The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	7440	60863	4703963	transposase,protease	Leptospira_phage(28.57%)	39	NA	NA
WP_024744592.1|7440_8277_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024744593.1|8461_9268_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024744594.1|9544_10738_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_053513954.1|10891_11560_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014501265.1|11644_12406_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12452_12875_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743315.1|12878_13292_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743314.1|13587_14355_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_024743313.1|14365_14635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743312.1|14709_16170_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_158525106.1|16991_17141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807019.1|17315_18692_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	4.1e-63
WP_101807304.1|18920_19805_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.0e-87
WP_107490060.1|19821_20923_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_024744007.1|21183_22311_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_024744008.1|23381_24722_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_010364746.1|24939_25632_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_008572943.1|25748_26069_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_024744009.1|27366_28890_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
WP_033003570.1|28994_30230_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_024744011.1|30390_31047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053512972.1|31209_33021_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_024744014.1|33168_33519_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024744015.1|33825_34956_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003577.1|35738_36791_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003579.1|37491_38565_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_024744018.1|38873_39932_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_101807021.1|42339_42969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490044.1|43018_44050_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_024744291.1|44131_45613_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024744290.1|45807_50280_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_024744289.1|50481_50862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324081.1|51008_52196_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.3e-41
WP_024744287.1|52398_52704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324376.1|53890_55030_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_024744284.1|55343_56129_-	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_033003662.1|56139_58728_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744282.1|58900_60058_+	ROK family protein	NA	NA	NA	NA	NA
WP_101807022.1|60100_60863_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	322091	388810	4703963	transposase	Leptospira_phage(37.5%)	50	NA	NA
WP_107490044.1|322091_323123_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807309.1|323158_324598_-	HpaF protein	NA	NA	NA	NA	NA
WP_024744915.1|325662_328071_-	serine kinase	NA	NA	NA	NA	NA
WP_107490032.1|329537_330640_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.8e-43
WP_082324345.1|331506_331953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513734.1|331949_333950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744340.1|334723_335194_-	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
WP_130625300.1|335248_335530_-	serine kinase	NA	NA	NA	NA	NA
WP_024744341.1|335610_335853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744342.1|335862_336801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744343.1|336797_337625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744344.1|337621_337882_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744345.1|337886_338531_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744346.1|338517_339471_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_053513737.1|339563_340205_-	type III secretion protein HpaP	NA	NA	NA	NA	NA
WP_053513739.1|340204_342127_-	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_024744349.1|342135_343209_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_011257083.1|343424_343880_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_011407211.1|343913_344306_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_024744351.1|344307_345072_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_024744352.1|345079_345709_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_024744353.1|345693_346395_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_024744354.1|346384_347713_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_053513741.1|347705_348215_+	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_024744356.1|348211_349042_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_053513743.1|349124_350948_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_053513745.1|351687_352119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513747.1|352522_353086_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	39.4	5.2e-12
WP_024744361.1|353549_355103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744362.1|356369_356711_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_053513751.1|356895_359454_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_053513749.1|359472_359733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807032.1|359812_360781_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.6e-98
WP_033003076.1|360906_362631_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	3.0e-34
WP_024742976.1|362871_363813_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_107490044.1|365369_366401_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807033.1|366448_368083_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_050587979.1|368620_370150_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_024742979.1|370146_372378_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_024742980.1|372380_374138_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_082324554.1|374194_376084_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_024742982.1|376080_378684_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|378706_378892_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_024742983.1|379005_381168_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_024742984.1|381184_381817_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_101807034.1|382182_383559_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.0e-78
WP_024743402.1|383640_384396_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024743401.1|384773_386183_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743400.1|386531_386963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419058.1|387433_388810_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
>prophage 3
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	492689	710177	4703963	capsid,holin,terminase,transposase,integrase,tRNA,head,protease,plate,portal,tail	Stenotrophomonas_phage(31.25%)	155	518316:518360	561298:561342
WP_053513464.1|492689_493253_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_024745936.1|493263_495756_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
WP_101807039.1|495938_497213_-	RDD family protein	NA	NA	NA	NA	NA
WP_101807040.1|497254_497977_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_024745938.1|498017_498491_-	DUF494 family protein	NA	NA	NA	NA	NA
WP_101807041.1|498533_499676_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_101807042.1|499747_500884_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_024745941.1|501016_501529_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_024745942.1|501929_502853_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_024745943.1|502852_504166_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_053513456.1|506116_507394_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_024745946.1|507591_508416_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745947.1|508416_509475_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_024745948.1|509641_511147_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_053513469.1|511143_511653_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_019302641.1|511762_512896_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_014504872.1|513138_513660_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033004404.1|513858_514773_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_024745951.1|514873_515314_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014504870.1|515422_517297_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_024745952.1|517489_517810_+	hypothetical protein	NA	NA	NA	NA	NA
518316:518360	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_082330806.1|518429_519704_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	1.1e-110
WP_011257520.1|519837_520044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075243253.1|520040_520313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745956.1|520309_520555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745957.1|520551_520827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745958.1|520988_521399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|521624_521903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|521899_522118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082330809.1|522426_525099_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_011258450.1|525132_525345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|525341_525620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745959.1|525630_525951_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
WP_053503015.1|525953_526211_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|526282_526720_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|527380_528367_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|528363_528765_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_024745960.1|528777_531648_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
WP_011258456.1|531680_531794_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|531802_532105_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|532150_532660_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258459.1|532690_533857_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_024745961.1|533868_534228_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
WP_024745962.1|534224_534788_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
WP_024745963.1|534848_535427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745964.1|535434_536940_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
WP_024745965.1|536949_537495_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
WP_024745966.1|537487_538378_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
WP_024745967.1|538459_538909_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
WP_024745968.1|538896_539316_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
WP_011258470.1|539789_540431_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
WP_024745970.1|540427_540703_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
WP_024745971.1|540695_541052_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
WP_024745972.1|541056_541266_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
WP_012445486.1|541265_541733_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_011258475.1|541832_542552_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_024745974.1|542555_543575_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
WP_024745975.1|543621_544464_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
WP_033004409.1|544585_546370_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
WP_024745977.1|546369_547389_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
WP_082330810.1|547409_547640_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
WP_024745978.1|547572_548277_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
WP_033004412.1|548308_548776_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_024745980.1|548775_549954_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_101807043.1|550684_553444_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
WP_024745590.1|553452_554379_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_101807044.1|554375_557210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743124.1|557237_557969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807045.1|557995_560338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324338.1|561409_561643_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
561298:561342	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_024743230.1|563519_565409_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_011260615.1|565625_565967_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
