.1|343491_343947_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_011407211.1|343980_344373_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_024744351.1|344374_345139_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_024744352.1|345146_345776_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_024744353.1|345760_346462_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_024744354.1|346451_347780_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_053513741.1|347772_348282_+	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_024744356.1|348278_349109_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_053513743.1|349191_351015_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_053513745.1|351754_352186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513747.1|352596_353160_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	39.4	5.2e-12
WP_024744361.1|353623_355177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744362.1|356443_356785_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_053513751.1|356969_359528_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_053513749.1|359546_359807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807032.1|359886_360855_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.6e-98
WP_033003076.1|360980_362705_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	3.0e-34
WP_024742976.1|362945_363887_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_107490044.1|365443_366475_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807033.1|366522_368157_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_050587979.1|368694_370224_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_024742979.1|370220_372452_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_024742980.1|372454_374212_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_082324554.1|374268_376158_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_024742982.1|376154_378758_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|378780_378966_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_024742983.1|379079_381242_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_024742984.1|381258_381891_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_101807034.1|382256_383633_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.0e-78
WP_024743402.1|383714_384470_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024743401.1|384847_386257_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743400.1|386605_387037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419058.1|387507_388884_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
>prophage 3
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	492753	710236	4705038	capsid,plate,terminase,integrase,tail,head,portal,protease,holin,transposase,tRNA	Stenotrophomonas_phage(31.25%)	153	518380:518424	561362:561406
WP_053513464.1|492753_493317_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_024745936.1|493327_495820_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
WP_101807039.1|496002_497277_-	RDD family protein	NA	NA	NA	NA	NA
WP_101807040.1|497318_498041_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_024745938.1|498081_498555_-	DUF494 family protein	NA	NA	NA	NA	NA
WP_101807041.1|498597_499740_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_101807042.1|499811_500948_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_024745941.1|501080_501593_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_024745942.1|501993_502917_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_024745943.1|502916_504230_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_053513456.1|506180_507458_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_024745946.1|507655_508480_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745947.1|508480_509539_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_024745948.1|509705_511211_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_053513469.1|511207_511717_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_019302641.1|511826_512960_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_014504872.1|513202_513724_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033004404.1|513922_514837_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_024745951.1|514937_515378_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014504870.1|515486_517361_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_024745952.1|517553_517874_+	hypothetical protein	NA	NA	NA	NA	NA
518380:518424	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_082330806.1|518493_519768_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	1.1e-110
WP_011257520.1|519901_520108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075243253.1|520104_520377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745956.1|520373_520619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745957.1|520615_520891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745958.1|521052_521463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|521688_521967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|521963_522182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082330809.1|522490_525163_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_011258450.1|525196_525409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|525405_525684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745959.1|525694_526015_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
WP_053503015.1|526017_526275_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|526346_526784_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|527444_528431_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|528427_528829_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_024745960.1|528841_531712_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
WP_011258456.1|531744_531858_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|531866_532169_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|532214_532724_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258459.1|532754_533921_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_024745961.1|533932_534292_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
WP_024745962.1|534288_534852_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
WP_024745963.1|534912_535491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745964.1|535498_537004_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
WP_024745965.1|537013_537559_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
WP_024745966.1|537551_538442_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
WP_024745967.1|538523_538973_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
WP_024745968.1|538960_539380_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
WP_011258470.1|539853_540495_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
WP_024745970.1|540491_540767_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
WP_024745971.1|540759_541116_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
WP_024745972.1|541120_541330_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
WP_012445486.1|541329_541797_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_011258475.1|541896_542616_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_024745974.1|542619_543639_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
WP_024745975.1|543685_544528_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
WP_033004409.1|544649_546434_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
WP_024745977.1|546433_547453_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
WP_082330810.1|547473_547704_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
WP_024745978.1|547636_548341_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
WP_033004412.1|548372_548840_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_024745980.1|548839_550018_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_101807043.1|550748_553508_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
WP_024745590.1|553516_554443_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_101807044.1|554439_557274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743124.1|557301_558033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807045.1|558059_560402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324338.1|561473_561707_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
561362:561406	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_024743230.1|563583_565473_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_011260615.1|565689_566031_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
WP_053513444.1|566229_567954_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.1e-47
WP_024743228.1|568029_568716_+	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
WP_024743227.1|568712_569663_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_082324547.1|569719_570514_+	response regulator	NA	NA	NA	NA	NA
WP_053513446.1|570510_571236_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	4.7e-50
WP_024743224.1|571452_572328_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
WP_053513448.1|572406_573021_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_053513449.1|573073_574366_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003483210.1|576656_576944_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
WP_011260602.1|577087_578728_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
WP_058419179.1|582411_583380_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_058419036.1|585765_586734_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_024745526.1|587665_588739_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
WP_053513971.1|589255_591433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513973.1|591526_593944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513975.1|594207_595128_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_024745528.1|595127_595646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513977.1|595807_598633_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_053513979.1|598728_599289_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	1.4e-12
WP_058419055.1|600995_602372_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_101807046.1|603356_603959_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053513670.1|606464_606965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513672.1|607865_608813_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_024745121.1|608948_609539_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_024745122.1|609749_610493_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024745365.1|612807_615495_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_024745366.1|615581_616319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807047.1|616329_617706_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_130625305.1|617885_618446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419175.1|618764_620141_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_053513412.1|620451_623181_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.7	3.8e-68
WP_082324544.1|623249_624425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324336.1|624471_626349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807048.1|626362_627937_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_053513416.1|628069_629032_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_058419060.1|629319_630696_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419174.1|631700_635525_+	avirulence protein	NA	NA	NA	NA	NA
WP_024745997.1|636594_638178_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_082324335.1|638568_638760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745996.1|641260_643585_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_024745994.1|645488_646580_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_024745993.1|647544_648423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324334.1|648611_649496_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024745991.1|649773_651546_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_050588046.1|651943_653644_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_033004419.1|654798_656175_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_024745988.1|656261_657257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745987.1|657502_658414_+	magnesium transporter	NA	NA	NA	NA	NA
WP_024745985.1|658948_659233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745984.1|659562_660009_+	autotransporter	NA	NA	NA	NA	NA
