The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	7440	60863	4703977	transposase,protease	Leptospira_phage(28.57%)	38	NA	NA
WP_024744592.1|7440_8277_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024744593.1|8461_9268_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024744594.1|9544_10738_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_053513954.1|10891_11560_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014501265.1|11644_12406_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12452_12875_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743315.1|12878_13292_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743314.1|13587_14355_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_024743313.1|14365_14635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743312.1|14709_16170_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_101807019.1|17315_18692_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	4.1e-63
WP_101807304.1|18920_19805_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.0e-87
WP_107490060.1|19821_20923_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_024744007.1|21183_22311_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_024744008.1|23381_24722_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_010364746.1|24939_25632_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_008572943.1|25748_26069_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_024744009.1|27366_28890_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
WP_033003570.1|28994_30230_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_024744011.1|30390_31047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053512972.1|31209_33021_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_024744014.1|33168_33519_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024744015.1|33825_34956_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003577.1|35738_36791_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003579.1|37491_38565_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_024744018.1|38873_39932_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_101807021.1|42339_42969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490044.1|43018_44050_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_024744291.1|44131_45613_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024744290.1|45807_50280_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_024744289.1|50481_50862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324081.1|51008_52196_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.3e-41
WP_024744287.1|52398_52704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324376.1|53890_55030_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_024744284.1|55343_56129_-	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_033003662.1|56139_58728_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744282.1|58900_60058_+	ROK family protein	NA	NA	NA	NA	NA
WP_101807022.1|60100_60863_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	322094	388813	4703977	transposase	Leptospira_phage(37.5%)	50	NA	NA
WP_107490044.1|322094_323126_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807309.1|323161_324601_-	HpaF protein	NA	NA	NA	NA	NA
WP_024744915.1|325665_328074_-	serine kinase	NA	NA	NA	NA	NA
WP_107490032.1|329540_330643_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.8e-43
WP_082324345.1|331509_331956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513734.1|331952_333953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744340.1|334726_335197_-	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
WP_130625300.1|335251_335533_-	serine kinase	NA	NA	NA	NA	NA
WP_024744341.1|335613_335856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744342.1|335865_336804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744343.1|336800_337628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744344.1|337624_337885_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744345.1|337889_338534_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744346.1|338520_339474_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_053513737.1|339566_340208_-	type III secretion protein HpaP	NA	NA	NA	NA	NA
WP_053513739.1|340207_342130_-	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_024744349.1|342138_343212_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_011257083.1|343427_343883_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_011407211.1|343916_344309_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_024744351.1|344310_345075_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_024744352.1|345082_345712_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_024744353.1|345696_346398_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_024744354.1|346387_347716_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_053513741.1|347708_348218_+	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_024744356.1|348214_349045_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_053513743.1|349127_350951_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_053513745.1|351690_352122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513747.1|352525_353089_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	39.4	5.2e-12
WP_024744361.1|353552_355106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744362.1|356372_356714_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_053513751.1|356898_359457_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_053513749.1|359475_359736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807032.1|359815_360784_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.6e-98
WP_033003076.1|360909_362634_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	3.0e-34
WP_024742976.1|362874_363816_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_107490044.1|365372_366404_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807033.1|366451_368086_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_050587979.1|368623_370153_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_024742979.1|370149_372381_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_024742980.1|372383_374141_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_082324554.1|374197_376087_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_024742982.1|376083_378687_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|378709_378895_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_024742983.1|379008_381171_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_024742984.1|381187_381820_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_101807034.1|382185_383562_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.0e-78
WP_024743402.1|383643_384399_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024743401.1|384776_386186_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743400.1|386534_386966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419058.1|387436_388813_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
>prophage 3
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	492692	602313	4703977	portal,capsid,head,integrase,tRNA,tail,plate,holin,terminase,transposase	Stenotrophomonas_phage(40.82%)	94	518319:518363	561302:561346
WP_053513464.1|492692_493256_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_024745936.1|493266_495759_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
WP_101807039.1|495941_497216_-	RDD family protein	NA	NA	NA	NA	NA
WP_101807040.1|497257_497980_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_024745938.1|498020_498494_-	DUF494 family protein	NA	NA	NA	NA	NA
WP_101807041.1|498536_499679_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_101807042.1|499750_500887_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_024745941.1|501019_501532_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_024745942.1|501932_502856_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_024745943.1|502855_504169_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_053513456.1|506119_507397_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_024745946.1|507594_508419_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745947.1|508419_509478_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_024745948.1|509644_511150_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_053513469.1|511146_511656_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_019302641.1|511765_512899_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_014504872.1|513141_513663_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033004404.1|513861_514776_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_024745951.1|514876_515317_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014504870.1|515425_517300_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_024745952.1|517492_517813_+	hypothetical protein	NA	NA	NA	NA	NA
518319:518363	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_082330806.1|518432_519707_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	1.1e-110
WP_011257520.1|519840_520047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075243253.1|520043_520316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745956.1|520312_520558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745957.1|520554_520830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745958.1|520991_521402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|521627_521906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|521902_522121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082330809.1|522429_525102_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_011258450.1|525135_525348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|525344_525623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745959.1|525633_525954_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
WP_053503015.1|525956_526214_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|526285_526723_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|527383_528370_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|528366_528768_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_024745960.1|528780_531651_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
WP_011258456.1|531683_531797_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|531805_532108_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|532153_532663_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258459.1|532693_533860_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_024745961.1|533871_534231_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
WP_024745962.1|534227_534791_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
WP_024745963.1|534851_535430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745964.1|535437_536943_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
WP_024745965.1|536952_537498_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
WP_024745966.1|537490_538381_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
WP_024745967.1|538462_538912_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
WP_024745968.1|538899_539319_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
WP_011258470.1|539792_540434_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
WP_024745970.1|540430_540706_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
WP_024745971.1|540698_541055_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
WP_024745972.1|541059_541269_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
WP_012445486.1|541268_541736_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_011258475.1|541835_542555_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_024745974.1|542558_543578_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
WP_024745975.1|543624_544467_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
WP_033004409.1|544588_546373_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
WP_024745977.1|546372_547392_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
WP_082330810.1|547412_547643_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
WP_024745978.1|547575_548280_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
WP_033004412.1|548311_548779_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_024745980.1|548778_549957_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_101807043.1|550687_553447_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
WP_024745590.1|553455_554382_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_101807044.1|554378_557213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743124.1|557240_557972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807045.1|557998_560341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101836529.1|560908_561109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324338.1|561413_561647_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
561302:561346	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_024743230.1|563523_565413_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_011260615.1|565629_565971_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
WP_053513444.1|566169_567894_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.1e-47
WP_024743228.1|567969_568656_+	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
WP_024743227.1|568652_569603_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_082324547.1|569659_570454_+	response regulator	NA	NA	NA	NA	NA
WP_053513446.1|570450_571176_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	4.7e-50
WP_024743224.1|571392_572268_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