WP_053513444.1|566165_567890_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.1e-47
WP_024743228.1|567965_568652_+	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
WP_024743227.1|568648_569599_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_082324547.1|569655_570450_+	response regulator	NA	NA	NA	NA	NA
WP_053513446.1|570446_571172_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	4.7e-50
WP_024743224.1|571388_572264_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
WP_053513448.1|572342_572957_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_053513449.1|573009_574302_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003483210.1|576592_576880_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
WP_011260602.1|577023_578664_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
WP_053513452.1|578964_581241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419179.1|582348_583317_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_058419036.1|585702_586671_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_024745526.1|587602_588676_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
WP_053513971.1|589192_591370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513973.1|591463_593881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513975.1|594144_595065_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_024745528.1|595064_595583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513977.1|595744_598570_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_053513979.1|598665_599226_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	1.4e-12
WP_058419055.1|600932_602309_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_101807046.1|603293_603896_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053513670.1|606401_606902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513672.1|607802_608750_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_024745121.1|608886_609477_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_024745122.1|609687_610431_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024745365.1|612746_615434_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_024745366.1|615520_616258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807047.1|616268_617645_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_130625305.1|617824_618385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419175.1|618703_620080_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_053513412.1|620390_623120_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.7	3.8e-68
WP_082324544.1|623188_624364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324336.1|624410_626288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807048.1|626301_627876_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_053513416.1|628008_628971_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_058419060.1|629258_630635_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419174.1|631640_635465_+	avirulence protein	NA	NA	NA	NA	NA
WP_024745997.1|636534_638118_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_082324335.1|638508_638700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745996.1|641200_643525_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_024745994.1|645428_646520_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_024745993.1|647484_648363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324334.1|648551_649436_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024745991.1|649713_651486_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_050588046.1|651883_653584_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_033004419.1|654738_656115_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_024745988.1|656201_657197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745987.1|657442_658354_+	magnesium transporter	NA	NA	NA	NA	NA
WP_024745985.1|658888_659173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745984.1|659502_659949_+	autotransporter	NA	NA	NA	NA	NA
WP_101807049.1|660260_661362_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|662071_663448_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024743083.1|664620_666312_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_024743082.1|666564_667350_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_024743081.1|668593_669598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743080.1|669636_670566_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_024743079.1|671101_673990_-	insulinase family protein	NA	NA	NA	NA	NA
WP_024743078.1|674242_676825_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
WP_101807050.1|677402_678201_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745720.1|680804_682259_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
WP_024745721.1|682466_683954_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
WP_082324540.1|684233_685187_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.7e-15
WP_024745723.1|685355_687005_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_033004321.1|687996_689934_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_024745725.1|690085_690754_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024745726.1|690758_691811_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
WP_024745727.1|691841_692579_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745728.1|692609_693524_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_024745729.1|694086_694887_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_024745730.1|695448_696414_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745731.1|696522_697092_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_024745732.1|697476_697788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745733.1|697855_699949_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_053513809.1|700543_701728_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_024745735.1|701837_703973_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.8e-28
WP_024745736.1|704316_704715_+	YbaN family protein	NA	NA	NA	NA	NA
WP_024745737.1|704772_705015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745738.1|705004_705859_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_082324332.1|705846_706527_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_024745740.1|706720_707638_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.7e-12
WP_024745741.1|708153_708705_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024745742.1|708809_710177_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
>prophage 4
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	761901	832816	4703963	transposase	Ralstonia_phage(20.0%)	55	NA	NA
WP_058419161.1|761901_762870_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
WP_107490082.1|762921_763020_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743525.1|763898_766607_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_158525109.1|766603_766771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050587990.1|766757_769652_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
WP_053513077.1|769648_772045_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_024743528.1|772178_773345_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_050587991.1|773559_774327_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743530.1|774371_775649_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_024743531.1|775689_776757_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743532.1|776763_777792_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_024743533.1|777794_778949_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_024743534.1|779453_780059_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_024743535.1|780055_781309_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_024743536.1|781310_783209_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_024743537.1|783210_785253_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_024743539.1|786466_787699_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.5	2.3e-73
WP_058419068.1|787919_788888_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_101807052.1|794252_794990_-	endonuclease	NA	NA	NA	NA	NA
WP_053513041.1|795039_795855_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_101807053.1|795946_796597_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_082324537.1|796690_797431_-	cytochrome c4	NA	NA	NA	NA	NA
WP_024744861.1|797632_798256_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024744862.1|798349_799045_-	VIT family protein	NA	NA	NA	NA	NA
WP_024744863.1|799260_800625_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_058419060.1|802416_803793_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024712624.1|804567_805053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744626.1|805995_806916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513043.1|806948_808448_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.1	3.6e-12
WP_082324328.1|808444_809164_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024744866.1|809302_810403_+	glycosyltransferase	NA	A0A142BZU7	Faustovirus	28.5	9.8e-15
WP_024744868.1|811538_811814_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024744869.1|811878_812988_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	3.8e-35
WP_024744870.1|813056_813632_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_024744871.1|813691_814522_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_024744872.1|814651_814861_+	DUF4386 family protein	NA	NA	NA	NA	NA
WP_058419036.1|814912_815881_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_082324327.1|816054_816531_+	DUF4386 domain-containing protein	NA	NA	NA	NA	NA
WP_082324326.1|816527_816872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743416.1|817047_818709_-	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	28.6	1.3e-39
WP_024743415.1|818934_819432_+	RcnB family protein	NA	NA	NA	NA	NA
WP_154221260.1|819612_819894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807054.1|820102_822433_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024712241.1|822618_823872_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	1.6e-101
WP_024743412.1|823885_824401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743411.1|824400_824925_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_024743410.1|824921_825407_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101807310.1|825418_826513_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.8e-45
WP_024743408.1|826568_827192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743407.1|827752_828355_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.0	3.9e-26
WP_024743406.1|828351_829491_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	34.3	1.6e-52
WP_024743405.1|829804_830269_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.3	2.2e-24
WP_024743404.1|830265_830736_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_024743403.1|830956_831931_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_101807055.1|832018_832816_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1073122	1135547	4703963	transposase,protease	Leptospira_phage(16.67%)	43	NA	NA
WP_107490031.1|1073122_1074154_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_058419168.1|1075214_1076183_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324317.1|1078085_1079459_-	MFS transporter	NA	NA	NA	NA	NA
WP_024745685.1|1079557_1081597_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_024745686.1|1081804_1082827_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024745687.1|1083242_1084340_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745688.1|1084532_1085042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513257.1|1085061_1085922_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_024745690.1|1085872_1086265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745691.1|1086267_1087476_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	2.9e-20
WP_053513259.1|1087566_1088664_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024745693.1|1088667_1089528_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_024745694.1|1089524_1090478_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_024745695.1|1090485_1091520_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
WP_024745696.1|1091879_1092593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004302.1|1092662_1093685_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_033004295.1|1094200_1096534_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033004296.1|1098948_1101099_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_024745700.1|1101191_1101836_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_024745701.1|1102806_1104105_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_024745702.1|1104172_1105255_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_033004297.1|1105469_1106210_+	CvpA family protein	NA	NA	NA	NA	NA
WP_024745703.1|1106246_1107713_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	8.3e-86