WP_101807049.1|660320_661422_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|662131_663508_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024743083.1|664680_666372_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_024743082.1|666624_667410_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_024743081.1|668653_669658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743080.1|669696_670626_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_024743079.1|671161_674050_-	insulinase family protein	NA	NA	NA	NA	NA
WP_024743078.1|674302_676885_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
WP_101807050.1|677462_678261_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745720.1|680864_682319_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
WP_024745721.1|682526_684014_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
WP_082324540.1|684293_685247_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.7e-15
WP_024745723.1|685415_687065_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_033004321.1|688056_689994_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_024745725.1|690145_690814_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024745726.1|690818_691871_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
WP_024745727.1|691901_692639_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745728.1|692669_693584_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_024745729.1|694146_694947_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_024745730.1|695508_696474_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745731.1|696582_697152_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_024745732.1|697536_697848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745733.1|697915_700009_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_053513809.1|700603_701788_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_024745735.1|701897_704033_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.8e-28
WP_024745736.1|704376_704775_+	YbaN family protein	NA	NA	NA	NA	NA
WP_024745738.1|705063_705918_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_082324332.1|705905_706586_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_024745740.1|706779_707697_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.7e-12
WP_024745741.1|708212_708764_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024745742.1|708868_710236_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
>prophage 4
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	728071	815939	4705038	transposase	Ralstonia_phage(16.67%)	60	NA	NA
WP_053513544.1|728071_729103_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	7.9e-75
WP_024743814.1|730404_731796_+	endopolygalacturonase	NA	NA	NA	NA	NA
WP_024743813.1|732064_733204_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_024743812.1|733200_734616_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_024743811.1|735117_736323_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	1.6e-66
WP_011409453.1|737402_737681_+	YbeD family protein	NA	NA	NA	NA	NA
WP_024743809.1|737668_738367_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_024743808.1|738381_739395_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_033003474.1|739793_741977_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.4	3.7e-82
WP_024743806.1|742268_743135_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_024743805.1|743296_744352_+	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	3.7e-80
WP_024743804.1|744474_745878_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.6	6.6e-133
WP_024743801.1|748097_748859_+	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409446.1|748983_749364_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_058419171.1|749535_750873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743799.1|750893_751835_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.6	8.5e-68
WP_024743798.1|752174_753233_-	oxidoreductase	NA	NA	NA	NA	NA
WP_082324538.1|753392_753755_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_024743796.1|754039_755851_+	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	27.8	3.5e-09
WP_011260315.1|755847_756288_+	response regulator	NA	NA	NA	NA	NA
WP_053513717.1|756291_757794_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.9	4.9e-09
WP_024743794.1|757885_758401_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_024743793.1|758569_759307_-	pteridine reductase	NA	NA	NA	NA	NA
WP_033003467.1|759374_760559_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_058419161.1|761959_762928_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
WP_107490082.1|762979_763078_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_101836530.1|763956_766665_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_050587990.1|766815_769710_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
WP_053513077.1|769706_772103_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_024743528.1|772236_773403_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_050587991.1|773617_774385_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743530.1|774429_775707_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_024743531.1|775747_776815_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743532.1|776821_777850_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_024743533.1|777852_779007_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_024743534.1|779511_780117_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_024743535.1|780113_781367_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_024743536.1|781368_783267_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_024743537.1|783268_785311_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_024743539.1|786524_787757_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.5	2.3e-73
WP_058419068.1|787977_788946_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_101807052.1|794310_795048_-	endonuclease	NA	NA	NA	NA	NA
WP_053513041.1|795097_795913_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_101807053.1|796004_796655_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_082324537.1|796748_797489_-	cytochrome c4	NA	NA	NA	NA	NA
WP_024744861.1|797690_798314_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024744862.1|798407_799103_-	VIT family protein	NA	NA	NA	NA	NA
WP_024744863.1|799318_800683_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_058419060.1|802474_803851_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024712624.1|804625_805111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744626.1|806053_806974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513043.1|807006_808506_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.1	3.6e-12
WP_082324328.1|808502_809222_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024744866.1|809360_810461_+	glycosyltransferase	NA	A0A142BZU7	Faustovirus	28.5	9.8e-15
WP_024744868.1|811596_811872_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024744869.1|811936_813046_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	3.8e-35
WP_024744870.1|813114_813690_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_024744871.1|813749_814580_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_024744872.1|814709_814919_+	DUF4386 family protein	NA	NA	NA	NA	NA
WP_058419036.1|814970_815939_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 5
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	1073176	1135599	4705038	transposase,protease	Leptospira_phage(16.67%)	44	NA	NA
WP_107490031.1|1073176_1074208_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_058419168.1|1075268_1076237_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324317.1|1078138_1079512_-	MFS transporter	NA	NA	NA	NA	NA
WP_024745685.1|1079610_1081650_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_024745686.1|1081857_1082880_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024745687.1|1083295_1084393_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745688.1|1084585_1085095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513257.1|1085114_1085975_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_024745690.1|1085925_1086318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745691.1|1086320_1087529_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	2.9e-20
WP_053513259.1|1087619_1088717_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024745693.1|1088720_1089581_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_024745694.1|1089577_1090531_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_024745695.1|1090538_1091573_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
WP_024745696.1|1091932_1092646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004302.1|1092715_1093738_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_024745698.1|1093969_1094257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004295.1|1094253_1096587_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033004296.1|1099000_1101151_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_024745700.1|1101243_1101888_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_024745701.1|1102858_1104157_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_024745702.1|1104224_1105307_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_033004297.1|1105521_1106262_+	CvpA family protein	NA	NA	NA	NA	NA
WP_024745703.1|1106298_1107765_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	8.3e-86
WP_024745704.1|1107903_1108728_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807070.1|1109447_1110246_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745844.1|1110708_1111128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513157.1|1111307_1112051_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_024745846.1|1112685_1113228_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_053513155.1|1113208_1114345_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_033004364.1|1114549_1116076_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_024745848.1|1116247_1118350_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_082324316.1|1118453_1119797_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	5.0e-29
WP_024745850.1|1119854_1120544_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
WP_082324528.1|1120718_1122365_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745852.1|1122514_1122823_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
WP_024745853.1|1122819_1123215_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_014502224.1|1123429_1124437_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_014502225.1|1124577_1125339_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_058419165.1|1126545_1127604_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_058419103.1|1128920_1129889_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_024745448.1|1132176_1133469_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1133561_1134188_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1134312_1135599_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
>prophage 7
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	1243099	1394525	4705038	plate,transposase,protease	Ralstonia_phage(15.38%)	107	NA	NA
WP_101807076.1|1243099_1244497_-|protease	serine protease	protease	NA	NA	NA	NA
WP_053513692.1|1244924_1246895_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_024744518.1|1247739_1248585_+	transporter	NA	NA	NA	NA	NA
WP_024744517.1|1248873_1250994_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_024744516.1|1251270_1251732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744515.1|1251863_1252589_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513688.1|1253406_1255548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513686.1|1255664_1257800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807077.1|1257962_1258768_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	5.3e-10
WP_024745783.1|1259870_1261109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745784.1|1261934_1264040_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.7	1.9e-136
WP_050588043.1|1265689_1266337_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	45.5	6.5e-35
WP_024745785.1|1266333_1266885_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_101807315.1|1267250_1270184_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	8.9e-257
WP_024745787.1|1270651_1270843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745788.1|1271273_1272077_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_033004344.1|1272165_1273377_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_101836531.1|1273373_1275533_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	1.7e-34