WP_053513448.1|572346_572961_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_053513449.1|573013_574306_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003483210.1|576596_576884_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
WP_011260602.1|577027_578668_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
WP_053513452.1|578968_581245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419179.1|582352_583321_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_058419036.1|585706_586675_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_024745526.1|587606_588680_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
WP_053513971.1|589196_591374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513973.1|591467_593885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513975.1|594148_595069_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_024745528.1|595068_595587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513977.1|595748_598574_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_053513979.1|598669_599230_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	1.4e-12
WP_058419055.1|600936_602313_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 4
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	616272	710181	4703977	transposase,protease	Acidithiobacillus_phage(26.67%)	55	NA	NA
WP_101807047.1|616272_617649_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_130625305.1|617828_618389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419175.1|618707_620084_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_053513412.1|620394_623124_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.7	3.8e-68
WP_082324544.1|623192_624368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324336.1|624414_626292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807048.1|626305_627880_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_053513416.1|628012_628975_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_058419060.1|629262_630639_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419174.1|631644_635469_+	avirulence protein	NA	NA	NA	NA	NA
WP_024745997.1|636538_638122_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_082324335.1|638512_638704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745996.1|641204_643529_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_024745994.1|645432_646524_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_024745993.1|647488_648367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324334.1|648555_649440_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024745991.1|649717_651490_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_050588046.1|651887_653588_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_033004419.1|654742_656119_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_024745988.1|656205_657201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745987.1|657446_658358_+	magnesium transporter	NA	NA	NA	NA	NA
WP_024745985.1|658892_659177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745984.1|659506_659953_+	autotransporter	NA	NA	NA	NA	NA
WP_101807049.1|660264_661366_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|662075_663452_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024743083.1|664624_666316_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_024743082.1|666568_667354_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_024743081.1|668597_669602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743080.1|669640_670570_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_024743079.1|671105_673994_-	insulinase family protein	NA	NA	NA	NA	NA
WP_024743078.1|674246_676829_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
WP_101807050.1|677406_678205_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745720.1|680808_682263_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
WP_024745721.1|682470_683958_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
WP_082324540.1|684237_685191_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.7e-15
WP_024745723.1|685359_687009_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_033004321.1|688000_689938_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_024745725.1|690089_690758_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024745726.1|690762_691815_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
WP_024745727.1|691845_692583_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745728.1|692613_693528_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_024745729.1|694090_694891_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_024745730.1|695452_696418_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745731.1|696526_697096_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_024745732.1|697480_697792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745733.1|697859_699953_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_053513809.1|700547_701732_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_024745735.1|701841_703977_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.8e-28
WP_024745736.1|704320_704719_+	YbaN family protein	NA	NA	NA	NA	NA
WP_024745737.1|704776_705019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745738.1|705008_705863_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_082324332.1|705850_706531_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_024745740.1|706724_707642_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.7e-12
WP_024745741.1|708157_708709_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024745742.1|708813_710181_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
>prophage 5
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	728017	815885	4703977	transposase	Ralstonia_phage(16.67%)	60	NA	NA
WP_053513544.1|728017_729049_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	7.9e-75
WP_024743814.1|730350_731742_+	endopolygalacturonase	NA	NA	NA	NA	NA
WP_024743813.1|732010_733150_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_024743812.1|733146_734562_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_024743811.1|735063_736269_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	1.6e-66
WP_011409453.1|737348_737627_+	YbeD family protein	NA	NA	NA	NA	NA
WP_024743809.1|737614_738313_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_024743808.1|738327_739341_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_033003474.1|739739_741923_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.4	3.7e-82
WP_024743806.1|742214_743081_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_024743805.1|743242_744298_+	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	3.7e-80
WP_024743804.1|744420_745824_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.6	6.6e-133
WP_024743801.1|748043_748805_+	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409446.1|748929_749310_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_058419171.1|749481_750819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743799.1|750839_751781_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.6	8.5e-68
WP_024743798.1|752120_753179_-	oxidoreductase	NA	NA	NA	NA	NA
WP_082324538.1|753338_753701_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_024743796.1|753985_755797_+	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	27.8	3.5e-09
WP_011260315.1|755793_756234_+	response regulator	NA	NA	NA	NA	NA
WP_101836928.1|756237_757740_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.9	4.9e-09
WP_024743794.1|757831_758347_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_024743793.1|758515_759253_-	pteridine reductase	NA	NA	NA	NA	NA
WP_033003467.1|759320_760505_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_058419161.1|761905_762874_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
WP_107490082.1|762925_763024_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743525.1|763902_766611_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_050587990.1|766761_769656_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
WP_053513077.1|769652_772049_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_024743528.1|772182_773349_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_050587991.1|773563_774331_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743530.1|774375_775653_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_024743531.1|775693_776761_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743532.1|776767_777796_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_024743533.1|777798_778953_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_024743534.1|779457_780063_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_024743535.1|780059_781313_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_024743536.1|781314_783213_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_024743537.1|783214_785257_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_024743539.1|786470_787703_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.5	2.3e-73
WP_058419068.1|787923_788892_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_101807052.1|794256_794994_-	endonuclease	NA	NA	NA	NA	NA
WP_053513041.1|795043_795859_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_101807053.1|795950_796601_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_082324537.1|796694_797435_-	cytochrome c4	NA	NA	NA	NA	NA
WP_024744861.1|797636_798260_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024744862.1|798353_799049_-	VIT family protein	NA	NA	NA	NA	NA
WP_024744863.1|799264_800629_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_058419060.1|802420_803797_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024712624.1|804571_805057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744626.1|805999_806920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513043.1|806952_808452_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.1	3.6e-12
WP_082324328.1|808448_809168_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024744866.1|809306_810407_+	glycosyltransferase	NA	A0A142BZU7	Faustovirus	28.5	9.8e-15
WP_024744868.1|811542_811818_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024744869.1|811882_812992_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	3.8e-35
WP_024744870.1|813060_813636_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_024744871.1|813695_814526_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_024744872.1|814655_814865_+	DUF4386 family protein	NA	NA	NA	NA	NA
WP_058419036.1|814916_815885_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 6
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1073126	1135551	4703977	transposase,protease	Leptospira_phage(16.67%)	44	NA	NA
WP_107490031.1|1073126_1074158_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_058419168.1|1075218_1076187_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324317.1|1078089_1079463_-	MFS transporter	NA	NA	NA	NA	NA
WP_024745685.1|1079561_1081601_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_024745686.1|1081808_1082831_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024745687.1|1083246_1084344_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745688.1|1084536_1085046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513257.1|1085065_1085926_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_024745690.1|1085876_1086269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745691.1|1086271_1087480_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	2.9e-20
WP_053513259.1|1087570_1088668_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024745693.1|1088671_1089532_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_024745694.1|1089528_1090482_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_024745695.1|1090489_1091524_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
WP_024745696.1|1091883_1092597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004302.1|1092666_1093689_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_024745698.1|1093920_1094208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004295.1|1094204_1096538_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033004296.1|1098952_1101103_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_024745700.1|1101195_1101840_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_024745701.1|1102810_1104109_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_024745702.1|1104176_1105259_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_033004297.1|1105473_1106214_+	CvpA family protein	NA	NA	NA	NA	NA
WP_024745703.1|1106250_1107717_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	8.3e-86
WP_024745704.1|1107855_1108680_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807070.1|1109399_1110198_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745844.1|1110660_1111080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513157.1|1111259_1112003_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_024745846.1|1112637_1113180_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_053513155.1|1113160_1114297_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_033004364.1|1114501_1116028_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_024745848.1|1116199_1118302_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_082324316.1|1118405_1119749_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	5.0e-29
WP_024745850.1|1119806_1120496_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
WP_082324528.1|1120670_1122317_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745852.1|1122466_1122775_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