WP_024745704.1|1107851_1108676_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807070.1|1109395_1110194_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745844.1|1110656_1111076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513157.1|1111255_1111999_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_024745846.1|1112633_1113176_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_053513155.1|1113156_1114293_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_033004364.1|1114497_1116024_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_024745848.1|1116195_1118298_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_082324316.1|1118401_1119745_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	5.0e-29
WP_024745850.1|1119802_1120492_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
WP_082324528.1|1120666_1122313_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745852.1|1122462_1122771_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
WP_024745853.1|1122767_1123163_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_014502224.1|1123377_1124385_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_014502225.1|1124525_1125287_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_058419165.1|1126493_1127552_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_058419103.1|1128868_1129837_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_024745448.1|1132124_1133417_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1133509_1134136_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1134260_1135547_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
>prophage 7
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1243047	1394474	4703963	transposase,plate,protease	Ralstonia_phage(15.38%)	108	NA	NA
WP_101807076.1|1243047_1244445_-|protease	serine protease	protease	NA	NA	NA	NA
WP_053513692.1|1244872_1246843_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_024744518.1|1247687_1248533_+	transporter	NA	NA	NA	NA	NA
WP_024744517.1|1248821_1250942_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_024744516.1|1251218_1251680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744515.1|1251811_1252537_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513688.1|1253354_1255496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513686.1|1255612_1257748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807077.1|1257910_1258716_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	5.3e-10
WP_024745783.1|1259818_1261057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745784.1|1261882_1263988_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.7	1.9e-136
WP_050588043.1|1265637_1266285_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	45.5	6.5e-35
WP_024745785.1|1266281_1266833_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_101807315.1|1267198_1270132_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	8.9e-257
WP_024745787.1|1270599_1270791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745788.1|1271221_1272025_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_033004344.1|1272113_1273325_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024745790.1|1273321_1275481_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	2.2e-34
WP_024745792.1|1276289_1276694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745793.1|1276775_1278794_-	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745794.1|1278905_1280576_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_024745795.1|1280572_1281337_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024745796.1|1281436_1283170_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_024745797.1|1283389_1284106_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	2.8e-23
WP_024745798.1|1284098_1285391_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_024745799.1|1285542_1286034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745800.1|1286102_1286360_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_024745801.1|1286362_1287172_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_024745802.1|1287207_1287948_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014502368.1|1287952_1288552_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745803.1|1288796_1289993_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_008574699.1|1289992_1290634_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745804.1|1290984_1292181_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_024745805.1|1292262_1292649_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_024745806.1|1292651_1293326_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_024745807.1|1293389_1294187_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_024745808.1|1294317_1294497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745809.1|1294493_1294778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745812.1|1295393_1296596_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_101807078.1|1296794_1297004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807079.1|1297000_1297417_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024745813.1|1297572_1298304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745814.1|1298503_1299382_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
WP_024745815.1|1299489_1299750_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745816.1|1299809_1301291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745817.1|1301306_1305044_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_101807080.1|1305040_1306024_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513252.1|1306020_1306815_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745820.1|1306867_1307938_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_107490031.1|1308868_1309900_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_101807081.1|1309971_1312794_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.0e-52
WP_101807316.1|1313299_1314316_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.3e-49
WP_058419153.1|1315423_1316800_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
WP_058419152.1|1316943_1318320_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
WP_058419050.1|1318984_1319953_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744031.1|1320366_1320879_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_033003115.1|1323428_1324217_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011259947.1|1324216_1325551_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743027.1|1325702_1326311_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033003111.1|1326696_1327185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467601.1|1327231_1327732_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011409204.1|1327735_1329232_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1329373_1329871_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409203.1|1330018_1330507_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_024743026.1|1330509_1332345_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743025.1|1332308_1333400_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_053513684.1|1333485_1336218_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_014502423.1|1336248_1336602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807082.1|1336694_1339481_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	6.9e-41
WP_053513217.1|1339455_1340328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|1342364_1343467_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024743437.1|1345974_1347039_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_024743436.1|1347053_1347305_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_024743435.1|1347604_1348717_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_024743434.1|1348713_1349256_-	shikimate kinase	NA	NA	NA	NA	NA
WP_024743433.1|1349422_1350022_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_012445807.1|1350202_1350619_+	YjfI family protein	NA	NA	NA	NA	NA
WP_024743432.1|1350631_1351405_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_024743431.1|1351430_1352513_+	potassium channel protein	NA	NA	NA	NA	NA
WP_082324520.1|1352515_1353187_+	YjfK family protein	NA	NA	NA	NA	NA
WP_024743429.1|1353224_1353629_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_024743428.1|1353641_1354214_+	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
WP_024743427.1|1354215_1355382_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
WP_050587989.1|1355744_1356206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743426.1|1358003_1360010_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_082324305.1|1361059_1364206_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743423.1|1364537_1365290_+	SapC family protein	NA	NA	NA	NA	NA
WP_101807084.1|1365300_1366347_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024743421.1|1366387_1367905_+	tryptophan 7-halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
WP_024743420.1|1367942_1368947_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743419.1|1369091_1369490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807085.1|1369621_1370998_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
WP_024745604.1|1371585_1372983_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_024745603.1|1373424_1374807_-	APC family permease	NA	NA	NA	NA	NA
WP_024745602.1|1374999_1375764_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745601.1|1376077_1377019_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_053513783.1|1377774_1379163_+	amino acid permease	NA	NA	NA	NA	NA
WP_101807086.1|1381112_1382567_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	9.0e-93
WP_033004264.1|1382523_1383426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588037.1|1383425_1384667_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
WP_101807087.1|1384899_1385868_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_024744440.1|1386988_1388005_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_082324517.1|1388065_1388860_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_024744438.1|1389019_1390381_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744437.1|1390668_1392399_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
WP_005913389.1|1392457_1392727_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_003487850.1|1392719_1393112_-	PTS fructose IIA component family protein	NA	NA	NA	NA	NA
WP_058419145.1|1393505_1394474_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
>prophage 8
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1419897	1527179	4703963	transposase,tRNA,protease	Ralstonia_phage(18.75%)	87	NA	NA
WP_107490044.1|1419897_1420929_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_058419036.1|1420995_1421964_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_011258205.1|1422267_1422597_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_024743872.1|1422593_1423133_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058419057.1|1423342_1424311_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024743209.1|1424424_1425669_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
WP_024743208.1|1425665_1426928_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_024743207.1|1426927_1427692_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.5	2.0e-11
WP_024743206.1|1427949_1429407_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_024743205.1|1429422_1429881_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_003487757.1|1430052_1430520_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_033003226.1|1430624_1430843_+	peptidase	NA	NA	NA	NA	NA
WP_024743204.1|1431449_1432046_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_033003224.1|1432101_1432644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743203.1|1432701_1433043_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_024743202.1|1433100_1433742_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_024743201.1|1433846_1434272_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_024743200.1|1434827_1435688_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_024743199.1|1435731_1436424_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_101807090.1|1436489_1437255_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743682.1|1437605_1438643_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_024743681.1|1438756_1439887_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_082324514.1|1440176_1440833_+	YitT family protein	NA	NA	NA	NA	NA
WP_024743679.1|1441935_1442508_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_024743678.1|1442504_1442939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003404.1|1442935_1443817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743677.1|1443784_1444351_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_024743676.1|1444343_1444811_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_024743675.1|1444824_1445772_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_024743674.1|1446208_1446643_+	OsmC family protein	NA	NA	NA	NA	NA
