The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	7440	60862	4703982	protease,transposase	Leptospira_phage(28.57%)	38	NA	NA
WP_024744592.1|7440_8277_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024744593.1|8461_9268_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024744594.1|9544_10738_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014501265.1|11643_12405_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12451_12874_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743315.1|12877_13291_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743314.1|13586_14354_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_024743313.1|14364_14634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743312.1|14708_16169_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_158525106.1|16990_17140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807019.1|17314_18691_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	4.1e-63
WP_101807304.1|18919_19804_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.0e-87
WP_107490060.1|19820_20922_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_024744007.1|21182_22310_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_024744008.1|23380_24721_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_010364746.1|24938_25631_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_008572943.1|25747_26068_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_024744009.1|27365_28889_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
WP_033003570.1|28993_30229_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_024744011.1|30389_31046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053512972.1|31208_33020_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_024744014.1|33167_33518_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024744015.1|33824_34955_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003577.1|35737_36790_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003579.1|37490_38564_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_024744018.1|38872_39931_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_101807021.1|42338_42968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490044.1|43017_44049_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_024744291.1|44130_45612_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024744290.1|45806_50279_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_024744289.1|50480_50861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324081.1|51007_52195_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.3e-41
WP_024744287.1|52397_52703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324376.1|53889_55029_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_024744284.1|55342_56128_-	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_033003662.1|56138_58727_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744282.1|58899_60057_+	ROK family protein	NA	NA	NA	NA	NA
WP_101807022.1|60099_60862_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	322093	388812	4703982	transposase	Leptospira_phage(37.5%)	51	NA	NA
WP_107490044.1|322093_323125_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807309.1|323160_324600_-	HpaF protein	NA	NA	NA	NA	NA
WP_024744915.1|325664_328073_-	serine kinase	NA	NA	NA	NA	NA
WP_107490032.1|329539_330642_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.8e-43
WP_082324345.1|331508_331955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513734.1|331951_333952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744340.1|334725_335196_-	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
WP_130625300.1|335250_335532_-	serine kinase	NA	NA	NA	NA	NA
WP_024744341.1|335612_335855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744342.1|335864_336803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744343.1|336799_337627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744344.1|337623_337884_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744345.1|337888_338533_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_024744346.1|338519_339473_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_053513737.1|339565_340207_-	type III secretion protein HpaP	NA	NA	NA	NA	NA
WP_053513739.1|340206_342129_-	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_024744349.1|342137_343211_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_011257083.1|343426_343882_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_011407211.1|343915_344308_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_024744351.1|344309_345074_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_024744352.1|345081_345711_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_024744353.1|345695_346397_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_024744354.1|346386_347715_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_053513741.1|347707_348217_+	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_024744356.1|348213_349044_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_053513743.1|349126_350950_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
WP_053513745.1|351689_352121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513747.1|352524_353088_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	39.4	5.2e-12
WP_024744361.1|353551_355105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744362.1|356371_356713_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_053513751.1|356897_359456_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_053513749.1|359474_359735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807032.1|359814_360783_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.6e-98
WP_033003076.1|360908_362633_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	3.0e-34
WP_024742976.1|362873_363815_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_107490044.1|365371_366403_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_101807033.1|366450_368085_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_050587979.1|368622_370152_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_024742979.1|370148_372380_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_024742980.1|372382_374140_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_082324554.1|374196_376086_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_024742982.1|376082_378686_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|378708_378894_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_024742983.1|379007_381170_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_024742984.1|381186_381819_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_101807034.1|382184_383561_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.0e-78
WP_024743402.1|383642_384398_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024743401.1|384775_386185_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743400.1|386533_386965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158525107.1|387182_387320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419058.1|387435_388812_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
>prophage 3
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	492690	602311	4703982	integrase,transposase,tRNA,terminase,head,holin,capsid,tail,portal,plate	Stenotrophomonas_phage(40.82%)	94	518317:518361	561300:561344