WP_024745853.1|1122771_1123167_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_014502224.1|1123381_1124389_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_014502225.1|1124529_1125291_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_058419165.1|1126497_1127556_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_058419103.1|1128872_1129841_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_024745448.1|1132128_1133421_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1133513_1134140_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1134264_1135551_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
>prophage 8
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1243051	1319955	4703977	transposase,protease	Bacillus_phage(14.29%)	53	NA	NA
WP_101807076.1|1243051_1244449_-|protease	serine protease	protease	NA	NA	NA	NA
WP_053513692.1|1244876_1246847_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_024744518.1|1247691_1248537_+	transporter	NA	NA	NA	NA	NA
WP_024744517.1|1248825_1250946_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_024744516.1|1251222_1251684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744515.1|1251815_1252541_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513688.1|1253358_1255500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513686.1|1255616_1257752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807077.1|1257914_1258720_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	5.3e-10
WP_024745783.1|1259822_1261061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745784.1|1261886_1263992_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.7	1.9e-136
WP_050588043.1|1265641_1266289_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	45.5	6.5e-35
WP_024745785.1|1266285_1266837_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_101807315.1|1267202_1270136_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	8.9e-257
WP_024745787.1|1270603_1270795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745788.1|1271225_1272029_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_033004344.1|1272117_1273329_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024745790.1|1273325_1275485_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	2.2e-34
WP_024745792.1|1276293_1276698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745793.1|1276779_1278798_-	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745794.1|1278909_1280580_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_024745795.1|1280576_1281341_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024745796.1|1281440_1283174_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_024745797.1|1283393_1284110_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	2.8e-23
WP_024745798.1|1284102_1285395_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_024745799.1|1285546_1286038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745800.1|1286106_1286364_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_024745801.1|1286366_1287176_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_024745802.1|1287211_1287952_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014502368.1|1287956_1288556_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745803.1|1288800_1289997_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_008574699.1|1289996_1290638_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745804.1|1290988_1292185_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_024745805.1|1292266_1292653_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_024745806.1|1292655_1293330_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_024745807.1|1293393_1294191_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_024745808.1|1294321_1294501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745809.1|1294497_1294782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745812.1|1295397_1296600_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_131112933.1|1296696_1296909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807079.1|1297004_1297421_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024745813.1|1297576_1298308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745814.1|1298507_1299386_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
WP_024745815.1|1299493_1299754_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_101807080.1|1305042_1306026_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513252.1|1306022_1306817_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745820.1|1306869_1307940_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_107490031.1|1308870_1309902_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_101807081.1|1309973_1312796_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.0e-52
WP_101807316.1|1313301_1314318_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.3e-49
WP_058419153.1|1315425_1316802_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
WP_058419152.1|1316945_1318322_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
WP_058419050.1|1318986_1319955_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
>prophage 9
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1324218	1394477	4703977	transposase,plate	Ralstonia_phage(25.0%)	51	NA	NA
WP_011259947.1|1324218_1325553_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743027.1|1325704_1326313_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033003111.1|1326698_1327187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467601.1|1327233_1327734_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011409204.1|1327737_1329234_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1329375_1329873_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409203.1|1330020_1330509_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_024743026.1|1330511_1332347_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743025.1|1332310_1333402_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_053513684.1|1333487_1336220_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_014502423.1|1336250_1336604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807082.1|1336696_1339483_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	6.9e-41
WP_053513217.1|1339457_1340330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|1342366_1343469_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024743437.1|1345977_1347042_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_024743436.1|1347056_1347308_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_024743435.1|1347607_1348720_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_024743434.1|1348716_1349259_-	shikimate kinase	NA	NA	NA	NA	NA
WP_024743433.1|1349425_1350025_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_012445807.1|1350205_1350622_+	YjfI family protein	NA	NA	NA	NA	NA
WP_024743432.1|1350634_1351408_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_024743431.1|1351433_1352516_+	potassium channel protein	NA	NA	NA	NA	NA
WP_082324520.1|1352518_1353190_+	YjfK family protein	NA	NA	NA	NA	NA
WP_024743429.1|1353227_1353632_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_024743428.1|1353644_1354217_+	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
WP_024743427.1|1354218_1355385_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
WP_050587989.1|1355747_1356209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743426.1|1358006_1360013_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_082324305.1|1361062_1364209_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743423.1|1364540_1365293_+	SapC family protein	NA	NA	NA	NA	NA
WP_101807084.1|1365303_1366350_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024743421.1|1366390_1367908_+	tryptophan 7-halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
WP_024743420.1|1367945_1368950_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743419.1|1369094_1369493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807085.1|1369624_1371001_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
WP_024745604.1|1371588_1372986_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_024745603.1|1373427_1374810_-	APC family permease	NA	NA	NA	NA	NA
WP_024745602.1|1375002_1375767_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745601.1|1376080_1377022_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_053513783.1|1377777_1379166_+	amino acid permease	NA	NA	NA	NA	NA
WP_101807086.1|1381115_1382570_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	9.0e-93
WP_033004264.1|1382526_1383429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588037.1|1383428_1384670_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
WP_101807087.1|1384902_1385871_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_024744440.1|1386991_1388008_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_082324517.1|1388068_1388863_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_024744438.1|1389022_1390384_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744437.1|1390671_1392402_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
WP_005913389.1|1392460_1392730_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_003487850.1|1392722_1393115_-	PTS fructose IIA component family protein	NA	NA	NA	NA	NA
WP_058419145.1|1393508_1394477_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
>prophage 10
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1419909	1527190	4703977	transposase,tRNA,protease	Ralstonia_phage(18.75%)	87	NA	NA
WP_107490044.1|1419909_1420941_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_058419036.1|1421007_1421976_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_011258205.1|1422279_1422609_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_024743872.1|1422605_1423145_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058419057.1|1423354_1424323_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024743209.1|1424436_1425681_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
WP_024743208.1|1425677_1426940_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_024743207.1|1426939_1427704_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.5	2.0e-11
WP_024743206.1|1427961_1429419_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_024743205.1|1429434_1429893_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_003487757.1|1430064_1430532_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_033003226.1|1430636_1430855_+	peptidase	NA	NA	NA	NA	NA
WP_024743204.1|1431461_1432058_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_033003224.1|1432113_1432656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743203.1|1432713_1433055_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_024743202.1|1433112_1433754_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_101836931.1|1433858_1434242_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_024743200.1|1434838_1435699_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_024743199.1|1435742_1436435_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_101807090.1|1436500_1437266_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743682.1|1437616_1438654_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_024743681.1|1438767_1439898_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_082324514.1|1440187_1440844_+	YitT family protein	NA	NA	NA	NA	NA
WP_024743679.1|1441946_1442519_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_024743678.1|1442515_1442950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003404.1|1442946_1443828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743677.1|1443795_1444362_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_024743676.1|1444354_1444822_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_024743675.1|1444835_1445783_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_024743674.1|1446219_1446654_+	OsmC family protein	NA	NA	NA	NA	NA
WP_024743673.1|1446806_1447406_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743672.1|1447703_1448585_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_024743669.1|1449677_1452287_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_024743668.1|1452270_1452729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743667.1|1452725_1454081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743666.1|1454061_1455468_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_053512934.1|1455784_1456606_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_058419088.1|1456700_1457669_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_024743020.1|1457923_1458922_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_024743021.1|1459197_1459731_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
WP_024743022.1|1460013_1461498_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	5.0e-14
WP_024743023.1|1461791_1462499_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_154221304.1|1463107_1463269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324511.1|1465010_1465688_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_158500229.1|1465809_1466256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016904074.1|1466224_1466449_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_024745822.1|1466448_1468521_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_050588044.1|1468804_1469611_+	pirin family protein	NA	NA	NA	NA	NA
WP_101807093.1|1469697_1470069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419141.1|1470472_1473289_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	4.7e-53