WP_024743673.1|1446795_1447395_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743672.1|1447692_1448574_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_024743669.1|1449666_1452276_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_024743668.1|1452259_1452718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743667.1|1452714_1454070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743666.1|1454050_1455457_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_053512934.1|1455773_1456595_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_058419088.1|1456689_1457658_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_024743020.1|1457912_1458911_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_024743021.1|1459186_1459720_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
WP_024743022.1|1460002_1461487_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	5.0e-14
WP_024743023.1|1461780_1462488_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_154221304.1|1463096_1463258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324511.1|1464999_1465677_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_158500229.1|1465798_1466245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016904074.1|1466213_1466438_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_024745822.1|1466437_1468510_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_050588044.1|1468793_1469600_+	pirin family protein	NA	NA	NA	NA	NA
WP_101807093.1|1469686_1470058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419141.1|1470461_1473278_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	4.7e-53
WP_024745912.1|1473277_1474174_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_024745911.1|1474170_1474635_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324298.1|1474658_1475138_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324297.1|1475287_1475767_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324296.1|1475853_1477590_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_082324203.1|1478370_1479747_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743650.1|1480397_1480994_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_058419169.1|1481419_1482796_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_024712501.1|1485699_1486161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625317.1|1487476_1488133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024742990.1|1488400_1489114_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_024742991.1|1489217_1489967_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_082324510.1|1491408_1492530_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_082324295.1|1492544_1493372_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_024743606.1|1493355_1494639_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_024743605.1|1494665_1495181_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743604.1|1495191_1497348_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.4e-09
WP_024743603.1|1497416_1499420_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1499438_1499768_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_131091743.1|1499798_1500026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743602.1|1500257_1503722_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|1504115_1504658_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033003388.1|1505082_1505991_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_024743600.1|1507521_1508334_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_024743598.1|1509279_1509891_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743597.1|1510009_1510894_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_024743596.1|1510915_1512007_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_024743595.1|1512075_1513479_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019302800.1|1513492_1513999_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743594.1|1514401_1514860_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743593.1|1515637_1515841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807094.1|1516004_1517148_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.9	1.2e-84
WP_101807095.1|1517257_1518274_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807096.1|1518559_1519936_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
WP_033004102.1|1519963_1520854_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_024743817.1|1521540_1522137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131112934.1|1526147_1527179_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.7e-74
>prophage 9
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1569867	1637834	4703963	transposase,tRNA,protease	Ralstonia_phage(33.33%)	57	NA	NA
WP_058419068.1|1569867_1570836_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744656.1|1571159_1571453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324504.1|1571531_1571945_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_033003771.1|1572636_1573623_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_053513278.1|1573673_1573907_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_024744651.1|1574380_1574674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807099.1|1575566_1576016_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_053513279.1|1576281_1577139_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
WP_024744648.1|1577343_1577955_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_024744647.1|1578053_1580696_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
WP_024744646.1|1581209_1581845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807100.1|1581867_1582896_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_101807101.1|1582892_1583792_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1583848_1584265_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_053513280.1|1584276_1585392_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_024744641.1|1586481_1586952_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_033003769.1|1587389_1588064_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024744639.1|1588374_1591485_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744638.1|1591951_1592686_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_024744637.1|1592824_1593397_+	Maf-like protein	NA	NA	NA	NA	NA
WP_024744636.1|1593396_1594896_+	ribonuclease G	NA	NA	NA	NA	NA
WP_024744635.1|1595036_1598957_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_024744634.1|1598962_1599715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744633.1|1599813_1601259_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_024744632.1|1601515_1602097_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_024744631.1|1602242_1603610_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_082324502.1|1603684_1604089_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744630.1|1604140_1604602_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744629.1|1604671_1605769_-|protease	protease	protease	NA	NA	NA	NA
WP_101807075.1|1606175_1606973_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745348.1|1607085_1607961_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_024745349.1|1607962_1608223_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_024745350.1|1608254_1609559_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_101807102.1|1609592_1611299_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_024745352.1|1611441_1612782_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_024745353.1|1612791_1613628_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_133285949.1|1613637_1613862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745354.1|1613874_1614366_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024745355.1|1614573_1615323_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_024745356.1|1615432_1615969_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_024745357.1|1616079_1616559_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_024745358.1|1616787_1618032_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_024745359.1|1618039_1619290_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053514015.1|1619286_1620657_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
WP_024744748.1|1622214_1622511_+	cysteine methyltransferase	NA	NA	NA	NA	NA
WP_024744749.1|1622551_1623250_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_058419134.1|1623500_1624469_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_101807103.1|1625052_1626078_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_130625326.1|1627195_1627657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743076.1|1628473_1630489_-	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_101807317.1|1631158_1632175_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	9.6e-49
WP_058419036.1|1632571_1633540_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_154221280.1|1633623_1634193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744531.1|1634558_1635410_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_024744530.1|1635505_1636075_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.9	4.5e-72
WP_024744529.1|1636109_1636295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419036.1|1636865_1637834_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 10
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1698468	1768129	4703963	transposase,integrase,tRNA	Leptospira_phage(20.0%)	54	1696859:1696875	1771642:1771658
1696859:1696875	attL	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
WP_024743628.1|1698468_1699395_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003485583.1|1699551_1699812_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_024743627.1|1699978_1702093_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_024743626.1|1702466_1703507_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_101807108.1|1703570_1704446_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_024743624.1|1704442_1704712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743623.1|1704770_1705274_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
WP_024743622.1|1705270_1706416_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_024743621.1|1706557_1707136_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.6	8.4e-34
WP_024743620.1|1707257_1707578_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_053513476.1|1707574_1708318_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743618.1|1708314_1708914_+	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_024743617.1|1709683_1712878_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743616.1|1712984_1714370_+	LOG family protein	NA	NA	NA	NA	NA
WP_024743615.1|1714539_1715055_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	42.5	1.1e-05
WP_024743614.1|1715051_1715528_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_024743613.1|1715524_1716691_+	PilW family protein	NA	NA	NA	NA	NA
WP_024743612.1|1716694_1717204_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_024743610.1|1718123_1721162_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_024743609.1|1721168_1721624_+	type IV pilin protein	NA	NA	NA	NA	NA
WP_019299933.1|1721800_1722343_-	fimbrial protein	NA	NA	NA	NA	NA
WP_024743608.1|1722481_1724503_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_024744187.1|1726297_1727026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744188.1|1727155_1728250_-	acyltransferase	NA	NA	NA	NA	NA
WP_024744189.1|1728677_1730345_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_024744190.1|1730361_1731219_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_024744191.1|1731403_1732945_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.8	2.7e-79
WP_024744192.1|1732958_1734164_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_024744193.1|1734224_1735595_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_101807109.1|1735916_1736654_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_024744195.1|1736810_1737821_-	membrane protein	NA	NA	NA	NA	NA
WP_024744196.1|1738387_1738951_-	phasin family protein	NA	NA	NA	NA	NA
WP_024744197.1|1739112_1739388_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_101807318.1|1739628_1740438_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_024744199.1|1740379_1741036_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_024744200.1|1741337_1742306_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_053513270.1|1742480_1743566_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	1.7e-75
WP_053513272.1|1743648_1744857_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_024744202.1|1744978_1746292_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_101807110.1|1746333_1747131_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107490046.1|1747326_1748428_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024744617.1|1748848_1749316_-	TonB family protein	NA	NA	NA	NA	NA
WP_058419031.1|1749746_1750715_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_082324283.1|1750836_1751604_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743448.1|1751610_1753002_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