WP_053513464.1|492690_493254_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_024745936.1|493264_495757_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
WP_101807039.1|495939_497214_-	RDD family protein	NA	NA	NA	NA	NA
WP_101807040.1|497255_497978_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_024745938.1|498018_498492_-	DUF494 family protein	NA	NA	NA	NA	NA
WP_101807041.1|498534_499677_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_101807042.1|499748_500885_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_024745941.1|501017_501530_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_024745942.1|501930_502854_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_024745943.1|502853_504167_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_053513456.1|506117_507395_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_024745946.1|507592_508417_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745947.1|508417_509476_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_024745948.1|509642_511148_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_053513469.1|511144_511654_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_019302641.1|511763_512897_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_014504872.1|513139_513661_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033004404.1|513859_514774_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_024745951.1|514874_515315_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014504870.1|515423_517298_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_024745952.1|517490_517811_+	hypothetical protein	NA	NA	NA	NA	NA
518317:518361	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_082330806.1|518430_519705_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	1.1e-110
WP_011257520.1|519838_520045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075243253.1|520041_520314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745956.1|520310_520556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745957.1|520552_520828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745958.1|520989_521400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|521625_521904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|521900_522119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082330809.1|522427_525100_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_011258450.1|525133_525346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|525342_525621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745959.1|525631_525952_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
WP_053503015.1|525954_526212_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|526283_526721_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|527381_528368_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|528364_528766_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_024745960.1|528778_531649_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
WP_011258456.1|531681_531795_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|531803_532106_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|532151_532661_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258459.1|532691_533858_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_024745961.1|533869_534229_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
WP_024745962.1|534225_534789_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
WP_024745963.1|534849_535428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745964.1|535435_536941_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
WP_024745965.1|536950_537496_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
WP_024745966.1|537488_538379_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
WP_024745967.1|538460_538910_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
WP_024745968.1|538897_539317_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
WP_011258470.1|539790_540432_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
WP_024745970.1|540428_540704_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
WP_024745971.1|540696_541053_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
WP_024745972.1|541057_541267_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
WP_012445486.1|541266_541734_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_011258475.1|541833_542553_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_024745974.1|542556_543576_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
WP_024745975.1|543622_544465_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
WP_033004409.1|544586_546371_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
WP_024745977.1|546370_547390_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
WP_082330810.1|547410_547641_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
WP_024745978.1|547573_548278_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
WP_033004412.1|548309_548777_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_024745980.1|548776_549955_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_101807043.1|550685_553445_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
WP_024745590.1|553453_554380_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_101807044.1|554376_557211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743124.1|557238_557970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807045.1|557996_560339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101836529.1|560906_561107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324338.1|561411_561645_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
561300:561344	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_024743230.1|563521_565411_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_011260615.1|565627_565969_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
WP_053513444.1|566167_567892_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.1e-47
WP_024743228.1|567967_568654_+	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
WP_024743227.1|568650_569601_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_082324547.1|569657_570452_+	response regulator	NA	NA	NA	NA	NA
WP_053513446.1|570448_571174_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	4.7e-50
WP_024743224.1|571390_572266_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
WP_053513448.1|572344_572959_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_053513449.1|573011_574304_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003483210.1|576594_576882_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
WP_011260602.1|577025_578666_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
WP_053513452.1|578966_581243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419179.1|582350_583319_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_058419036.1|585704_586673_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_024745526.1|587604_588678_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
WP_053513971.1|589194_591372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513973.1|591465_593883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513975.1|594146_595067_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_024745528.1|595066_595585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513977.1|595746_598572_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_053513979.1|598667_599228_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	1.4e-12
WP_058419055.1|600934_602311_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 4