WP_024745912.1|1473288_1474185_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_024745911.1|1474181_1474646_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324298.1|1474669_1475149_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324297.1|1475298_1475778_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324296.1|1475864_1477601_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_082324203.1|1478381_1479758_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743650.1|1480408_1481005_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_058419169.1|1481430_1482807_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_024712501.1|1485710_1486172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625317.1|1487487_1488144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024742990.1|1488411_1489125_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_024742991.1|1489228_1489978_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_082324510.1|1491419_1492541_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_082324295.1|1492555_1493383_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_024743606.1|1493366_1494650_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_024743605.1|1494676_1495192_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743604.1|1495202_1497359_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.4e-09
WP_024743603.1|1497427_1499431_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1499449_1499779_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_131091743.1|1499809_1500037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743602.1|1500268_1503733_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|1504126_1504669_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033003388.1|1505093_1506002_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_024743600.1|1507532_1508345_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_024743598.1|1509290_1509902_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743597.1|1510020_1510905_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_024743596.1|1510926_1512018_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_024743595.1|1512086_1513490_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019302800.1|1513503_1514010_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743594.1|1514412_1514871_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743593.1|1515648_1515852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807094.1|1516015_1517159_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.9	1.2e-84
WP_101807095.1|1517268_1518285_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807096.1|1518570_1519947_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
WP_033004102.1|1519974_1520865_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_024743817.1|1521551_1522148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131112934.1|1526158_1527190_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.7e-74
>prophage 11
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1569881	1637848	4703977	transposase,tRNA,protease	Ralstonia_phage(33.33%)	57	NA	NA
WP_058419068.1|1569881_1570850_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744656.1|1571173_1571467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324504.1|1571545_1571959_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_033003771.1|1572650_1573637_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_053513278.1|1573687_1573921_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_024744651.1|1574394_1574688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807099.1|1575580_1576030_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_053513279.1|1576295_1577153_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
WP_024744648.1|1577357_1577969_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_024744647.1|1578067_1580710_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
WP_024744646.1|1581223_1581859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807100.1|1581881_1582910_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_101807101.1|1582906_1583806_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1583862_1584279_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_053513280.1|1584290_1585406_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_024744641.1|1586495_1586966_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_033003769.1|1587403_1588078_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024744639.1|1588388_1591499_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744638.1|1591965_1592700_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_024744637.1|1592838_1593411_+	Maf-like protein	NA	NA	NA	NA	NA
WP_024744636.1|1593410_1594910_+	ribonuclease G	NA	NA	NA	NA	NA
WP_024744635.1|1595050_1598971_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_024744634.1|1598976_1599729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744633.1|1599827_1601273_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_024744632.1|1601529_1602111_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_024744631.1|1602256_1603624_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_082324502.1|1603698_1604103_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744630.1|1604154_1604616_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744629.1|1604685_1605783_-|protease	protease	protease	NA	NA	NA	NA
WP_101807075.1|1606189_1606987_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745348.1|1607099_1607975_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_024745349.1|1607976_1608237_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_024745350.1|1608268_1609573_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_101807102.1|1609606_1611313_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_024745352.1|1611455_1612796_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_024745353.1|1612805_1613642_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_130625325.1|1613648_1613876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745354.1|1613888_1614380_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024745355.1|1614587_1615337_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_024745356.1|1615446_1615983_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_024745357.1|1616093_1616573_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_024745358.1|1616801_1618046_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_024745359.1|1618053_1619304_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053514015.1|1619300_1620671_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
WP_024744748.1|1622228_1622525_+	cysteine methyltransferase	NA	NA	NA	NA	NA
WP_024744749.1|1622565_1623264_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_058419134.1|1623514_1624483_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_101807103.1|1625066_1626092_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_058419132.1|1627209_1627632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743076.1|1628487_1630503_-	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_101807317.1|1631172_1632189_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	9.6e-49
WP_058419036.1|1632585_1633554_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_154221280.1|1633637_1634207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744531.1|1634572_1635424_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_024744530.1|1635519_1636089_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.9	4.5e-72
WP_024744529.1|1636123_1636309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419036.1|1636879_1637848_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 12
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1698483	1768144	4703977	transposase,tRNA,integrase	Leptospira_phage(20.0%)	54	1696874:1696890	1771657:1771673
1696874:1696890	attL	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
WP_024743628.1|1698483_1699410_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003485583.1|1699566_1699827_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_024743627.1|1699993_1702108_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_024743626.1|1702481_1703522_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_101807108.1|1703585_1704461_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_024743624.1|1704457_1704727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743623.1|1704785_1705289_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
WP_024743622.1|1705285_1706431_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_024743621.1|1706572_1707151_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.6	8.4e-34
WP_024743620.1|1707272_1707593_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_053513476.1|1707589_1708333_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743618.1|1708329_1708929_+	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_024743617.1|1709698_1712893_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743616.1|1712999_1714385_+	LOG family protein	NA	NA	NA	NA	NA
WP_024743615.1|1714554_1715070_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	42.5	1.1e-05
WP_024743614.1|1715066_1715543_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_024743613.1|1715539_1716706_+	PilW family protein	NA	NA	NA	NA	NA
WP_024743612.1|1716709_1717219_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_024743610.1|1718138_1721177_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_024743609.1|1721183_1721639_+	type IV pilin protein	NA	NA	NA	NA	NA
WP_019299933.1|1721815_1722358_-	fimbrial protein	NA	NA	NA	NA	NA
WP_024743608.1|1722496_1724518_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_024744187.1|1726312_1727041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744188.1|1727170_1728265_-	acyltransferase	NA	NA	NA	NA	NA
WP_024744189.1|1728692_1730360_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_024744190.1|1730376_1731234_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_024744191.1|1731418_1732960_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.8	2.7e-79
WP_024744192.1|1732973_1734179_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_024744193.1|1734239_1735610_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_101807109.1|1735931_1736669_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_024744195.1|1736825_1737836_-	membrane protein	NA	NA	NA	NA	NA
WP_024744196.1|1738402_1738966_-	phasin family protein	NA	NA	NA	NA	NA
WP_024744197.1|1739127_1739403_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_101807318.1|1739643_1740453_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_024744199.1|1740394_1741051_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_024744200.1|1741352_1742321_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_053513270.1|1742495_1743581_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	1.7e-75
WP_053513272.1|1743663_1744872_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_024744202.1|1744993_1746307_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_101807110.1|1746348_1747146_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107490046.1|1747341_1748443_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024744617.1|1748863_1749331_-	TonB family protein	NA	NA	NA	NA	NA
WP_058419031.1|1749761_1750730_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_082324283.1|1750851_1751619_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743448.1|1751625_1753017_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
WP_024743447.1|1753477_1754062_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_024743446.1|1754161_1755178_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082324494.1|1755801_1757220_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017154976.1|1757315_1757558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324282.1|1757551_1757893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490965.1|1758445_1759546_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	7.2e-42
WP_101807112.1|1759603_1763197_-	avirulence protein	NA	NA	NA	NA	NA
WP_024743886.1|1764571_1766683_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	1.3e-15
WP_107490049.1|1767178_1768144_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
1771657:1771673	attR	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
>prophage 13
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1839094	1848982	4703977	tRNA	Micromonas_sp._RCC1109_virus(16.67%)	7	NA	NA
WP_053513920.1|1839094_1840771_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.1e-37
WP_011408885.1|1840859_1841501_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_019300309.1|1841673_1842708_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
WP_024745487.1|1843009_1843498_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_024745486.1|1843599_1846248_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
WP_003481884.1|1846387_1846600_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_101807119.1|1848490_1848982_+	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	67.7	4.6e-57
>prophage 14
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1974583	2061190	4703977	transposase,tRNA	uncultured_Caudovirales_phage(37.5%)	53	NA	NA
WP_024745402.1|1974583_1976101_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	8.6e-86
WP_024745401.1|1976242_1977379_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_024745399.1|1977743_1979921_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.3e-47