WP_024745792.1|1276341_1276746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745793.1|1276827_1278846_-	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745794.1|1278957_1280628_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_024745795.1|1280624_1281389_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024745796.1|1281488_1283222_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_024745797.1|1283440_1284157_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	2.8e-23
WP_024745798.1|1284149_1285442_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_024745799.1|1285593_1286085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745800.1|1286153_1286411_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_024745801.1|1286413_1287223_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_024745802.1|1287258_1287999_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014502368.1|1288003_1288603_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745803.1|1288847_1290044_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_008574699.1|1290043_1290685_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745804.1|1291035_1292232_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_024745805.1|1292313_1292700_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_024745806.1|1292702_1293377_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_024745807.1|1293440_1294238_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_024745808.1|1294368_1294548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745809.1|1294544_1294829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745812.1|1295444_1296647_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_131112933.1|1296743_1296956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807079.1|1297051_1297468_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024745813.1|1297623_1298355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745814.1|1298554_1299433_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
WP_024745815.1|1299540_1299801_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745816.1|1299860_1301342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807080.1|1305090_1306074_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513252.1|1306070_1306865_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745820.1|1306917_1307988_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_107490031.1|1308918_1309950_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_101807081.1|1310021_1312844_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.0e-52
WP_101807316.1|1313349_1314366_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.3e-49
WP_058419153.1|1315473_1316850_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
WP_058419152.1|1316993_1318370_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
WP_058419050.1|1319034_1320003_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744031.1|1320416_1320929_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_033003115.1|1323478_1324267_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011259947.1|1324266_1325601_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743027.1|1325752_1326361_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033003111.1|1326746_1327235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467601.1|1327281_1327782_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011409204.1|1327785_1329282_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1329423_1329921_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409203.1|1330068_1330557_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_024743026.1|1330559_1332395_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743025.1|1332358_1333450_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_053513684.1|1333535_1336268_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_014502423.1|1336298_1336652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807082.1|1336744_1339531_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	6.9e-41
WP_053513217.1|1339505_1340378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|1342414_1343517_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024743437.1|1346025_1347090_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_024743436.1|1347104_1347356_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_024743435.1|1347655_1348768_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_024743434.1|1348764_1349307_-	shikimate kinase	NA	NA	NA	NA	NA
WP_024743433.1|1349473_1350073_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_012445807.1|1350253_1350670_+	YjfI family protein	NA	NA	NA	NA	NA
WP_024743432.1|1350682_1351456_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_024743431.1|1351481_1352564_+	potassium channel protein	NA	NA	NA	NA	NA
WP_082324520.1|1352566_1353238_+	YjfK family protein	NA	NA	NA	NA	NA
WP_024743429.1|1353275_1353680_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_024743428.1|1353692_1354265_+	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
WP_024743427.1|1354266_1355433_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
WP_050587989.1|1355795_1356257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743426.1|1358054_1360061_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_082324305.1|1361110_1364257_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743423.1|1364588_1365341_+	SapC family protein	NA	NA	NA	NA	NA
WP_101807084.1|1365351_1366398_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024743421.1|1366438_1367956_+	tryptophan 7-halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
WP_024743420.1|1367993_1368998_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743419.1|1369142_1369541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807085.1|1369672_1371049_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
WP_024745604.1|1371636_1373034_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_024745603.1|1373475_1374858_-	APC family permease	NA	NA	NA	NA	NA
WP_024745602.1|1375050_1375815_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745601.1|1376128_1377070_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_053513783.1|1377825_1379214_+	amino acid permease	NA	NA	NA	NA	NA
WP_101807086.1|1381163_1382618_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	9.0e-93
WP_033004264.1|1382574_1383477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588037.1|1383476_1384718_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
WP_101807087.1|1384950_1385919_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_024744440.1|1387039_1388056_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_082324517.1|1388116_1388911_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_024744438.1|1389070_1390432_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744437.1|1390719_1392450_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
WP_005913389.1|1392508_1392778_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_003487850.1|1392770_1393163_-	PTS fructose IIA component family protein	NA	NA	NA	NA	NA
WP_058419145.1|1393556_1394525_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
>prophage 8
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	1419948	1527229	4705038	transposase,tRNA,protease	Ralstonia_phage(18.75%)	87	NA	NA
WP_107490044.1|1419948_1420980_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_058419036.1|1421046_1422015_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_011258205.1|1422318_1422648_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_024743872.1|1422644_1423184_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058419057.1|1423393_1424362_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024743209.1|1424475_1425720_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
WP_024743208.1|1425716_1426979_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_024743207.1|1426978_1427743_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.5	2.0e-11
WP_024743206.1|1428000_1429458_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_024743205.1|1429473_1429932_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_003487757.1|1430103_1430571_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_033003226.1|1430675_1430894_+	peptidase	NA	NA	NA	NA	NA
WP_024743204.1|1431500_1432097_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_033003224.1|1432152_1432695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743203.1|1432752_1433094_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_024743202.1|1433151_1433793_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_024743201.1|1433897_1434323_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_024743200.1|1434878_1435739_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_024743199.1|1435782_1436475_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_101807090.1|1436540_1437306_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743682.1|1437656_1438694_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_024743681.1|1438807_1439938_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_082324514.1|1440227_1440884_+	YitT family protein	NA	NA	NA	NA	NA
WP_024743679.1|1441986_1442559_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_024743678.1|1442555_1442990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003404.1|1442986_1443868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743677.1|1443835_1444402_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_024743676.1|1444394_1444862_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_024743675.1|1444875_1445823_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_024743674.1|1446259_1446694_+	OsmC family protein	NA	NA	NA	NA	NA
WP_024743673.1|1446846_1447446_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743672.1|1447743_1448625_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_024743669.1|1449717_1452327_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_024743668.1|1452310_1452769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743667.1|1452765_1454121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743666.1|1454101_1455508_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_053512934.1|1455824_1456646_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_058419088.1|1456740_1457709_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_024743020.1|1457963_1458962_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_024743021.1|1459237_1459771_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
WP_024743022.1|1460053_1461538_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	5.0e-14
WP_024743023.1|1461831_1462539_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_154221304.1|1463147_1463309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324511.1|1465050_1465728_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_158500229.1|1465849_1466296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016904074.1|1466264_1466489_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_024745822.1|1466488_1468561_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_050588044.1|1468844_1469651_+	pirin family protein	NA	NA	NA	NA	NA
WP_101807093.1|1469737_1470109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419141.1|1470512_1473329_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	4.7e-53
WP_024745912.1|1473328_1474225_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_024745911.1|1474221_1474686_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324298.1|1474709_1475189_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324297.1|1475338_1475818_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324296.1|1475904_1477641_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_082324203.1|1478421_1479798_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743650.1|1480448_1481045_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_058419169.1|1481470_1482847_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_024712501.1|1485750_1486212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625317.1|1487527_1488184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024742990.1|1488451_1489165_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_024742991.1|1489268_1490018_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_082324510.1|1491459_1492581_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_082324295.1|1492595_1493423_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_024743606.1|1493406_1494690_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_024743605.1|1494716_1495232_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743604.1|1495242_1497399_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.4e-09