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	616270	710179	4703982	protease,transposase	Acidithiobacillus_phage(26.67%)	55	NA	NA
WP_101807047.1|616270_617647_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_130625305.1|617826_618387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419175.1|618705_620082_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_053513412.1|620392_623122_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.7	3.8e-68
WP_082324544.1|623190_624366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324336.1|624412_626290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807048.1|626303_627878_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_053513416.1|628010_628973_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_058419060.1|629260_630637_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419174.1|631642_635467_+	avirulence protein	NA	NA	NA	NA	NA
WP_024745997.1|636536_638120_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_082324335.1|638510_638702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745996.1|641202_643527_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_024745994.1|645430_646522_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_024745993.1|647486_648365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324334.1|648553_649438_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024745991.1|649715_651488_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_050588046.1|651885_653586_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_033004419.1|654740_656117_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_024745988.1|656203_657199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745987.1|657444_658356_+	magnesium transporter	NA	NA	NA	NA	NA
WP_024745985.1|658890_659175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745984.1|659504_659951_+	autotransporter	NA	NA	NA	NA	NA
WP_101807049.1|660262_661364_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|662073_663450_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024743083.1|664622_666314_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_024743082.1|666566_667352_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_024743081.1|668595_669600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743080.1|669638_670568_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_024743079.1|671103_673992_-	insulinase family protein	NA	NA	NA	NA	NA
WP_024743078.1|674244_676827_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
WP_101807050.1|677404_678203_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745720.1|680806_682261_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
WP_024745721.1|682468_683956_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
WP_082324540.1|684235_685189_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.7e-15
WP_024745723.1|685357_687007_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_033004321.1|687998_689936_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_024745725.1|690087_690756_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024745726.1|690760_691813_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
WP_024745727.1|691843_692581_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745728.1|692611_693526_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_024745729.1|694088_694889_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_024745730.1|695450_696416_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745731.1|696524_697094_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_024745732.1|697478_697790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745733.1|697857_699951_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_053513809.1|700545_701730_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_024745735.1|701839_703975_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.8e-28
WP_024745736.1|704318_704717_+	YbaN family protein	NA	NA	NA	NA	NA
WP_024745737.1|704774_705017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745738.1|705006_705861_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_082324332.1|705848_706529_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_024745740.1|706722_707640_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.7e-12
WP_024745741.1|708155_708707_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024745742.1|708811_710179_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
>prophage 5
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	761903	832817	4703982	transposase	Ralstonia_phage(20.0%)	55	NA	NA
WP_058419161.1|761903_762872_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
WP_107490082.1|762923_763022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_101836530.1|763900_766609_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_158525109.1|766605_766773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050587990.1|766759_769654_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
WP_053513077.1|769650_772047_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_024743528.1|772180_773347_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_050587991.1|773561_774329_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743530.1|774373_775651_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_024743531.1|775691_776759_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743532.1|776765_777794_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_024743533.1|777796_778951_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_024743534.1|779455_780061_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_024743535.1|780057_781311_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_024743536.1|781312_783211_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_024743537.1|783212_785255_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_024743539.1|786468_787701_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.5	2.3e-73
WP_058419068.1|787921_788890_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_101807052.1|794254_794992_-	endonuclease	NA	NA	NA	NA	NA
WP_053513041.1|795041_795857_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_101807053.1|795948_796599_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_082324537.1|796692_797433_-	cytochrome c4	NA	NA	NA	NA	NA
WP_024744861.1|797634_798258_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024744862.1|798351_799047_-	VIT family protein	NA	NA	NA	NA	NA
WP_024744863.1|799262_800627_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_058419060.1|802418_803795_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024712624.1|804569_805055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744626.1|805997_806918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513043.1|806950_808450_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.1	3.6e-12
WP_082324328.1|808446_809166_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024744866.1|809304_810405_+	glycosyltransferase	NA	A0A142BZU7	Faustovirus	28.5	9.8e-15
WP_024744868.1|811539_811815_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024744869.1|811879_812989_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	3.8e-35
WP_024744870.1|813057_813633_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_024744871.1|813692_814523_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_024744872.1|814652_814862_+	DUF4386 family protein	NA	NA	NA	NA	NA