WP_019299970.1|1979932_1980802_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_024745398.1|1980978_1982661_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	2.1e-32
WP_024745396.1|1983310_1986079_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1986226_1986475_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1986471_1986882_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024745395.1|1986947_1989539_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_101807129.1|1989892_1990708_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_101807130.1|1991363_1993607_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024745392.1|1993715_1994792_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010365269.1|1994788_1995385_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_019302811.1|1995381_1996248_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_082324264.1|1996493_1998884_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	3.9e-08
WP_082324486.1|1998962_1999307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002806488.1|1999661_2000144_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_082324263.1|2000279_2001077_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_053513169.1|2002118_2004380_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_053513167.1|2004791_2007053_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	2.5e-12
WP_024742986.1|2007644_2010119_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	1.9e-10
WP_107490044.1|2010164_2011196_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_053514012.1|2014223_2016467_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.4e-14
WP_082324099.1|2016725_2018102_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_053513639.1|2018383_2020597_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-09
WP_053513641.1|2020794_2023164_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.7e-09
WP_024744836.1|2023177_2023939_-	transporter	NA	NA	NA	NA	NA
WP_101836940.1|2024254_2026984_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.6	2.8e-10
WP_101807131.1|2029447_2031709_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	2.8e-08
WP_024743066.1|2032607_2034617_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|2034650_2035016_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_010375641.1|2035012_2035321_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_101807132.1|2035421_2036444_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743068.1|2036440_2037223_-	ParA family protein	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
WP_024743069.1|2037224_2038199_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_014503259.1|2038205_2038946_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_024743070.1|2039034_2039388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003138.1|2041674_2042382_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
WP_082330725.1|2042384_2043329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625354.1|2042961_2043897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743072.1|2043898_2046118_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
WP_024743073.1|2046372_2046825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324484.1|2047716_2050758_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082324483.1|2051002_2051281_-	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	70.3	9.0e-34
WP_058419068.1|2051436_2052405_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744204.1|2052888_2053323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807133.1|2054717_2055939_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.7	2.1e-103
WP_082324260.1|2056035_2056437_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745516.1|2056433_2056943_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.0	1.3e-09
WP_024745515.1|2056923_2057265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324259.1|2057278_2057875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419060.1|2057980_2059357_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419060.1|2059813_2061190_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 15
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	2139430	2201871	4703977	transposase,tRNA,protease	Ralstonia_phage(25.0%)	48	NA	NA
WP_101807140.1|2139430_2140567_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024744409.1|2140563_2141022_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024744410.1|2141272_2141593_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
WP_024744411.1|2141735_2144018_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
WP_002813418.1|2144225_2144444_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024744412.1|2144524_2145277_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_024744413.1|2145410_2146040_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
WP_154221278.1|2146231_2146453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744414.1|2146715_2147837_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_101807141.1|2147894_2148863_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.0e-64
WP_101807142.1|2149146_2151504_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_024744416.1|2151666_2153595_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_082324480.1|2153701_2154331_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_033003706.1|2154443_2158610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744419.1|2158846_2160223_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	4.0e-74
WP_024744420.1|2160254_2160581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324256.1|2160577_2160985_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
WP_024744422.1|2161016_2161367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744423.1|2161363_2162695_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	4.3e-41
WP_024744424.1|2163015_2164221_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_024744425.1|2164385_2166758_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_053513574.1|2166782_2167415_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2167633_2168059_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_024744427.1|2168077_2169283_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_024744428.1|2169293_2170082_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_024744429.1|2170078_2170939_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024744430.1|2171009_2171648_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_082324255.1|2171644_2172865_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_024744432.1|2172875_2174273_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_024744433.1|2174587_2175808_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_082330762.1|2176299_2177460_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_101807324.1|2178308_2179325_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	3.3e-49
WP_101807143.1|2179662_2180262_-	DUF1264 domain-containing protein	NA	NA	NA	NA	NA
WP_101807144.1|2180407_2181376_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324479.1|2181524_2181914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744965.1|2181852_2182230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003964.1|2182435_2183689_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_101807145.1|2183726_2184296_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_024744963.1|2184279_2184642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744960.1|2187016_2187994_-	siroheme synthase	NA	NA	NA	NA	NA
WP_024744957.1|2189315_2189504_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024744956.1|2189516_2189792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019302775.1|2190436_2190694_+	stress-induced protein	NA	NA	NA	NA	NA
WP_101807146.1|2190919_2191888_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_024744883.1|2192529_2193015_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807147.1|2193121_2194042_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_024744881.1|2195231_2197043_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_058419089.1|2200902_2201871_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
>prophage 16
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	2220807	2367024	4703977	transposase,plate	Tupanvirus(42.86%)	52	NA	NA
WP_107490085.1|2220807_2221908_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	3.2e-42
WP_101807325.1|2222247_2222610_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_101836932.1|2222666_2226560_+	avirulence protein	NA	NA	NA	NA	NA
WP_101807152.1|2226691_2229778_+	avirulence protein	NA	NA	NA	NA	NA
WP_101807153.1|2229909_2234217_+	avirulence protein	NA	NA	NA	NA	NA
WP_024743648.1|2236148_2237042_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743647.1|2237295_2238948_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.5	9.1e-41
WP_082324252.1|2239041_2240001_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.8	5.7e-11
WP_131112935.1|2240053_2244052_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.7	4.6e-54
WP_130625348.1|2244055_2244538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131091774.1|2244448_2247070_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	24.9	4.0e-67
WP_024743560.1|2247015_2247723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158525161.1|2247953_2267342_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.1	9.1e-132
WP_101807157.1|2267440_2289853_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	1.1e-133
WP_101807158.1|2289849_2304336_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	1.4e-124
WP_101807159.1|2304466_2304712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744003.1|2304867_2305962_+	type III polyketide synthase	NA	NA	NA	NA	NA
WP_024744002.1|2306001_2306745_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024744001.1|2306741_2308019_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_024744000.1|2308006_2309362_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743999.1|2309358_2310156_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024743998.1|2310232_2311939_+	cyclic peptide export ABC transporter	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	22.4	2.0e-06
WP_003468470.1|2312037_2312256_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_101807326.1|2312638_2314222_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743719.1|2317865_2320991_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024743718.1|2321042_2322155_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_053513440.1|2322278_2322857_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053512987.1|2325411_2327499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743837.1|2329436_2332526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033007312.1|2334810_2335518_+	response regulator	NA	NA	NA	NA	NA
WP_101807160.1|2335514_2336507_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033003485.1|2336503_2338963_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_033003483.1|2339076_2340057_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807161.1|2340065_2341094_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_024743830.1|2341266_2341593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513001.1|2341589_2344493_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	1.9e-09
WP_024743828.1|2344489_2345212_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_053513003.1|2345208_2345856_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513005.1|2345852_2349311_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_024743825.1|2349314_2350631_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_024743824.1|2350632_2351970_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743823.1|2351966_2353355_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_024743822.1|2353351_2353891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743821.1|2353899_2355837_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	7.7e-39
WP_024743820.1|2356100_2356562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743819.1|2356664_2356868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324173.1|2357912_2359289_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419068.1|2359451_2360420_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024743894.1|2360861_2363633_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
WP_024743895.1|2363665_2364676_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024743896.1|2364639_2366517_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743897.1|2366520_2367024_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 17
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	2601602	2706530	4703977	transposase,tRNA,protease	Ralstonia_phage(20.0%)	60	NA	NA
WP_058419031.1|2601602_2602571_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_053513013.1|2602951_2604787_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	9.5e-23
WP_024744752.1|2605058_2606150_+	ribonuclease D	NA	NA	NA	NA	NA
WP_082324230.1|2608199_2608364_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_024744755.1|2608588_2608990_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024744756.1|2609800_2610886_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_024744757.1|2610928_2611438_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024744758.1|2611449_2613108_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.6	2.7e-08
WP_082324229.1|2616168_2616585_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_014503014.1|2617156_2617597_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.0	7.1e-25