WP_024743603.1|1497467_1499471_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1499489_1499819_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_131091743.1|1499849_1500077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743602.1|1500308_1503773_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|1504166_1504709_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033003388.1|1505133_1506042_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_024743600.1|1507571_1508384_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_024743598.1|1509329_1509941_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743597.1|1510059_1510944_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_024743596.1|1510965_1512057_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_024743595.1|1512125_1513529_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019302800.1|1513542_1514049_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743594.1|1514451_1514910_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743593.1|1515687_1515891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807094.1|1516054_1517198_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.9	1.2e-84
WP_101807095.1|1517307_1518324_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807096.1|1518609_1519986_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
WP_033004102.1|1520013_1520904_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_024743817.1|1521590_1522187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131112934.1|1526197_1527229_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.7e-74
>prophage 9
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	1569918	1637885	4705038	transposase,tRNA,protease	Ralstonia_phage(33.33%)	57	NA	NA
WP_058419068.1|1569918_1570887_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744656.1|1571210_1571504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324504.1|1571582_1571996_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_033003771.1|1572687_1573674_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_053513278.1|1573724_1573958_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_024744651.1|1574431_1574725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807099.1|1575617_1576067_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_053513279.1|1576332_1577190_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
WP_024744648.1|1577394_1578006_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_024744647.1|1578104_1580747_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
WP_024744646.1|1581260_1581896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807100.1|1581918_1582947_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_101807101.1|1582943_1583843_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1583899_1584316_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_053513280.1|1584327_1585443_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_024744641.1|1586532_1587003_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_033003769.1|1587440_1588115_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024744639.1|1588425_1591536_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744638.1|1592002_1592737_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_024744637.1|1592875_1593448_+	Maf-like protein	NA	NA	NA	NA	NA
WP_024744636.1|1593447_1594947_+	ribonuclease G	NA	NA	NA	NA	NA
WP_024744635.1|1595087_1599008_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_024744634.1|1599013_1599766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744633.1|1599864_1601310_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_024744632.1|1601566_1602148_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_024744631.1|1602293_1603661_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_082324502.1|1603735_1604140_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744630.1|1604191_1604653_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744629.1|1604722_1605820_-|protease	protease	protease	NA	NA	NA	NA
WP_101807075.1|1606226_1607024_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745348.1|1607136_1608012_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_024745349.1|1608013_1608274_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_024745350.1|1608305_1609610_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_101807102.1|1609643_1611350_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_024745352.1|1611492_1612833_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_024745353.1|1612842_1613679_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_130625325.1|1613685_1613913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745354.1|1613925_1614417_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024745355.1|1614624_1615374_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_024745356.1|1615483_1616020_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_024745357.1|1616130_1616610_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_024745358.1|1616838_1618083_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_024745359.1|1618090_1619341_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053514015.1|1619337_1620708_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
WP_024744748.1|1622265_1622562_+	cysteine methyltransferase	NA	NA	NA	NA	NA
WP_024744749.1|1622602_1623301_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_058419134.1|1623551_1624520_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_101807103.1|1625103_1626129_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_058419132.1|1627246_1627669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743076.1|1628524_1630540_-	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_101807317.1|1631209_1632226_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	9.6e-49
WP_058419036.1|1632622_1633591_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_154221280.1|1633674_1634244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744531.1|1634609_1635461_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_024744530.1|1635556_1636126_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.9	4.5e-72
WP_024744529.1|1636160_1636346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419036.1|1636916_1637885_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 10
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	1746381	1768176	4705038	integrase,transposase,tRNA	Leptospira_phage(40.0%)	15	1751035:1751049	1772898:1772912
WP_101807110.1|1746381_1747179_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107490046.1|1747374_1748476_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024744617.1|1748895_1749363_-	TonB family protein	NA	NA	NA	NA	NA
WP_058419031.1|1749793_1750762_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_082324283.1|1750883_1751651_-	energy transducer TonB	NA	NA	NA	NA	NA
1751035:1751049	attL	CCGCCGGGATTGCCG	NA	NA	NA	NA
WP_024743448.1|1751657_1753049_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
WP_024743447.1|1753509_1754094_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_024743446.1|1754193_1755210_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082324494.1|1755833_1757252_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017154976.1|1757347_1757590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324282.1|1757583_1757925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490965.1|1758477_1759578_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	7.2e-42
WP_101807112.1|1759635_1763229_-	avirulence protein	NA	NA	NA	NA	NA
WP_024743886.1|1764603_1766715_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	1.3e-15
WP_107490049.1|1767210_1768176_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
1772898:1772912	attR	CCGCCGGGATTGCCG	NA	NA	NA	NA
>prophage 11
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	1839126	1849014	4705038	tRNA	Micromonas_sp._RCC1109_virus(16.67%)	7	NA	NA
WP_053513920.1|1839126_1840803_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.1e-37
WP_011408885.1|1840891_1841533_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_019300309.1|1841705_1842740_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
WP_024745487.1|1843041_1843530_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_024745486.1|1843631_1846280_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
WP_003481884.1|1846419_1846632_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_101807119.1|1848522_1849014_+	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	67.7	4.6e-57
>prophage 12
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	1974615	2061220	4705038	transposase,tRNA	uncultured_Caudovirales_phage(34.78%)	52	NA	NA
WP_024745402.1|1974615_1976133_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	8.6e-86
WP_024745401.1|1976274_1977411_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_024745399.1|1977775_1979953_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.3e-47
WP_019299970.1|1979964_1980834_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_024745398.1|1981010_1982693_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	2.1e-32
WP_024745396.1|1983342_1986111_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1986258_1986507_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1986503_1986914_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024745395.1|1986979_1989571_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_101807129.1|1989924_1990740_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_101807130.1|1991395_1993639_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024745392.1|1993747_1994824_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010365269.1|1994820_1995417_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_019302811.1|1995413_1996280_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_082324264.1|1996525_1998916_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	3.9e-08
WP_082324486.1|1998994_1999339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002806488.1|1999693_2000176_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_082324263.1|2000311_2001109_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_053513169.1|2002150_2004412_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_053513167.1|2004823_2007085_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	2.5e-12
WP_024742986.1|2007675_2010150_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	1.9e-10
WP_107490044.1|2010195_2011227_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_053514012.1|2014254_2016498_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.4e-14
WP_082324099.1|2016756_2018133_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_053513639.1|2018414_2020628_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-09
WP_053513641.1|2020825_2023195_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.7e-09
WP_024744836.1|2023208_2023970_-	transporter	NA	NA	NA	NA	NA
WP_101807131.1|2029477_2031739_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	2.8e-08
WP_024743066.1|2032637_2034647_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|2034680_2035046_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_010375641.1|2035042_2035351_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_101807132.1|2035451_2036474_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743068.1|2036470_2037253_-	ParA family protein	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
WP_024743069.1|2037254_2038229_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_014503259.1|2038235_2038976_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_024743070.1|2039064_2039418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003138.1|2041704_2042412_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
WP_082330725.1|2042414_2043359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625354.1|2042991_2043927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743072.1|2043928_2046148_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
WP_024743073.1|2046402_2046855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324484.1|2047746_2050788_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082324483.1|2051032_2051311_-	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	70.3	9.0e-34