WP_024743447.1|1753462_1754047_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_024743446.1|1754146_1755163_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082324494.1|1755786_1757205_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017154976.1|1757300_1757543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324282.1|1757536_1757878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490965.1|1758430_1759531_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	7.2e-42
WP_101807112.1|1759588_1763182_-	avirulence protein	NA	NA	NA	NA	NA
WP_024743886.1|1764556_1766668_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	1.3e-15
WP_107490049.1|1767163_1768129_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
1771642:1771658	attR	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
>prophage 11
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1839079	1848967	4703963	tRNA	Micromonas_sp._RCC1109_virus(16.67%)	7	NA	NA
WP_053513920.1|1839079_1840756_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.1e-37
WP_011408885.1|1840844_1841486_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_019300309.1|1841658_1842693_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
WP_024745487.1|1842994_1843483_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_024745486.1|1843584_1846233_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
WP_003481884.1|1846372_1846585_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_101807119.1|1848475_1848967_+	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	67.7	4.6e-57
>prophage 12
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	1974568	2061174	4703963	transposase,tRNA	uncultured_Caudovirales_phage(34.78%)	53	NA	NA
WP_024745402.1|1974568_1976086_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	8.6e-86
WP_024745401.1|1976227_1977364_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_024745399.1|1977728_1979906_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.3e-47
WP_019299970.1|1979917_1980787_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_024745398.1|1980963_1982646_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	2.1e-32
WP_024745396.1|1983295_1986064_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1986211_1986460_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1986456_1986867_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024745395.1|1986932_1989524_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_101807129.1|1989877_1990693_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_101807130.1|1991348_1993592_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024745392.1|1993700_1994777_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010365269.1|1994773_1995370_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_019302811.1|1995366_1996233_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_082324264.1|1996478_1998869_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	3.9e-08
WP_082324486.1|1998947_1999292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002806488.1|1999646_2000129_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_082324263.1|2000264_2001062_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_053513169.1|2002103_2004365_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_053513167.1|2004776_2007038_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	2.5e-12
WP_024742986.1|2007629_2010104_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	1.9e-10
WP_107490044.1|2010149_2011181_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_053514012.1|2014208_2016452_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.4e-14
WP_082324099.1|2016710_2018087_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_053513639.1|2018368_2020582_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-09
WP_053513641.1|2020779_2023149_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.7e-09
WP_024744836.1|2023162_2023924_-	transporter	NA	NA	NA	NA	NA
WP_101807131.1|2029431_2031693_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	2.8e-08
WP_158525110.1|2032114_2032279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743066.1|2032591_2034601_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|2034634_2035000_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_010375641.1|2034996_2035305_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_101807132.1|2035405_2036428_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743068.1|2036424_2037207_-	ParA family protein	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
WP_024743069.1|2037208_2038183_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_014503259.1|2038189_2038930_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_024743070.1|2039018_2039372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003138.1|2041658_2042366_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
WP_082330725.1|2042368_2043313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625354.1|2042945_2043881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743072.1|2043882_2046102_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
WP_024743073.1|2046356_2046809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324484.1|2047700_2050742_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082324483.1|2050986_2051265_-	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	70.3	9.0e-34
WP_058419068.1|2051420_2052389_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744204.1|2052872_2053307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807133.1|2054701_2055923_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.7	2.1e-103
WP_082324260.1|2056019_2056421_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745516.1|2056417_2056927_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.0	1.3e-09
WP_024745515.1|2056907_2057249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324259.1|2057262_2057859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419060.1|2057964_2059341_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419060.1|2059797_2061174_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 13
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	2139414	2201855	4703963	transposase,tRNA,protease	Ralstonia_phage(25.0%)	48	NA	NA
WP_101807140.1|2139414_2140551_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024744409.1|2140547_2141006_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024744410.1|2141256_2141577_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
WP_024744411.1|2141719_2144002_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
WP_002813418.1|2144209_2144428_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024744412.1|2144508_2145261_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_024744413.1|2145394_2146024_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
WP_154221278.1|2146215_2146437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744414.1|2146699_2147821_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_101807141.1|2147878_2148847_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.0e-64
WP_101807142.1|2149130_2151488_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_024744416.1|2151650_2153579_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_082324480.1|2153685_2154315_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_033003706.1|2154427_2158594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744419.1|2158830_2160207_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	4.0e-74
WP_024744420.1|2160238_2160565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324256.1|2160561_2160969_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
WP_024744422.1|2161000_2161351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744423.1|2161347_2162679_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	4.3e-41
WP_024744424.1|2162999_2164205_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_024744425.1|2164369_2166742_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_053513574.1|2166766_2167399_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2167617_2168043_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_024744427.1|2168061_2169267_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_024744428.1|2169277_2170066_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_024744429.1|2170062_2170923_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024744430.1|2170993_2171632_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_082324255.1|2171628_2172849_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_024744432.1|2172859_2174257_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_024744433.1|2174571_2175792_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_082330762.1|2176283_2177444_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_101807324.1|2178292_2179309_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	3.3e-49
WP_101807143.1|2179646_2180246_-	DUF1264 domain-containing protein	NA	NA	NA	NA	NA
WP_101807144.1|2180391_2181360_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324479.1|2181508_2181898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744965.1|2181836_2182214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003964.1|2182419_2183673_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_101807145.1|2183710_2184280_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_024744963.1|2184263_2184626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744960.1|2187000_2187978_-	siroheme synthase	NA	NA	NA	NA	NA
WP_024744957.1|2189299_2189488_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024744956.1|2189500_2189776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019302775.1|2190420_2190678_+	stress-induced protein	NA	NA	NA	NA	NA
WP_101807146.1|2190903_2191872_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_024744883.1|2192513_2192999_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807147.1|2193105_2194026_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_024744881.1|2195215_2197027_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_058419089.1|2200886_2201855_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
>prophage 14
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	2220791	2367007	4703963	transposase,plate	Tupanvirus(46.67%)	52	NA	NA
WP_107490085.1|2220791_2221892_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	3.2e-42
WP_101807325.1|2222231_2222594_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_101807151.1|2222650_2226544_+	avirulence protein	NA	NA	NA	NA	NA
WP_101807152.1|2226675_2229762_+	avirulence protein	NA	NA	NA	NA	NA
WP_101807153.1|2229893_2234201_+	avirulence protein	NA	NA	NA	NA	NA
WP_024743648.1|2236132_2237026_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743647.1|2237279_2238932_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.5	9.1e-41
WP_082324252.1|2239025_2239985_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.8	5.7e-11
WP_131112935.1|2240037_2244036_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.7	4.6e-54
WP_130625348.1|2244039_2244522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743561.1|2244432_2247072_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	4.1e-67
WP_024743560.1|2246999_2247707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807155.1|2247937_2260771_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.1	6.1e-132
WP_101807156.1|2260461_2267418_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.3	1.2e-131
WP_101807157.1|2267423_2289836_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	1.1e-133
WP_101807158.1|2289832_2304319_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	1.4e-124
WP_024744003.1|2304850_2305945_+	type III polyketide synthase	NA	NA	NA	NA	NA
WP_024744002.1|2305984_2306728_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024744001.1|2306724_2308002_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_024744000.1|2307989_2309345_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743999.1|2309341_2310139_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024743998.1|2310215_2311922_+	cyclic peptide export ABC transporter	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	22.4	2.0e-06
WP_003468470.1|2312020_2312239_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_101807326.1|2312621_2314205_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743719.1|2317848_2320974_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024743718.1|2321025_2322138_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_053513440.1|2322261_2322840_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053512987.1|2325394_2327482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743837.1|2329419_2332509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033007312.1|2334793_2335501_+	response regulator	NA	NA	NA	NA	NA