WP_058419036.1|814913_815882_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_082324327.1|816055_816532_+	DUF4386 domain-containing protein	NA	NA	NA	NA	NA
WP_082324326.1|816528_816873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743416.1|817048_818710_-	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	28.6	1.3e-39
WP_024743415.1|818935_819433_+	RcnB family protein	NA	NA	NA	NA	NA
WP_154221260.1|819613_819895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807054.1|820103_822434_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024712241.1|822619_823873_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	1.6e-101
WP_024743412.1|823886_824402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743411.1|824401_824926_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_024743410.1|824922_825408_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101807310.1|825419_826514_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.8e-45
WP_024743408.1|826569_827193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743407.1|827753_828356_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.0	3.9e-26
WP_024743406.1|828352_829492_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	34.3	1.6e-52
WP_024743405.1|829805_830270_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.3	2.2e-24
WP_024743404.1|830266_830737_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_024743403.1|830957_831932_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_101807055.1|832019_832817_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	1073123	1135548	4703982	protease,transposase	Leptospira_phage(16.67%)	43	NA	NA
WP_107490031.1|1073123_1074155_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_058419168.1|1075215_1076184_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324317.1|1078086_1079460_-	MFS transporter	NA	NA	NA	NA	NA
WP_024745685.1|1079558_1081598_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_024745686.1|1081805_1082828_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024745687.1|1083243_1084341_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745688.1|1084533_1085043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513257.1|1085062_1085923_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_024745690.1|1085873_1086266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745691.1|1086268_1087477_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	2.9e-20
WP_053513259.1|1087567_1088665_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024745693.1|1088668_1089529_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_024745694.1|1089525_1090479_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_024745695.1|1090486_1091521_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
WP_024745696.1|1091880_1092594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004302.1|1092663_1093686_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_033004295.1|1094201_1096535_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033004296.1|1098949_1101100_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_024745700.1|1101192_1101837_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_024745701.1|1102807_1104106_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_024745702.1|1104173_1105256_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_033004297.1|1105470_1106211_+	CvpA family protein	NA	NA	NA	NA	NA
WP_024745703.1|1106247_1107714_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	8.3e-86
WP_024745704.1|1107852_1108677_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807070.1|1109396_1110195_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745844.1|1110657_1111077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513157.1|1111256_1112000_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_024745846.1|1112634_1113177_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_053513155.1|1113157_1114294_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_033004364.1|1114498_1116025_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_024745848.1|1116196_1118299_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_082324316.1|1118402_1119746_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	5.0e-29
WP_024745850.1|1119803_1120493_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
WP_082324528.1|1120667_1122314_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745852.1|1122463_1122772_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
WP_024745853.1|1122768_1123164_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_014502224.1|1123378_1124386_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_014502225.1|1124526_1125288_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_058419165.1|1126494_1127553_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_058419103.1|1128869_1129838_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_024745448.1|1132125_1133418_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1133510_1134137_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1134261_1135548_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
>prophage 8
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	1243048	1394477	4703982	plate,protease,transposase	Ralstonia_phage(15.38%)	108	NA	NA
WP_101807076.1|1243048_1244446_-|protease	serine protease	protease	NA	NA	NA	NA
WP_053513692.1|1244873_1246844_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_024744518.1|1247688_1248534_+	transporter	NA	NA	NA	NA	NA
WP_024744517.1|1248822_1250943_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_024744516.1|1251219_1251681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744515.1|1251812_1252538_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513688.1|1253355_1255497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513686.1|1255613_1257749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807077.1|1257911_1258717_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	5.3e-10
WP_024745783.1|1259819_1261058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745784.1|1261883_1263989_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.7	1.9e-136
WP_050588043.1|1265638_1266286_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	45.5	6.5e-35
WP_024745785.1|1266282_1266834_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_101807315.1|1267199_1270133_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	8.9e-257
WP_024745787.1|1270600_1270792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745788.1|1271222_1272026_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_033004344.1|1272114_1273326_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_101836531.1|1273322_1275482_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	1.7e-34
WP_024745792.1|1276290_1276695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745793.1|1276776_1278795_-	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745794.1|1278906_1280577_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_024745795.1|1280573_1281338_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024745796.1|1281437_1283171_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_024745797.1|1283390_1284107_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	2.8e-23