WP_058419068.1|2051466_2052435_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744204.1|2052918_2053353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807133.1|2054747_2055969_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.7	2.1e-103
WP_082324260.1|2056065_2056467_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745516.1|2056463_2056973_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.0	1.3e-09
WP_024745515.1|2056953_2057295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324259.1|2057308_2057905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419060.1|2058010_2059387_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419060.1|2059843_2061220_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 13
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	2139459	2201900	4705038	transposase,tRNA,protease	Ralstonia_phage(25.0%)	48	NA	NA
WP_101807140.1|2139459_2140596_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024744409.1|2140592_2141051_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024744410.1|2141301_2141622_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
WP_024744411.1|2141764_2144047_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
WP_002813418.1|2144254_2144473_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024744412.1|2144553_2145306_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_024744413.1|2145439_2146069_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
WP_154221278.1|2146260_2146482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744414.1|2146744_2147866_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_101807141.1|2147923_2148892_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.0e-64
WP_101807142.1|2149175_2151533_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_024744416.1|2151695_2153624_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_082324480.1|2153730_2154360_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_033003706.1|2154472_2158639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744419.1|2158875_2160252_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	4.0e-74
WP_024744420.1|2160283_2160610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324256.1|2160606_2161014_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
WP_024744422.1|2161045_2161396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744423.1|2161392_2162724_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	4.3e-41
WP_024744424.1|2163044_2164250_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_024744425.1|2164414_2166787_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_053513574.1|2166811_2167444_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2167662_2168088_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_024744427.1|2168106_2169312_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_024744428.1|2169322_2170111_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_024744429.1|2170107_2170968_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024744430.1|2171038_2171677_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_082324255.1|2171673_2172894_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_024744432.1|2172904_2174302_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_024744433.1|2174616_2175837_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_082330762.1|2176328_2177489_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_101807324.1|2178337_2179354_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	3.3e-49
WP_101807143.1|2179691_2180291_-	DUF1264 domain-containing protein	NA	NA	NA	NA	NA
WP_101807144.1|2180436_2181405_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324479.1|2181553_2181943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744965.1|2181881_2182259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003964.1|2182464_2183718_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_101807145.1|2183755_2184325_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_024744963.1|2184308_2184671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744960.1|2187045_2188023_-	siroheme synthase	NA	NA	NA	NA	NA
WP_024744957.1|2189344_2189533_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024744956.1|2189545_2189821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019302775.1|2190465_2190723_+	stress-induced protein	NA	NA	NA	NA	NA
WP_101807146.1|2190948_2191917_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_024744883.1|2192558_2193044_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807147.1|2193150_2194071_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_024744881.1|2195260_2197072_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_058419089.1|2200931_2201900_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
>prophage 14
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	2220836	2367053	4705038	plate,transposase	Tupanvirus(42.86%)	50	NA	NA
WP_107490085.1|2220836_2221937_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	3.2e-42
WP_101807325.1|2222276_2222639_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_101807151.1|2222695_2226589_+	avirulence protein	NA	NA	NA	NA	NA
WP_101807152.1|2226720_2229807_+	avirulence protein	NA	NA	NA	NA	NA
WP_101807153.1|2229938_2234246_+	avirulence protein	NA	NA	NA	NA	NA
WP_024743648.1|2236177_2237071_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743647.1|2237324_2238977_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.5	9.1e-41
WP_082324252.1|2239070_2240030_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.8	5.7e-11
WP_101807154.1|2240082_2244399_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.7	5.0e-54
WP_131091774.1|2244477_2247099_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	24.9	4.0e-67
WP_024743560.1|2247044_2247752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158525161.1|2247982_2267371_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.1	9.1e-132
WP_101807157.1|2267469_2289882_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	1.1e-133
WP_101807158.1|2289878_2304365_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	1.4e-124
WP_024744003.1|2304896_2305991_+	type III polyketide synthase	NA	NA	NA	NA	NA
WP_024744002.1|2306030_2306774_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024744001.1|2306770_2308048_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_024744000.1|2308035_2309391_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743999.1|2309387_2310185_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024743998.1|2310261_2311968_+	cyclic peptide export ABC transporter	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	22.4	2.0e-06
WP_003468470.1|2312066_2312285_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_101807326.1|2312667_2314251_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743719.1|2317894_2321020_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024743718.1|2321071_2322184_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_053513440.1|2322307_2322886_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053512987.1|2325440_2327528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743837.1|2329465_2332555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033007312.1|2334839_2335547_+	response regulator	NA	NA	NA	NA	NA
WP_101807160.1|2335543_2336536_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033003485.1|2336532_2338992_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_033003483.1|2339105_2340086_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807161.1|2340094_2341123_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_024743830.1|2341295_2341622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513001.1|2341618_2344522_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	1.9e-09
WP_024743828.1|2344518_2345241_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_053513003.1|2345237_2345885_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513005.1|2345881_2349340_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_024743825.1|2349343_2350660_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_024743824.1|2350661_2351999_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743823.1|2351995_2353384_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_024743822.1|2353380_2353920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743821.1|2353928_2355866_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	7.7e-39
WP_024743820.1|2356129_2356591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743819.1|2356693_2356897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324173.1|2357941_2359318_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419068.1|2359480_2360449_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024743894.1|2360890_2363662_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
WP_024743895.1|2363694_2364705_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024743896.1|2364668_2366546_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743897.1|2366549_2367053_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 15
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	2617184	2708000	4705038	tRNA,transposase,protease	Ralstonia_phage(14.29%)	53	NA	NA
WP_014503014.1|2617184_2617625_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.0	7.1e-25
WP_024744763.1|2617703_2618339_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_082324468.1|2618735_2619479_-	cytochrome c1	NA	NA	NA	NA	NA
WP_024744765.1|2619486_2620746_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_024744766.1|2620745_2621390_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_024744767.1|2621916_2622903_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_050588012.1|2624255_2624549_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_024744770.1|2624844_2626299_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_024744771.1|2626722_2627709_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
WP_033003832.1|2628139_2628784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744772.1|2628838_2629324_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_024744773.1|2629323_2629842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744774.1|2629936_2630815_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024744775.1|2630811_2632092_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_024744776.1|2632107_2633109_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_033003835.1|2633260_2634625_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_101807173.1|2635099_2635948_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744779.1|2635944_2636856_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744780.1|2636984_2638118_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
WP_082324228.1|2638263_2639775_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024744782.1|2639761_2641348_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_024744783.1|2641344_2642547_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_058419102.1|2643395_2644364_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
WP_024743152.1|2646983_2648369_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_024743150.1|2649015_2650395_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_033003186.1|2650394_2651711_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_082330729.1|2651847_2653092_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
WP_024743147.1|2653397_2654678_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_082324226.1|2654979_2655288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743145.1|2655247_2657596_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_024743144.1|2657592_2658438_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_024743143.1|2658444_2660124_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_024743142.1|2660652_2662005_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743141.1|2662065_2665197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743140.1|2665361_2666216_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
WP_101807174.1|2666386_2667691_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_024743138.1|2667832_2671927_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	5.0e-56