WP_101807160.1|2335497_2336490_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033003485.1|2336486_2338946_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_033003483.1|2339059_2340040_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807161.1|2340048_2341077_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_024743830.1|2341249_2341576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513001.1|2341572_2344476_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	1.9e-09
WP_024743828.1|2344472_2345195_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_053513003.1|2345191_2345839_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513005.1|2345835_2349294_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_024743825.1|2349297_2350614_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_024743824.1|2350615_2351953_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743823.1|2351949_2353338_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_024743822.1|2353334_2353874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743821.1|2353882_2355820_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	7.7e-39
WP_024743820.1|2356083_2356545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743819.1|2356647_2356851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324173.1|2357895_2359272_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419068.1|2359434_2360403_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024743894.1|2360844_2363616_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
WP_024743895.1|2363648_2364659_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024743896.1|2364622_2366500_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743897.1|2366503_2367007_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 15
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	2617139	2707955	4703963	transposase,tRNA,protease	Ralstonia_phage(14.29%)	54	NA	NA
WP_014503014.1|2617139_2617580_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.0	7.1e-25
WP_024744763.1|2617658_2618294_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_082324468.1|2618690_2619434_-	cytochrome c1	NA	NA	NA	NA	NA
WP_024744765.1|2619441_2620701_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_024744766.1|2620700_2621345_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_024744767.1|2621872_2622859_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_050588012.1|2624211_2624505_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_130625339.1|2624521_2624761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744770.1|2624799_2626254_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_024744771.1|2626677_2627664_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
WP_033003832.1|2628094_2628739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744772.1|2628793_2629279_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_024744773.1|2629278_2629797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744774.1|2629891_2630770_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024744775.1|2630766_2632047_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_024744776.1|2632062_2633064_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_033003835.1|2633215_2634580_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_101807173.1|2635054_2635903_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744779.1|2635899_2636811_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744780.1|2636939_2638073_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
WP_082324228.1|2638218_2639730_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024744782.1|2639716_2641303_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_024744783.1|2641299_2642502_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_058419102.1|2643350_2644319_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
WP_024743152.1|2646938_2648324_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_024743150.1|2648970_2650350_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_033003186.1|2650349_2651666_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_082330729.1|2651802_2653047_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
WP_024743147.1|2653352_2654633_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_082324226.1|2654934_2655243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743145.1|2655202_2657551_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_024743144.1|2657547_2658393_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_024743143.1|2658399_2660079_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_024743142.1|2660607_2661960_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743141.1|2662020_2665152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743140.1|2665316_2666171_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
WP_101807174.1|2666341_2667646_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_024743138.1|2667787_2671882_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	5.0e-56
WP_058419204.1|2672974_2673943_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_024743589.1|2674429_2679439_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_101807175.1|2679716_2680376_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743591.1|2680390_2681698_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_101807176.1|2681710_2684881_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024744846.1|2687572_2688568_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024744845.1|2688728_2691245_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_024744844.1|2691241_2692198_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_024744843.1|2692356_2694099_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_082324465.1|2694417_2695554_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_058419101.1|2695948_2698711_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	3.6e-42
WP_024712661.1|2698981_2699707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324130.1|2700185_2701202_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807177.1|2703777_2704521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807178.1|2705137_2706514_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_101807049.1|2706853_2707955_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
>prophage 16
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	2901947	3018456	4703963	transposase,tRNA,protease	Ralstonia_phage(13.33%)	84	NA	NA
WP_058419096.1|2901947_2902916_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_082324130.1|2904307_2905324_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807194.1|2905496_2906399_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_101807195.1|2906596_2907964_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.9	1.6e-112
WP_024743338.1|2908215_2908728_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_082324207.1|2908657_2908897_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_024743337.1|2909239_2910739_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743336.1|2910735_2911668_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743335.1|2911848_2914677_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_024743334.1|2914719_2915922_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_014502759.1|2916163_2917600_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
WP_024743333.1|2917798_2918392_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
WP_082324453.1|2918656_2919250_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_024743331.1|2919246_2921016_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
WP_024743330.1|2921258_2922113_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743329.1|2922109_2923513_+	TolC family protein	NA	NA	NA	NA	NA
WP_024743328.1|2923864_2924059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743327.1|2924338_2925460_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_024743326.1|2925456_2926374_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_101807196.1|2926901_2928032_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
WP_024743324.1|2928191_2930117_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
WP_011258741.1|2930258_2930777_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_101807197.1|2930877_2931930_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_024743322.1|2932046_2933711_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_082324204.1|2934153_2934579_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011258737.1|2934668_2935064_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_024743320.1|2935410_2935686_-	RnfH family protein	NA	NA	NA	NA	NA
WP_024743319.1|2935699_2936131_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010366344.1|2936191_2936695_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
WP_024743318.1|2936859_2939307_-	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	26.7	2.6e-15
WP_058419096.1|2941056_2942025_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_101807198.1|2942247_2943624_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	7.3e-60
WP_033003395.1|2944392_2945085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625332.1|2945203_2945629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|2945776_2946878_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_033003338.1|2947857_2948106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082330739.1|2948382_2949537_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_024743456.1|2949536_2950859_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_024743457.1|2950885_2951926_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_082324452.1|2951943_2952804_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_101807199.1|2952839_2953439_+	LysE family translocator	NA	NA	NA	NA	NA
WP_082324200.1|2953505_2954441_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_082324199.1|2954506_2955859_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_058419055.1|2956407_2957784_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_158525112.1|2957780_2958878_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.5e-76
WP_101807049.1|2958926_2960028_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_024743394.1|2963378_2964353_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
WP_024743393.1|2966215_2966941_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
WP_101807075.1|2967403_2968201_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324197.1|2968209_2969664_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.5	4.4e-47
WP_024743064.1|2969730_2971161_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
WP_024743063.1|2971382_2971937_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
WP_024743062.1|2972153_2974094_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
WP_024743061.1|2974269_2974908_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444392.1|2978974_2979766_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743060.1|2979911_2980127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743059.1|2980126_2980894_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_024743058.1|2980955_2981786_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_024743057.1|2981858_2982287_+	cytochrome c	NA	NA	NA	NA	NA
WP_024743056.1|2982418_2982898_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|2983148_2983364_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_024743055.1|2983591_2984077_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_024744839.1|2986695_2988927_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
WP_058419090.1|2989070_2990447_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419089.1|2991565_2992534_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
WP_101836935.1|2992855_2993929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807200.1|2994101_2995070_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_033004173.1|2996160_2996796_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_053513872.1|2996931_2998449_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_024745369.1|2998782_3000663_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
WP_024745370.1|3000851_3001631_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|3001712_3002198_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_082330790.1|3004655_3004895_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_024745371.1|3005144_3005858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745372.1|3007371_3007878_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024745373.1|3008039_3008618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745374.1|3008709_3009210_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807203.1|3009276_3010122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588027.1|3010172_3010451_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745377.1|3010670_3010859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503886.1|3011272_3011881_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024745379.1|3013077_3014895_+	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745380.1|3015023_3017213_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_101807204.1|3017658_3018456_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	3409663	3464148	4703963	transposase,tRNA	Acidithiobacillus_phage(33.33%)	36	NA	NA