WP_024744763.1|2617675_2618311_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_082324468.1|2618707_2619451_-	cytochrome c1	NA	NA	NA	NA	NA
WP_024744765.1|2619458_2620718_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_024744766.1|2620717_2621362_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_024744767.1|2621889_2622876_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_050588012.1|2624228_2624522_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_024744770.1|2624817_2626272_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_024744771.1|2626695_2627682_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
WP_033003832.1|2628112_2628757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744772.1|2628811_2629297_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_024744773.1|2629296_2629815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744774.1|2629909_2630788_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024744775.1|2630784_2632065_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_024744776.1|2632080_2633082_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_033003835.1|2633233_2634598_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_101807173.1|2635072_2635921_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744779.1|2635917_2636829_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744780.1|2636957_2638091_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
WP_082324228.1|2638236_2639748_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024744782.1|2639734_2641321_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_024744783.1|2641317_2642520_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_058419102.1|2643368_2644337_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
WP_024743152.1|2646956_2648342_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_024743150.1|2648988_2650368_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_033003186.1|2650367_2651684_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_082330729.1|2651820_2653065_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
WP_024743147.1|2653370_2654651_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_082324226.1|2654952_2655261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743145.1|2655220_2657569_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_024743144.1|2657565_2658411_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_024743143.1|2658417_2660097_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_024743142.1|2660625_2661978_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743141.1|2662038_2665170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743140.1|2665334_2666189_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
WP_101807174.1|2666359_2667664_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_058419204.1|2672991_2673960_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_024743589.1|2674446_2679456_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_101807175.1|2679733_2680393_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743591.1|2680407_2681715_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_101807176.1|2681727_2684898_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024744846.1|2687589_2688585_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024744845.1|2688745_2691262_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_024744844.1|2691258_2692215_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_024744843.1|2692373_2694116_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_082324465.1|2694433_2695570_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_058419101.1|2695964_2698727_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	3.6e-42
WP_024712661.1|2698997_2699723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324130.1|2700201_2701218_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807177.1|2703793_2704537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807178.1|2705153_2706530_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 18
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	2901970	3018479	4703977	transposase,tRNA,protease	Ralstonia_phage(13.33%)	84	NA	NA
WP_058419096.1|2901970_2902939_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_082324130.1|2904330_2905347_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807194.1|2905519_2906422_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_101807195.1|2906619_2907987_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.9	1.6e-112
WP_024743338.1|2908238_2908751_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_082324207.1|2908680_2908920_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_024743337.1|2909262_2910762_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743336.1|2910758_2911691_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743335.1|2911871_2914700_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_024743334.1|2914742_2915945_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_014502759.1|2916186_2917623_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
WP_024743333.1|2917821_2918415_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
WP_082324453.1|2918679_2919273_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_024743331.1|2919269_2921039_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
WP_024743330.1|2921281_2922136_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743329.1|2922132_2923536_+	TolC family protein	NA	NA	NA	NA	NA
WP_024743328.1|2923887_2924082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743327.1|2924361_2925483_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_024743326.1|2925479_2926397_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_101807196.1|2926924_2928055_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
WP_024743324.1|2928214_2930140_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
WP_011258741.1|2930281_2930800_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_101807197.1|2930900_2931953_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_024743322.1|2932069_2933734_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_082324204.1|2934176_2934602_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011258737.1|2934691_2935087_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_024743320.1|2935433_2935709_-	RnfH family protein	NA	NA	NA	NA	NA
WP_024743319.1|2935722_2936154_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010366344.1|2936214_2936718_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
WP_024743318.1|2936882_2939330_-	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	26.7	2.6e-15
WP_058419096.1|2941079_2942048_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_101807198.1|2942269_2943646_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	7.3e-60
WP_033003395.1|2944414_2945107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625332.1|2945225_2945651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|2945798_2946900_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_033003338.1|2947879_2948128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082330739.1|2948404_2949559_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_024743456.1|2949558_2950881_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_024743457.1|2950907_2951948_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_082324452.1|2951965_2952826_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_101807199.1|2952861_2953461_+	LysE family translocator	NA	NA	NA	NA	NA
WP_082324200.1|2953527_2954463_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_082324199.1|2954528_2955881_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_058419055.1|2956429_2957806_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_158525112.1|2957802_2958900_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.5e-76
WP_101807049.1|2958948_2960050_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_024743394.1|2963400_2964375_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
WP_024743393.1|2966237_2966963_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
WP_101807075.1|2967425_2968223_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324197.1|2968231_2969686_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.5	4.4e-47
WP_024743064.1|2969752_2971183_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
WP_024743063.1|2971404_2971959_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
WP_024743062.1|2972175_2974116_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
WP_024743061.1|2974291_2974930_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444392.1|2978996_2979788_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743060.1|2979933_2980149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743059.1|2980148_2980916_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_024743058.1|2980977_2981808_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_024743057.1|2981880_2982309_+	cytochrome c	NA	NA	NA	NA	NA
WP_024743056.1|2982440_2982920_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|2983170_2983386_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_024743055.1|2983613_2984099_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_024744839.1|2986717_2988949_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
WP_058419090.1|2989092_2990469_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419089.1|2991587_2992556_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
WP_101836935.1|2992877_2993951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807200.1|2994123_2995092_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_033004173.1|2996182_2996818_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_053513872.1|2996953_2998471_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_024745369.1|2998805_3000686_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
WP_024745370.1|3000874_3001654_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|3001735_3002221_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_082330790.1|3004678_3004918_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_024745371.1|3005167_3005881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745372.1|3007394_3007901_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024745373.1|3008062_3008641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745374.1|3008732_3009233_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807203.1|3009299_3010145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588027.1|3010195_3010474_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745377.1|3010693_3010882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503886.1|3011295_3011904_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024745379.1|3013100_3014918_+	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745380.1|3015046_3017236_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_101807204.1|3017681_3018479_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3409688	3464174	4703977	transposase,tRNA	Acidithiobacillus_phage(33.33%)	36	NA	NA
WP_107490063.1|3409688_3410791_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.9e-42
WP_024744212.1|3411102_3412014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744213.1|3412138_3414724_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_024744214.1|3415169_3415475_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_024744215.1|3415855_3418471_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.5	2.8e-28
WP_024744216.1|3418771_3419386_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_024744217.1|3419819_3422066_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_024744218.1|3422189_3422597_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_024744219.1|3422937_3424428_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005989873.1|3425046_3425454_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024744220.1|3425598_3426357_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_024744221.1|3426421_3426934_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011258141.1|3426977_3427235_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_024744222.1|3427344_3428142_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_050588001.1|3429381_3430617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744223.1|3430765_3432142_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407903.1|3432526_3433318_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_024744224.1|3433604_3434654_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_024744225.1|3434893_3436477_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_101807217.1|3436664_3437463_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_033003517.1|3438557_3440519_-	response regulator	NA	NA	NA	NA	NA
WP_024743903.1|3440502_3441390_-	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	9.3e-24
WP_024743904.1|3441386_3442397_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_024743905.1|3442387_3442783_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_014504248.1|3442779_3443142_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743906.1|3443143_3443986_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743907.1|3444660_3446985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324164.1|3447009_3448980_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.5e-15
WP_053513725.1|3449091_3450522_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053513727.1|3451282_3452074_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_101836534.1|3452291_3452573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807218.1|3453380_3454775_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_101807336.1|3455082_3456185_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.8e-43