WP_058419204.1|2673019_2673988_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_024743589.1|2674474_2679484_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_101807175.1|2679761_2680421_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743591.1|2680435_2681743_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_101807176.1|2681755_2684926_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024744846.1|2687617_2688613_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024744845.1|2688773_2691290_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_024744844.1|2691286_2692243_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_024744843.1|2692401_2694144_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_082324465.1|2694462_2695599_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_058419101.1|2695993_2698756_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	3.6e-42
WP_024712661.1|2699026_2699752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324130.1|2700230_2701247_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807177.1|2703822_2704566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807178.1|2705182_2706559_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_101807049.1|2706898_2708000_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
>prophage 16
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	2901992	3018502	4705038	transposase,tRNA,protease	Ralstonia_phage(13.33%)	84	NA	NA
WP_058419096.1|2901992_2902961_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_082324130.1|2904352_2905369_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807194.1|2905541_2906444_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_101807195.1|2906641_2908009_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.9	1.6e-112
WP_024743338.1|2908260_2908773_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_082324207.1|2908702_2908942_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_024743337.1|2909284_2910784_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743336.1|2910780_2911713_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743335.1|2911893_2914722_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_024743334.1|2914764_2915967_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_014502759.1|2916208_2917645_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
WP_024743333.1|2917843_2918437_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
WP_082324453.1|2918701_2919295_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_024743331.1|2919291_2921061_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
WP_024743330.1|2921303_2922158_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743329.1|2922154_2923558_+	TolC family protein	NA	NA	NA	NA	NA
WP_024743328.1|2923909_2924104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743327.1|2924383_2925505_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_024743326.1|2925501_2926419_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_101807196.1|2926946_2928077_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
WP_024743324.1|2928236_2930162_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
WP_011258741.1|2930303_2930822_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_101807197.1|2930922_2931975_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_024743322.1|2932091_2933756_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_082324204.1|2934198_2934624_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011258737.1|2934713_2935109_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_024743320.1|2935455_2935731_-	RnfH family protein	NA	NA	NA	NA	NA
WP_024743319.1|2935744_2936176_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010366344.1|2936236_2936740_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
WP_024743318.1|2936904_2939352_-	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	26.7	2.6e-15
WP_058419096.1|2941101_2942070_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_101807198.1|2942292_2943669_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	7.3e-60
WP_033003395.1|2944437_2945130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625332.1|2945248_2945674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|2945821_2946923_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_033003338.1|2947902_2948151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082330739.1|2948427_2949582_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_024743456.1|2949581_2950904_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_024743457.1|2950930_2951971_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_082324452.1|2951988_2952849_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_101807199.1|2952884_2953484_+	LysE family translocator	NA	NA	NA	NA	NA
WP_082324200.1|2953550_2954486_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_082324199.1|2954551_2955904_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_058419055.1|2956452_2957829_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_158525112.1|2957825_2958923_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.5e-76
WP_101807049.1|2958971_2960073_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_024743394.1|2963423_2964398_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
WP_024743393.1|2966260_2966986_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
WP_101807075.1|2967448_2968246_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324197.1|2968254_2969709_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.5	4.4e-47
WP_024743064.1|2969775_2971206_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
WP_024743063.1|2971427_2971982_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
WP_024743062.1|2972198_2974139_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
WP_024743061.1|2974314_2974953_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444392.1|2979019_2979811_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743060.1|2979956_2980172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743059.1|2980171_2980939_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_024743058.1|2981000_2981831_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_024743057.1|2981903_2982332_+	cytochrome c	NA	NA	NA	NA	NA
WP_024743056.1|2982463_2982943_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|2983193_2983409_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_024743055.1|2983636_2984122_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_024744839.1|2986740_2988972_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
WP_058419090.1|2989115_2990492_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419089.1|2991610_2992579_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
WP_101836935.1|2992900_2993974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807200.1|2994146_2995115_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_033004173.1|2996205_2996841_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_053513872.1|2996976_2998494_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_024745369.1|2998828_3000709_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
WP_024745370.1|3000897_3001677_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|3001758_3002244_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_082330790.1|3004701_3004941_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_024745371.1|3005190_3005904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745372.1|3007417_3007924_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024745373.1|3008085_3008664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745374.1|3008755_3009256_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807203.1|3009322_3010168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588027.1|3010218_3010497_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745377.1|3010716_3010905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503886.1|3011318_3011927_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024745379.1|3013123_3014941_+	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745380.1|3015069_3017259_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_101807204.1|3017704_3018502_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	3409722	3464205	4705038	transposase,tRNA	Acidithiobacillus_phage(33.33%)	37	NA	NA
WP_107490063.1|3409722_3410825_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.9e-42
WP_024744212.1|3411135_3412047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744213.1|3412171_3414757_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_024744214.1|3415202_3415508_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_024744215.1|3415887_3418503_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.5	2.8e-28
WP_024744216.1|3418803_3419418_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_024744217.1|3419850_3422097_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_024744218.1|3422220_3422628_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_024744219.1|3422968_3424459_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005989873.1|3425077_3425485_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024744220.1|3425629_3426388_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_024744221.1|3426452_3426965_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011258141.1|3427008_3427266_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_024744222.1|3427375_3428173_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_050588001.1|3429412_3430648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744223.1|3430796_3432173_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407903.1|3432557_3433349_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_024744224.1|3433635_3434685_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_024744225.1|3434924_3436508_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_101807217.1|3436695_3437494_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_033003517.1|3438588_3440550_-	response regulator	NA	NA	NA	NA	NA
WP_024743903.1|3440533_3441421_-	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	9.3e-24
WP_024743904.1|3441417_3442428_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_024743905.1|3442418_3442814_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_014504248.1|3442810_3443173_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743906.1|3443174_3444017_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743907.1|3444691_3447016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324164.1|3447040_3449011_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.5e-15
WP_053513725.1|3449122_3450553_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158500223.1|3450649_3450862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513727.1|3451313_3452105_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_101836534.1|3452322_3452604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807218.1|3453411_3454806_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_101807336.1|3455113_3456216_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.8e-43
WP_101807219.1|3456393_3457770_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_058419060.1|3460610_3461987_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_158525114.1|3463092_3464205_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	59.9	6.5e-59
>prophage 18
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	3553145	3573911	4705038	transposase,tRNA	Ralstonia_phage(60.0%)	15	NA	NA
WP_058419069.1|3553145_3554114_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_130625388.1|3554208_3554400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745347.1|3554472_3554865_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_130625389.1|3556650_3557541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419068.1|3558008_3558977_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_082324099.1|3559221_3560598_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_107490060.1|3561600_3562703_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_101807338.1|3563563_3564566_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	4.2e-97
WP_024744854.1|3567650_3567851_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_024744855.1|3568213_3569008_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014504352.1|3569309_3570068_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014504353.1|3570143_3572006_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_024744856.1|3572063_3572405_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_014504356.1|3572663_3572939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807223.1|3573112_3573911_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	3819060	3944117	4705038	tRNA,transposase,protease	Enterobacteria_phage(12.12%)	99	NA	NA
WP_058419057.1|3819060_3820029_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024744620.1|3820230_3820653_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