WP_107490063.1|3409663_3410766_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.9e-42
WP_024744212.1|3411077_3411989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744213.1|3412113_3414699_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_024744214.1|3415144_3415450_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_024744215.1|3415830_3418446_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.5	2.8e-28
WP_024744216.1|3418746_3419361_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_024744217.1|3419793_3422040_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_024744218.1|3422163_3422571_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_024744219.1|3422911_3424402_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005989873.1|3425020_3425428_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024744220.1|3425572_3426331_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_024744221.1|3426395_3426908_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011258141.1|3426951_3427209_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_024744222.1|3427318_3428116_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_050588001.1|3429355_3430591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744223.1|3430739_3432116_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407903.1|3432500_3433292_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_024744224.1|3433578_3434628_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_024744225.1|3434867_3436451_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_101807217.1|3436638_3437437_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_033003517.1|3438531_3440493_-	response regulator	NA	NA	NA	NA	NA
WP_024743903.1|3440476_3441364_-	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	9.3e-24
WP_024743904.1|3441360_3442371_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_024743905.1|3442361_3442757_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_014504248.1|3442753_3443116_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743906.1|3443117_3443960_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743907.1|3444634_3446959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324164.1|3446983_3448954_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.5e-15
WP_053513725.1|3449065_3450496_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053513727.1|3451256_3452048_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_101836534.1|3452265_3452547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807218.1|3453354_3454749_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_101807336.1|3455056_3456159_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.8e-43
WP_101807219.1|3456336_3457713_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_058419060.1|3460553_3461930_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_158525114.1|3463035_3464148_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	59.9	6.5e-59
>prophage 18
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	3553087	3573853	4703963	transposase,tRNA	Ralstonia_phage(60.0%)	15	NA	NA
WP_058419069.1|3553087_3554056_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_130625388.1|3554150_3554342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745347.1|3554414_3554807_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_130625389.1|3556592_3557483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419068.1|3557950_3558919_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_082324099.1|3559163_3560540_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_107490060.1|3561542_3562645_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_101807338.1|3563505_3564508_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	4.2e-97
WP_024744854.1|3567592_3567793_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_024744855.1|3568155_3568950_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014504352.1|3569251_3570010_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014504353.1|3570085_3571948_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_024744856.1|3572005_3572347_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_014504356.1|3572605_3572881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807223.1|3573054_3573853_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	3819001	3885671	4703963	transposase,tRNA,protease	Staphylococcus_phage(14.29%)	46	NA	NA
WP_058419057.1|3819001_3819970_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024744620.1|3820171_3820594_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
WP_024744619.1|3821186_3821576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744618.1|3821568_3823221_+|protease	serine protease	protease	NA	NA	NA	NA
WP_101807233.1|3823672_3824479_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
WP_024745219.1|3824531_3825710_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	6.9e-51
WP_050588023.1|3826096_3827026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324136.1|3827190_3828591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745216.1|3828538_3830446_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101807234.1|3830458_3831481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745214.1|3831610_3832450_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745213.1|3833060_3834218_+	phosphotransferase	NA	NA	NA	NA	NA
WP_053513843.1|3834253_3836416_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_053513841.1|3836790_3837366_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_024745210.1|3837471_3838200_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_024745209.1|3838630_3839470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745208.1|3839466_3841770_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	24.4	1.5e-09
WP_101807235.1|3841766_3842597_-	general secretion pathway protein GspN	NA	NA	NA	NA	NA
WP_024745206.1|3842586_3843240_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_024745205.1|3843223_3844345_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|3844341_3845193_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_024745204.1|3845189_3845825_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_024745203.1|3845821_3846238_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_024745202.1|3846234_3846744_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|3846753_3847185_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257722.1|3847452_3848670_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_082324135.1|3848669_3848849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324134.1|3848845_3850585_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_024745200.1|3850702_3852586_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.7	7.0e-21
WP_053513836.1|3852806_3858887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745197.1|3859864_3863917_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	5.8e-121
WP_024745196.1|3864332_3865130_-	DsbC family protein	NA	NA	NA	NA	NA
WP_024745195.1|3865613_3866585_-	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	30.3	1.9e-14
WP_024745194.1|3867010_3867478_+	RDD family protein	NA	NA	NA	NA	NA
WP_082324133.1|3867575_3867887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745193.1|3867891_3868998_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_053513834.1|3868994_3870077_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_024745191.1|3870184_3871657_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
WP_024745189.1|3872012_3872438_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_082324132.1|3872448_3873681_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324131.1|3873683_3874331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745188.1|3874459_3877402_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.2	2.2e-130
WP_053513831.1|3878124_3880098_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.3e-14
WP_101807236.1|3880554_3881931_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	9.2e-63
WP_082324130.1|3882284_3883301_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_082324130.1|3884654_3885671_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
>prophage 20
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	3905471	3911841	4703963		Enterobacteria_phage(50.0%)	6	NA	NA
WP_011407616.1|3905471_3906818_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_024743259.1|3906863_3908267_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
WP_024743260.1|3908383_3909292_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
WP_024743261.1|3909288_3909846_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
WP_011407613.1|3909842_3910730_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|3910785_3911841_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
>prophage 21
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	4260125	4336905	4703963	transposase	Acidithiobacillus_phage(21.43%)	56	NA	NA
WP_058419036.1|4260125_4261094_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_050588016.1|4261537_4262008_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024744929.1|4262692_4264825_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_082324401.1|4265311_4265674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744927.1|4265675_4266527_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_024744926.1|4266579_4267461_+	TolB-like protein	NA	NA	NA	NA	NA
WP_024744925.1|4268126_4270688_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_101807267.1|4270920_4271673_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.3	2.8e-21
WP_053513030.1|4271800_4272715_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024744922.1|4272807_4273785_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_014505063.1|4273972_4274965_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_033003934.1|4275185_4275434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744920.1|4275639_4276110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744919.1|4276210_4278001_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_024744918.1|4278205_4280443_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_101807344.1|4282036_4283053_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
WP_082324203.1|4283223_4284600_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743126.1|4287018_4288029_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743127.1|4288429_4289623_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024712051.1|4289619_4290366_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_024743128.1|4290397_4291999_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4292059_4292260_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024743129.1|4292256_4292844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743130.1|4293292_4293565_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024743131.1|4293630_4294620_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_082324107.1|4294689_4295451_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_024743133.1|4295553_4296549_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.5e-26
WP_033003179.1|4296566_4297358_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743135.1|4297359_4297944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033003181.1|4298062_4299001_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_101807269.1|4299114_4299318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|4299357_4300459_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|4300887_4302264_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024744975.1|4302844_4303393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053512924.1|4303880_4304165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744977.1|4304749_4306027_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011257407.1|4306306_4306633_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_024744978.1|4306604_4307099_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	2.7e-17
WP_024744979.1|4307106_4308432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712257.1|4308506_4309550_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.1	1.1e-151
WP_101807270.1|4309747_4312246_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	66.9	4.1e-303
WP_024744981.1|4312861_4313905_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	4.8e-80
WP_024744982.1|4314011_4316720_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024744983.1|4317006_4317621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257400.1|4317692_4319060_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744985.1|4319749_4321573_+	potassium transporter KefB	NA	NA	NA	NA	NA
WP_082330734.1|4323116_4325060_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	37.3	2.6e-79