WP_101807219.1|3456362_3457739_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_058419060.1|3460579_3461956_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_158525114.1|3463061_3464174_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	59.9	6.5e-59
>prophage 20
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3553114	3573880	4703977	transposase,tRNA	Ralstonia_phage(60.0%)	15	NA	NA
WP_058419069.1|3553114_3554083_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_130625388.1|3554177_3554369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745347.1|3554441_3554834_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_130625389.1|3556619_3557510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419068.1|3557977_3558946_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_082324099.1|3559190_3560567_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_107490060.1|3561569_3562672_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_101807338.1|3563532_3564535_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	4.2e-97
WP_024744854.1|3567619_3567820_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_024744855.1|3568182_3568977_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014504352.1|3569278_3570037_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014504353.1|3570112_3571975_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_024744856.1|3572032_3572374_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_014504356.1|3572632_3572908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807223.1|3573081_3573880_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3661520	3721517	4703977	transposase,protease	Ralstonia_phage(25.0%)	45	NA	NA
WP_058419065.1|3661520_3662897_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_011407794.1|3663161_3663812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743468.1|3664184_3665474_-	citrate synthase	NA	NA	NA	NA	NA
WP_005911911.1|3665708_3665951_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_024743469.1|3666021_3666960_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_024743470.1|3667092_3669246_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_024743471.1|3669266_3669647_-	RidA family protein	NA	NA	NA	NA	NA
WP_024743472.1|3669726_3671898_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_002812428.1|3672026_3672326_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_024743473.1|3672594_3673206_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	31.5	1.8e-10
WP_024743474.1|3673321_3674182_-	YicC family protein	NA	NA	NA	NA	NA
WP_024743475.1|3674291_3675017_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_082324150.1|3675378_3676002_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.2	2.0e-12
WP_024743477.1|3676017_3677175_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_024743478.1|3677341_3679762_+	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_024743479.1|3679758_3680106_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_024743480.1|3680304_3681630_+	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_024743481.1|3682516_3683857_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_011407785.1|3683867_3684410_-	YecA family protein	NA	NA	NA	NA	NA
WP_024743482.1|3684647_3684869_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_019300828.1|3684865_3685165_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_024743483.1|3685775_3686366_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_024743484.1|3686362_3686833_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_024743485.1|3686924_3687572_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_024743486.1|3687726_3688176_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_024743487.1|3688325_3689207_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257965.1|3689256_3689496_-	rubredoxin	NA	NA	NA	NA	NA
WP_024743488.1|3689519_3690143_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_024743490.1|3694050_3695340_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_024743491.1|3695867_3698639_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_024743492.1|3698717_3699167_-	azurin	NA	NA	NA	NA	NA
WP_024743493.1|3700610_3701114_-	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_101807228.1|3701562_3702529_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	2.5e-99
WP_024744368.1|3705110_3705728_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_024744369.1|3705973_3707200_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.4	4.4e-16
WP_101807229.1|3709369_3710167_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743791.1|3710214_3710874_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_024743790.1|3711025_3713113_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024743789.1|3713835_3714720_-	membrane protein	NA	NA	NA	NA	NA
WP_024743788.1|3714866_3715463_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_033003466.1|3715462_3716821_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_019303282.1|3717185_3717749_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	2.1e-13
WP_024743786.1|3717908_3719165_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_058419063.1|3719464_3720433_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_058419062.1|3720554_3721517_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3819007	3885677	4703977	transposase,tRNA,protease	Staphylococcus_phage(14.29%)	46	NA	NA
WP_058419057.1|3819007_3819976_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024744620.1|3820177_3820600_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
WP_024744619.1|3821192_3821582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744618.1|3821574_3823227_+|protease	serine protease	protease	NA	NA	NA	NA
WP_101807233.1|3823678_3824485_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
WP_024745219.1|3824537_3825716_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	6.9e-51
WP_050588023.1|3826102_3827032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324136.1|3827196_3828597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745216.1|3828544_3830452_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101807234.1|3830464_3831487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745214.1|3831616_3832456_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745213.1|3833066_3834224_+	phosphotransferase	NA	NA	NA	NA	NA
WP_053513843.1|3834259_3836422_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_053513841.1|3836796_3837372_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_024745210.1|3837477_3838206_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_024745209.1|3838636_3839476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745208.1|3839472_3841776_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	24.4	1.5e-09
WP_101807235.1|3841772_3842603_-	general secretion pathway protein GspN	NA	NA	NA	NA	NA
WP_024745206.1|3842592_3843246_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_024745205.1|3843229_3844351_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|3844347_3845199_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_024745204.1|3845195_3845831_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_024745203.1|3845827_3846244_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_024745202.1|3846240_3846750_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|3846759_3847191_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257722.1|3847458_3848676_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_082324135.1|3848675_3848855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324134.1|3848851_3850591_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_024745200.1|3850708_3852592_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.7	7.0e-21
WP_053513836.1|3852812_3858893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745197.1|3859870_3863923_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	5.8e-121
WP_024745196.1|3864338_3865136_-	DsbC family protein	NA	NA	NA	NA	NA
WP_024745195.1|3865619_3866591_-	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	30.3	1.9e-14
WP_024745194.1|3867016_3867484_+	RDD family protein	NA	NA	NA	NA	NA
WP_082324133.1|3867581_3867893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745193.1|3867897_3869004_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_053513834.1|3869000_3870083_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_024745191.1|3870190_3871663_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
WP_024745189.1|3872018_3872444_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_082324132.1|3872454_3873687_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324131.1|3873689_3874337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745188.1|3874465_3877408_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.2	2.2e-130
WP_053513831.1|3878130_3880104_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.3e-14
WP_101807236.1|3880560_3881937_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	9.2e-63
WP_082324130.1|3882290_3883307_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_082324130.1|3884660_3885677_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
>prophage 23
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3905477	3911847	4703977		Enterobacteria_phage(50.0%)	6	NA	NA
WP_011407616.1|3905477_3906824_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_024743259.1|3906869_3908273_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
WP_024743260.1|3908389_3909298_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
WP_024743261.1|3909294_3909852_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
WP_011407613.1|3909848_3910736_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|3910791_3911847_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
>prophage 24
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	4260138	4336918	4703977	transposase	Acidithiobacillus_phage(21.43%)	57	NA	NA
WP_058419036.1|4260138_4261107_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_154221287.1|4261396_4261561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588016.1|4261550_4262021_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024744929.1|4262705_4264838_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_082324401.1|4265324_4265687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744927.1|4265688_4266540_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_024744926.1|4266592_4267474_+	TolB-like protein	NA	NA	NA	NA	NA
WP_024744925.1|4268139_4270701_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_101807267.1|4270933_4271686_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.3	2.8e-21
WP_053513030.1|4271813_4272728_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024744922.1|4272820_4273798_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_014505063.1|4273985_4274978_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_033003934.1|4275198_4275447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744920.1|4275652_4276123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744919.1|4276223_4278014_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_024744918.1|4278218_4280456_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_101807344.1|4282049_4283066_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
WP_082324203.1|4283236_4284613_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743126.1|4287031_4288042_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743127.1|4288442_4289636_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024712051.1|4289632_4290379_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_024743128.1|4290410_4292012_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4292072_4292273_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024743129.1|4292269_4292857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743130.1|4293305_4293578_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024743131.1|4293643_4294633_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_082324107.1|4294702_4295464_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_024743133.1|4295566_4296562_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.5e-26
WP_033003179.1|4296579_4297371_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743135.1|4297372_4297957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033003181.1|4298075_4299014_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_101807269.1|4299127_4299331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|4299370_4300472_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|4300900_4302277_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024744975.1|4302857_4303406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053512924.1|4303893_4304178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744977.1|4304762_4306040_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011257407.1|4306319_4306646_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_024744978.1|4306617_4307112_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	2.7e-17
WP_024744979.1|4307119_4308445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712257.1|4308519_4309563_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.1	1.1e-151
WP_101807270.1|4309760_4312259_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	66.9	4.1e-303
WP_024744981.1|4312874_4313918_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	4.8e-80