WP_024744619.1|3821245_3821635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744618.1|3821627_3823280_+|protease	serine protease	protease	NA	NA	NA	NA
WP_101807233.1|3823731_3824538_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
WP_024745219.1|3824590_3825769_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	6.9e-51
WP_050588023.1|3826155_3827085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324136.1|3827249_3828650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745216.1|3828597_3830505_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101807234.1|3830517_3831540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745214.1|3831669_3832509_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745213.1|3833119_3834277_+	phosphotransferase	NA	NA	NA	NA	NA
WP_053513843.1|3834312_3836475_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_053513841.1|3836849_3837425_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_024745210.1|3837530_3838259_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_024745209.1|3838689_3839529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745208.1|3839525_3841829_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	24.4	1.5e-09
WP_101807235.1|3841825_3842656_-	general secretion pathway protein GspN	NA	NA	NA	NA	NA
WP_024745206.1|3842645_3843299_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_024745205.1|3843282_3844404_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|3844400_3845252_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_024745204.1|3845248_3845884_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_024745203.1|3845880_3846297_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_024745202.1|3846293_3846803_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|3846812_3847244_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257722.1|3847511_3848729_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_082324135.1|3848728_3848908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324134.1|3848904_3850644_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_024745200.1|3850761_3852645_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.7	7.0e-21
WP_053513836.1|3852865_3858946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745197.1|3859923_3863976_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	5.8e-121
WP_024745196.1|3864391_3865189_-	DsbC family protein	NA	NA	NA	NA	NA
WP_024745195.1|3865672_3866644_-	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	30.3	1.9e-14
WP_024745194.1|3867069_3867537_+	RDD family protein	NA	NA	NA	NA	NA
WP_082324133.1|3867634_3867946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745193.1|3867950_3869057_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_053513834.1|3869053_3870136_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_024745191.1|3870243_3871716_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
WP_024745189.1|3872071_3872497_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_082324132.1|3872507_3873740_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324131.1|3873742_3874390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745188.1|3874518_3877461_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.2	2.2e-130
WP_053513831.1|3878183_3880157_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.3e-14
WP_101807236.1|3880613_3881990_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	9.2e-63
WP_082324130.1|3882343_3883360_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_082324130.1|3884713_3885730_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_107490067.1|3885929_3887032_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.5e-42
WP_082324419.1|3887590_3888064_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743653.1|3888069_3888537_-	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_024743654.1|3888547_3889321_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_024743655.1|3889452_3889857_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_024743656.1|3889968_3891663_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024743657.1|3891805_3892267_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024743658.1|3892344_3893604_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014504620.1|3893773_3894886_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743659.1|3894971_3895814_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	2.4e-13
WP_024743660.1|3895816_3896743_+	MCE family protein	NA	NA	NA	NA	NA
WP_024743661.1|3896739_3897384_+	ABC transporter	NA	NA	NA	NA	NA
WP_101807240.1|3897526_3898326_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_053513544.1|3898514_3899546_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	7.9e-75
WP_024743254.1|3899874_3900483_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	34.6	1.8e-23
WP_024743255.1|3900599_3902249_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_024743256.1|3902358_3905094_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_024743257.1|3905117_3905756_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_024743258.1|3905755_3906487_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011407616.1|3906620_3907967_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_024743259.1|3908011_3909415_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
WP_024743260.1|3909531_3910440_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
WP_024743261.1|3910436_3910994_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
WP_011407613.1|3910990_3911878_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|3911933_3912989_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_024743262.1|3913370_3914117_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_024743263.1|3914116_3915058_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_024743264.1|3915283_3916102_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_019303336.1|3916091_3917405_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.9e-13
WP_107490046.1|3918026_3919128_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_058419058.1|3921161_3922538_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_033003786.1|3923509_3924580_-	acyltransferase	NA	A9YX16	Burkholderia_phage	33.0	6.5e-40
WP_082324129.1|3924585_3925749_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024744691.1|3925739_3926030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019301789.1|3926050_3926977_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_024744692.1|3928008_3929085_-	SDR family oxidoreductase	NA	A0A1V0SG19	Hokovirus	21.8	2.4e-10
WP_053513098.1|3929119_3929920_-	FkbM family methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	9.3e-07
WP_101807241.1|3929966_3931160_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_024744694.1|3931250_3932621_-	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
WP_003484103.1|3932861_3933080_-	YdcH family protein	NA	NA	NA	NA	NA
WP_024744695.1|3933421_3934312_-	membrane protein	NA	NA	NA	NA	NA
WP_033003790.1|3934308_3934692_-	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_082324128.1|3934784_3935924_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_024744697.1|3936263_3936926_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_033003793.1|3936969_3937959_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_082330772.1|3938120_3938246_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_024744699.1|3938338_3939721_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	6.4e-56
WP_024744700.1|3940145_3940499_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_024744701.1|3940691_3941027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744702.1|3941141_3941816_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_005920832.1|3942140_3942623_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_024744703.1|3942619_3943018_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_101807242.1|3943148_3944117_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
>prophage 20
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	4261270	4338050	4705038	transposase	Acidithiobacillus_phage(21.43%)	56	NA	NA
WP_058419036.1|4261270_4262239_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_050588016.1|4262682_4263153_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024744929.1|4263837_4265970_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_082324401.1|4266456_4266819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744927.1|4266820_4267672_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_024744926.1|4267724_4268606_+	TolB-like protein	NA	NA	NA	NA	NA
WP_024744925.1|4269271_4271833_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_101807267.1|4272065_4272818_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.3	2.8e-21
WP_053513030.1|4272945_4273860_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024744922.1|4273952_4274930_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_014505063.1|4275117_4276110_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_033003934.1|4276330_4276579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744920.1|4276784_4277255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744919.1|4277355_4279146_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_024744918.1|4279350_4281588_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_101807344.1|4283181_4284198_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
WP_082324203.1|4284368_4285745_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743126.1|4288163_4289174_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743127.1|4289574_4290768_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024712051.1|4290764_4291511_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_024743128.1|4291542_4293144_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4293204_4293405_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024743129.1|4293401_4293989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743130.1|4294437_4294710_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024743131.1|4294775_4295765_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_082324107.1|4295834_4296596_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_024743133.1|4296698_4297694_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.5e-26
WP_033003179.1|4297711_4298503_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743135.1|4298504_4299089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033003181.1|4299207_4300146_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_101807269.1|4300259_4300463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|4300502_4301604_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|4302032_4303409_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024744975.1|4303989_4304538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053512924.1|4305025_4305310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744977.1|4305894_4307172_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011257407.1|4307451_4307778_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_024744978.1|4307749_4308244_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	2.7e-17
WP_024744979.1|4308251_4309577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712257.1|4309651_4310695_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.1	1.1e-151
WP_101807270.1|4310892_4313391_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	66.9	4.1e-303
WP_024744981.1|4314006_4315050_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	4.8e-80
WP_024744982.1|4315156_4317865_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024744983.1|4318151_4318766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257400.1|4318837_4320205_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744985.1|4320894_4322718_+	potassium transporter KefB	NA	NA	NA	NA	NA
WP_082330734.1|4324261_4326205_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	37.3	2.6e-79
WP_024743306.1|4326054_4327854_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_082324102.1|4327917_4328247_-	phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_024743307.1|4328273_4331594_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011407425.1|4331586_4331847_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_024743308.1|4332065_4333265_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_024743309.1|4333264_4334038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743310.1|4334034_4334856_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024743311.1|4334852_4336475_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_101807272.1|4336673_4338050_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	2.2e-64