WP_024743306.1|4324909_4326709_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_082324102.1|4326772_4327102_-	phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_024743307.1|4327128_4330449_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011407425.1|4330441_4330702_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_024743308.1|4330920_4332120_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_024743309.1|4332119_4332893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743310.1|4332889_4333711_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024743311.1|4333707_4335330_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_101807272.1|4335528_4336905_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	2.2e-64
>prophage 22
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	4406399	4576356	4703963	transposase,tRNA	Acidithiobacillus_phage(16.13%)	106	NA	NA
WP_101807275.1|4406399_4407368_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_082324392.1|4407493_4407859_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_024743782.1|4407855_4409157_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_024743781.1|4409337_4410114_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743780.1|4410590_4411175_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_024743779.1|4411367_4414817_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_024743778.1|4415567_4418210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743777.1|4418313_4420713_-	NdvB protein	NA	NA	NA	NA	NA
WP_024743776.1|4420715_4422098_-	MFS transporter	NA	NA	NA	NA	NA
WP_024743775.1|4422255_4422840_+	gluconokinase	NA	NA	NA	NA	NA
WP_024743774.1|4423675_4425406_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	36.1	1.7e-82
WP_082324100.1|4425737_4426043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|4425945_4426386_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_024743773.1|4426405_4426834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|4428380_4429482_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807277.1|4429501_4430470_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_058419036.1|4431900_4432869_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_053513161.1|4433132_4436990_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_024743466.1|4436986_4438768_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_033003342.1|4438942_4441702_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.8	9.3e-147
WP_024743464.1|4441954_4443544_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_024743463.1|4443543_4445802_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_024743462.1|4445959_4446868_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_024743461.1|4446957_4448772_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_158525116.1|4449165_4457625_-	hypothetical protein	NA	A0A1S5SDF1	Streptococcus_phage	32.0	1.3e-10
WP_011409712.1|4458577_4459330_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_024745621.1|4459389_4460289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745620.1|4460441_4461197_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_024745619.1|4461193_4461766_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4461781_4462009_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_024745618.1|4462081_4462987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745617.1|4463140_4464106_+	ferrochelatase	NA	NA	NA	NA	NA
WP_024745616.1|4464108_4464960_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	31.3	1.3e-06
WP_024745615.1|4465040_4465499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745614.1|4465769_4466555_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745613.1|4467170_4468076_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.2	1.4e-43
WP_024745612.1|4468139_4469057_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_053513079.1|4469690_4471028_+	xylose isomerase	NA	NA	NA	NA	NA
WP_024744967.1|4471253_4472321_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_101807280.1|4472475_4474671_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_101807281.1|4474667_4476632_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_101807282.1|4476643_4477903_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_101807349.1|4477902_4479603_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_101807283.1|4479605_4482320_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_101807284.1|4482542_4484063_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	2.5e-45
WP_107490031.1|4484057_4485089_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_082324355.1|4485271_4486648_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_033003464.1|4486824_4487928_+	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
WP_024743784.1|4488019_4488394_-	VOC family protein	NA	NA	NA	NA	NA
WP_082324356.1|4489094_4490111_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_024743734.1|4490733_4491789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743735.1|4492015_4493434_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_024743736.1|4493474_4494452_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_082324358.1|4495856_4497338_-	MFS transporter	NA	NA	NA	NA	NA
WP_082324566.1|4497679_4500553_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743740.1|4500651_4502139_+	MFS transporter	NA	NA	NA	NA	NA
WP_024743741.1|4502170_4503205_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_024743742.1|4503546_4504080_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_101807285.1|4504361_4505330_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	6.6e-100
WP_154221296.1|4505381_4505720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807286.1|4505796_4506602_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.0	7.7e-09
WP_024743989.1|4506803_4507376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011349116.1|4507514_4507733_+	YdcH family protein	NA	NA	NA	NA	NA
WP_024743991.1|4508369_4509350_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_024743992.1|4509545_4512209_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_024743993.1|4512208_4513183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324359.1|4513181_4513427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743994.1|4513595_4514648_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513382.1|4514812_4517851_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_058419058.1|4518689_4520066_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_024743574.1|4522814_4524344_+	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.5	3.9e-46
WP_024743573.1|4524650_4525430_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_024743572.1|4525426_4526437_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_101807288.1|4526716_4527382_+	YceH family protein	NA	NA	NA	NA	NA
WP_101807290.1|4528780_4530757_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	6.3e-113
WP_024743567.1|4530963_4531593_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
WP_024743566.1|4532051_4533290_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_024743565.1|4533432_4535031_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_082324360.1|4535099_4536191_-	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_033003378.1|4536423_4537239_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
WP_058419055.1|4537527_4538904_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024744511.1|4545382_4547287_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.0e-19
WP_024744510.1|4547283_4547886_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_024744509.1|4547986_4549246_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_024744508.1|4549536_4551699_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_024744507.1|4551851_4552058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807291.1|4552265_4552655_-	YchJ family protein	NA	NA	NA	NA	NA
WP_082330766.1|4552712_4553534_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_101807292.1|4553658_4555035_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	4.3e-60
WP_053513660.1|4555166_4556348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513661.1|4556445_4559877_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024745665.1|4560024_4560723_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_024745666.1|4560706_4562179_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_024745667.1|4562175_4562763_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_024745668.1|4562762_4563959_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324363.1|4564032_4564662_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	4.2e-47
WP_050588040.1|4564755_4565253_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513662.1|4566666_4567191_+	FUSC family protein	NA	NA	NA	NA	NA
WP_101807293.1|4567162_4568179_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_024744628.1|4568585_4569947_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
WP_101807219.1|4570127_4571504_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_082324568.1|4572192_4572906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745343.1|4572936_4573443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745344.1|4573716_4573923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745345.1|4573909_4575022_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_107490090.1|4575254_4576356_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.2e-42
>prophage 23
NZ_CP019090	Xanthomonas oryzae pv. oryzae strain MAI129 chromosome, complete genome	4703963	4585082	4642960	4703963	transposase	Acidithiobacillus_phage(30.77%)	44	NA	NA
WP_058419060.1|4585082_4586459_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024742954.1|4586983_4587295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742953.1|4587554_4588037_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_024742952.1|4588333_4589503_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_024742951.1|4589744_4589933_+	CsbD family protein	NA	NA	NA	NA	NA
WP_074038671.1|4590577_4590835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742950.1|4590959_4591409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742949.1|4591565_4592546_+	ATP-binding cassette domain-containing protein	NA	K7PHD1	Enterobacteria_phage	46.4	7.0e-73
WP_082324366.1|4593465_4593822_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743547.1|4593864_4596645_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743548.1|4596931_4597954_+	sugar kinase	NA	NA	NA	NA	NA
WP_154221263.1|4598410_4598551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743549.1|4598574_4599783_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_024743552.1|4601754_4602921_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_154221305.1|4604209_4604578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419197.1|4604872_4606249_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_082324367.1|4606259_4606553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324368.1|4606663_4608859_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
WP_024712580.1|4608957_4610160_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024743645.1|4610430_4611441_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
WP_024743646.1|4611715_4612183_+	DUF4410 domain-containing protein	NA	NA	NA	NA	NA
WP_082324173.1|4613559_4614936_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_158500224.1|4615051_4615369_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101807296.1|4615481_4616450_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625425.1|4616874_4617105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625426.1|4617268_4619914_+	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_131085815.1|4619954_4620701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807297.1|4620722_4622018_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_050587973.1|4622037_4624164_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.3	7.9e-29
WP_101807298.1|4624420_4625668_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.1e-61
WP_082324571.1|4626960_4627371_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_033003354.1|4627630_4628086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625428.1|4628018_4628279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807299.1|4628309_4629197_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_033003355.1|4629530_4631108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743499.1|4631602_4632430_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_058419165.1|4633156_4634215_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_107490046.1|4635958_4637060_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807300.1|4637297_4637858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807296.1|4637856_4638825_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625431.1|4638919_4639222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745548.1|4639293_4640031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033004251.1|4640048_4640741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807103.1|4641934_4642960_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