WP_024744982.1|4314024_4316733_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024744983.1|4317019_4317634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257400.1|4317705_4319073_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744985.1|4319762_4321586_+	potassium transporter KefB	NA	NA	NA	NA	NA
WP_082330734.1|4323129_4325073_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	37.3	2.6e-79
WP_024743306.1|4324922_4326722_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_082324102.1|4326785_4327115_-	phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_024743307.1|4327141_4330462_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011407425.1|4330454_4330715_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_024743308.1|4330933_4332133_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_024743309.1|4332132_4332906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743310.1|4332902_4333724_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024743311.1|4333720_4335343_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_101807272.1|4335541_4336918_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	2.2e-64
>prophage 25
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	4406412	4576370	4703977	transposase,tRNA	Acidithiobacillus_phage(16.13%)	106	NA	NA
WP_101807275.1|4406412_4407381_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_082324392.1|4407506_4407872_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_024743782.1|4407868_4409170_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_024743781.1|4409350_4410127_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743780.1|4410603_4411188_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_024743779.1|4411380_4414830_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_024743778.1|4415581_4418224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743777.1|4418327_4420727_-	NdvB protein	NA	NA	NA	NA	NA
WP_024743776.1|4420729_4422112_-	MFS transporter	NA	NA	NA	NA	NA
WP_024743775.1|4422269_4422854_+	gluconokinase	NA	NA	NA	NA	NA
WP_024743774.1|4423689_4425420_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	36.1	1.7e-82
WP_082324100.1|4425751_4426057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|4425959_4426400_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_024743773.1|4426419_4426848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|4428394_4429496_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807277.1|4429515_4430484_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_058419036.1|4431914_4432883_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_053513161.1|4433146_4437004_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_024743466.1|4437000_4438782_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_033003342.1|4438956_4441716_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.8	9.3e-147
WP_024743464.1|4441968_4443558_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_024743463.1|4443557_4445816_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_024743462.1|4445973_4446882_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_024743461.1|4446971_4448786_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_158525116.1|4449179_4457639_-	hypothetical protein	NA	A0A1S5SDF1	Streptococcus_phage	32.0	1.3e-10
WP_011409712.1|4458591_4459344_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_024745621.1|4459403_4460303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745620.1|4460455_4461211_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_024745619.1|4461207_4461780_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4461795_4462023_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_024745618.1|4462095_4463001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745617.1|4463154_4464120_+	ferrochelatase	NA	NA	NA	NA	NA
WP_024745616.1|4464122_4464974_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	31.3	1.3e-06
WP_024745615.1|4465054_4465513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745614.1|4465783_4466569_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745613.1|4467184_4468090_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.2	1.4e-43
WP_024745612.1|4468153_4469071_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_053513079.1|4469704_4471042_+	xylose isomerase	NA	NA	NA	NA	NA
WP_024744967.1|4471267_4472335_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_101807280.1|4472489_4474685_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_101807281.1|4474681_4476646_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_101807282.1|4476657_4477917_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_101807349.1|4477916_4479617_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_101807283.1|4479619_4482334_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_101807284.1|4482556_4484077_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	2.5e-45
WP_107490031.1|4484071_4485103_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_082324355.1|4485285_4486662_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_033003464.1|4486838_4487942_+	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
WP_024743784.1|4488033_4488408_-	VOC family protein	NA	NA	NA	NA	NA
WP_082324356.1|4489108_4490125_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_024743734.1|4490747_4491803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743735.1|4492029_4493448_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_024743736.1|4493488_4494466_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_082324358.1|4495870_4497352_-	MFS transporter	NA	NA	NA	NA	NA
WP_082324566.1|4497693_4500567_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743740.1|4500665_4502153_+	MFS transporter	NA	NA	NA	NA	NA
WP_024743741.1|4502184_4503219_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_024743742.1|4503560_4504094_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_101807285.1|4504375_4505344_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	6.6e-100
WP_154221296.1|4505395_4505734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807286.1|4505810_4506616_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.0	7.7e-09
WP_024743989.1|4506817_4507390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011349116.1|4507528_4507747_+	YdcH family protein	NA	NA	NA	NA	NA
WP_024743991.1|4508383_4509364_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_024743992.1|4509559_4512223_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_024743993.1|4512222_4513197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324359.1|4513195_4513441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743994.1|4513609_4514662_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513382.1|4514826_4517865_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_058419058.1|4518703_4520080_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_024743574.1|4522828_4524358_+	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.5	3.9e-46
WP_024743573.1|4524664_4525444_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_024743572.1|4525440_4526451_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_101807288.1|4526730_4527396_+	YceH family protein	NA	NA	NA	NA	NA
WP_101807290.1|4528794_4530771_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	6.3e-113
WP_024743567.1|4530977_4531607_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
WP_024743566.1|4532065_4533304_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_024743565.1|4533446_4535045_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_082324360.1|4535113_4536205_-	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_033003378.1|4536437_4537253_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
WP_058419055.1|4537541_4538918_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024744511.1|4545396_4547301_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.0e-19
WP_024744510.1|4547297_4547900_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_024744509.1|4548000_4549260_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_024744508.1|4549550_4551713_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_024744507.1|4551865_4552072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807291.1|4552279_4552669_-	YchJ family protein	NA	NA	NA	NA	NA
WP_082330766.1|4552726_4553548_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_101807292.1|4553672_4555049_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	4.3e-60
WP_053513660.1|4555180_4556362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513661.1|4556459_4559891_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024745665.1|4560038_4560737_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_024745666.1|4560720_4562193_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_024745667.1|4562189_4562777_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_024745668.1|4562776_4563973_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324363.1|4564046_4564676_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	4.2e-47
WP_050588040.1|4564769_4565267_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513662.1|4566680_4567205_+	FUSC family protein	NA	NA	NA	NA	NA
WP_101807293.1|4567176_4568193_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_024744628.1|4568599_4569961_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
WP_101807219.1|4570141_4571518_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_082324568.1|4572206_4572920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745343.1|4572950_4573457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745344.1|4573730_4573937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745345.1|4573923_4575036_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_107490090.1|4575268_4576370_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.2e-42
>prophage 26
NZ_CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	4585096	4642974	4703977	transposase	Acidithiobacillus_phage(30.77%)	44	NA	NA
WP_058419060.1|4585096_4586473_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024742954.1|4586997_4587309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742953.1|4587568_4588051_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_024742952.1|4588347_4589517_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_024742951.1|4589758_4589947_+	CsbD family protein	NA	NA	NA	NA	NA
WP_074038671.1|4590591_4590849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742950.1|4590973_4591423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742949.1|4591579_4592560_+	ATP-binding cassette domain-containing protein	NA	K7PHD1	Enterobacteria_phage	46.4	7.0e-73
WP_082324366.1|4593479_4593836_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743547.1|4593878_4596659_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743548.1|4596945_4597968_+	sugar kinase	NA	NA	NA	NA	NA
WP_154221263.1|4598424_4598565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743549.1|4598588_4599797_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_024743552.1|4601768_4602935_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_154221305.1|4604223_4604592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419197.1|4604886_4606263_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_082324367.1|4606273_4606567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324368.1|4606677_4608873_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
WP_024712580.1|4608971_4610174_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024743645.1|4610444_4611455_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
WP_024743646.1|4611729_4612197_+	DUF4410 domain-containing protein	NA	NA	NA	NA	NA
WP_082324173.1|4613573_4614950_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_158500224.1|4615065_4615383_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101807296.1|4615495_4616464_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625425.1|4616888_4617119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625426.1|4617282_4619928_+	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_131085815.1|4619968_4620715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807297.1|4620736_4622032_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_050587973.1|4622051_4624178_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.3	7.9e-29
WP_101807298.1|4624434_4625682_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.1e-61
WP_082324571.1|4626974_4627385_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_033003354.1|4627644_4628100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625428.1|4628032_4628293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807299.1|4628323_4629211_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_033003355.1|4629544_4631122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743499.1|4631616_4632444_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_058419165.1|4633170_4634229_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_107490046.1|4635972_4637074_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807300.1|4637311_4637872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807296.1|4637870_4638839_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625431.1|4638933_4639236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745548.1|4639307_4640045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033004251.1|4640062_4640755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807103.1|4641948_4642974_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