>prophage 21
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	4407544	4577502	4705038	transposase,tRNA	Acidithiobacillus_phage(16.13%)	106	NA	NA
WP_101807275.1|4407544_4408513_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_082324392.1|4408638_4409004_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_024743782.1|4409000_4410302_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_024743781.1|4410482_4411259_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743780.1|4411735_4412320_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_024743779.1|4412512_4415962_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_024743778.1|4416713_4419356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743777.1|4419459_4421859_-	NdvB protein	NA	NA	NA	NA	NA
WP_024743776.1|4421861_4423244_-	MFS transporter	NA	NA	NA	NA	NA
WP_024743775.1|4423401_4423986_+	gluconokinase	NA	NA	NA	NA	NA
WP_024743774.1|4424821_4426552_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	36.1	1.7e-82
WP_082324100.1|4426883_4427189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|4427091_4427532_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_024743773.1|4427551_4427980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|4429526_4430628_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807277.1|4430647_4431616_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_058419036.1|4433046_4434015_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_053513161.1|4434278_4438136_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_024743466.1|4438132_4439914_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_033003342.1|4440088_4442848_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.8	9.3e-147
WP_024743464.1|4443100_4444690_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_024743463.1|4444689_4446948_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_024743462.1|4447105_4448014_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_024743461.1|4448103_4449918_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_158525116.1|4450311_4458771_-	hypothetical protein	NA	A0A1S5SDF1	Streptococcus_phage	32.0	1.3e-10
WP_011409712.1|4459723_4460476_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_024745621.1|4460535_4461435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745620.1|4461587_4462343_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_024745619.1|4462339_4462912_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4462927_4463155_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_024745618.1|4463227_4464133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745617.1|4464286_4465252_+	ferrochelatase	NA	NA	NA	NA	NA
WP_024745616.1|4465254_4466106_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	31.3	1.3e-06
WP_024745615.1|4466186_4466645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745614.1|4466915_4467701_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745613.1|4468316_4469222_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.2	1.4e-43
WP_024745612.1|4469285_4470203_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_053513079.1|4470836_4472174_+	xylose isomerase	NA	NA	NA	NA	NA
WP_024744967.1|4472399_4473467_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_101807280.1|4473621_4475817_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_101807281.1|4475813_4477778_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_101807282.1|4477789_4479049_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_101807349.1|4479048_4480749_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_101807283.1|4480751_4483466_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_101807284.1|4483688_4485209_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	2.5e-45
WP_107490031.1|4485203_4486235_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_082324355.1|4486417_4487794_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_033003464.1|4487970_4489074_+	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
WP_024743784.1|4489165_4489540_-	VOC family protein	NA	NA	NA	NA	NA
WP_082324356.1|4490240_4491257_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_024743734.1|4491879_4492935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743735.1|4493161_4494580_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_024743736.1|4494620_4495598_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_082324358.1|4497002_4498484_-	MFS transporter	NA	NA	NA	NA	NA
WP_082324566.1|4498825_4501699_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743740.1|4501797_4503285_+	MFS transporter	NA	NA	NA	NA	NA
WP_024743741.1|4503316_4504351_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_024743742.1|4504692_4505226_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_101807285.1|4505507_4506476_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	6.6e-100
WP_154221296.1|4506527_4506866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807286.1|4506942_4507748_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.0	7.7e-09
WP_024743989.1|4507949_4508522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011349116.1|4508660_4508879_+	YdcH family protein	NA	NA	NA	NA	NA
WP_024743991.1|4509515_4510496_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_024743992.1|4510691_4513355_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_024743993.1|4513354_4514329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324359.1|4514327_4514573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743994.1|4514741_4515794_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513382.1|4515958_4518997_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_058419058.1|4519835_4521212_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_024743574.1|4523960_4525490_+	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.5	3.9e-46
WP_024743573.1|4525796_4526576_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_024743572.1|4526572_4527583_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_101807288.1|4527862_4528528_+	YceH family protein	NA	NA	NA	NA	NA
WP_101807290.1|4529926_4531903_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	6.3e-113
WP_024743567.1|4532109_4532739_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
WP_024743566.1|4533197_4534436_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_024743565.1|4534578_4536177_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_082324360.1|4536245_4537337_-	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_033003378.1|4537569_4538385_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
WP_058419055.1|4538673_4540050_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024744511.1|4546528_4548433_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.0e-19
WP_024744510.1|4548429_4549032_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_024744509.1|4549132_4550392_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_024744508.1|4550682_4552845_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_024744507.1|4552997_4553204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807291.1|4553411_4553801_-	YchJ family protein	NA	NA	NA	NA	NA
WP_082330766.1|4553858_4554680_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_101807292.1|4554804_4556181_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	4.3e-60
WP_053513660.1|4556312_4557494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513661.1|4557591_4561023_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024745665.1|4561170_4561869_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_024745666.1|4561852_4563325_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_024745667.1|4563321_4563909_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_024745668.1|4563908_4565105_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324363.1|4565178_4565808_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	4.2e-47
WP_050588040.1|4565901_4566399_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513662.1|4567812_4568337_+	FUSC family protein	NA	NA	NA	NA	NA
WP_101807293.1|4568308_4569325_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_024744628.1|4569731_4571093_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
WP_101807219.1|4571273_4572650_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_082324568.1|4573338_4574052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745343.1|4574082_4574589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745344.1|4574862_4575069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745345.1|4575055_4576168_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_107490090.1|4576400_4577502_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.2e-42
>prophage 22
NZ_CP019087	Xanthomonas oryzae pv. oryzae strain MAI95 chromosome, complete genome	4705038	4586228	4644106	4705038	transposase	Acidithiobacillus_phage(30.77%)	44	NA	NA
WP_058419060.1|4586228_4587605_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024742954.1|4588129_4588441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742953.1|4588700_4589183_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_024742952.1|4589479_4590649_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_024742951.1|4590890_4591079_+	CsbD family protein	NA	NA	NA	NA	NA
WP_074038671.1|4591723_4591981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742950.1|4592105_4592555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742949.1|4592711_4593692_+	ATP-binding cassette domain-containing protein	NA	K7PHD1	Enterobacteria_phage	46.4	7.0e-73
WP_082324366.1|4594611_4594968_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743547.1|4595010_4597791_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743548.1|4598077_4599100_+	sugar kinase	NA	NA	NA	NA	NA
WP_154221263.1|4599556_4599697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743549.1|4599720_4600929_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_024743552.1|4602900_4604067_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_154221305.1|4605355_4605724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419197.1|4606018_4607395_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_082324367.1|4607405_4607699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324368.1|4607809_4610005_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
WP_024712580.1|4610103_4611306_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024743645.1|4611576_4612587_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
WP_024743646.1|4612861_4613329_+	DUF4410 domain-containing protein	NA	NA	NA	NA	NA
WP_082324173.1|4614705_4616082_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_158500224.1|4616197_4616515_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101807296.1|4616627_4617596_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625425.1|4618020_4618251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625426.1|4618414_4621060_+	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_131085815.1|4621100_4621847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807297.1|4621868_4623164_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_050587973.1|4623183_4625310_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.3	7.9e-29
WP_101807298.1|4625566_4626814_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.1e-61
WP_082324571.1|4628106_4628517_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_033003354.1|4628776_4629232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625428.1|4629164_4629425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807299.1|4629455_4630343_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_033003355.1|4630676_4632254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743499.1|4632748_4633576_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_058419165.1|4634302_4635361_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_107490046.1|4637104_4638206_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807300.1|4638443_4639004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807296.1|4639002_4639971_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625431.1|4640065_4640368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745548.1|4640439_4641177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033004251.1|4641194_4641887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807103.1|4643080_4644106_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