WP_024745798.1|1284099_1285392_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_024745799.1|1285543_1286035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745800.1|1286103_1286361_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_024745801.1|1286363_1287173_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_024745802.1|1287208_1287949_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014502368.1|1287953_1288553_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745803.1|1288797_1289994_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_008574699.1|1289993_1290635_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745804.1|1290985_1292182_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_024745805.1|1292263_1292650_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_024745806.1|1292652_1293327_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_024745807.1|1293390_1294188_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_024745808.1|1294318_1294498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745809.1|1294494_1294779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745812.1|1295394_1296597_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_101807078.1|1296795_1297005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807079.1|1297001_1297418_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024745813.1|1297573_1298305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745814.1|1298504_1299383_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
WP_024745815.1|1299490_1299751_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745816.1|1299810_1301292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745817.1|1301307_1305045_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_101807080.1|1305041_1306025_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513252.1|1306021_1306816_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745820.1|1306868_1307939_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_107490031.1|1308869_1309901_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_101807081.1|1309972_1312795_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.0e-52
WP_101807316.1|1313300_1314317_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.3e-49
WP_058419153.1|1315424_1316801_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
WP_058419152.1|1316944_1318321_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
WP_058419050.1|1318985_1319954_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744031.1|1320367_1320880_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_033003115.1|1323429_1324218_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011259947.1|1324217_1325552_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743027.1|1325703_1326312_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033003111.1|1326697_1327186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467601.1|1327232_1327733_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011409204.1|1327736_1329233_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1329374_1329872_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409203.1|1330019_1330508_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_024743026.1|1330510_1332346_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743025.1|1332309_1333401_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_053513684.1|1333486_1336219_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_014502423.1|1336249_1336603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807082.1|1336695_1339482_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	6.9e-41
WP_053513217.1|1339456_1340329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|1342365_1343468_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024743437.1|1345976_1347041_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_024743436.1|1347055_1347307_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_024743435.1|1347606_1348719_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_024743434.1|1348715_1349258_-	shikimate kinase	NA	NA	NA	NA	NA
WP_024743433.1|1349424_1350024_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_012445807.1|1350204_1350621_+	YjfI family protein	NA	NA	NA	NA	NA
WP_024743432.1|1350633_1351407_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_024743431.1|1351432_1352515_+	potassium channel protein	NA	NA	NA	NA	NA
WP_082324520.1|1352517_1353189_+	YjfK family protein	NA	NA	NA	NA	NA
WP_024743429.1|1353226_1353631_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_024743428.1|1353643_1354216_+	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
WP_024743427.1|1354217_1355384_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
WP_050587989.1|1355746_1356208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743426.1|1358005_1360012_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_082324305.1|1361061_1364208_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743423.1|1364539_1365292_+	SapC family protein	NA	NA	NA	NA	NA
WP_101807084.1|1365302_1366349_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024743421.1|1366389_1367907_+	tryptophan 7-halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
WP_024743420.1|1367944_1368949_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743419.1|1369093_1369492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807085.1|1369623_1371000_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
WP_024745604.1|1371588_1372986_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_024745603.1|1373427_1374810_-	APC family permease	NA	NA	NA	NA	NA
WP_024745602.1|1375002_1375767_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745601.1|1376080_1377022_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_053513783.1|1377777_1379166_+	amino acid permease	NA	NA	NA	NA	NA
WP_101807086.1|1381115_1382570_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	9.0e-93
WP_033004264.1|1382526_1383429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588037.1|1383428_1384670_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
WP_101807087.1|1384902_1385871_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_024744440.1|1386991_1388008_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_082324517.1|1388068_1388863_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_024744438.1|1389022_1390384_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744437.1|1390671_1392402_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
WP_005913389.1|1392460_1392730_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_003487850.1|1392722_1393115_-	PTS fructose IIA component family protein	NA	NA	NA	NA	NA
WP_058419145.1|1393508_1394477_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
>prophage 9
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	1419900	1527181	4703982	tRNA,protease,transposase	Ralstonia_phage(18.75%)	86	NA	NA
WP_107490044.1|1419900_1420932_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_058419036.1|1420998_1421967_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_011258205.1|1422270_1422600_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_024743872.1|1422596_1423136_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058419057.1|1423345_1424314_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024743209.1|1424427_1425672_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
WP_024743208.1|1425668_1426931_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_024743207.1|1426930_1427695_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.5	2.0e-11
WP_024743206.1|1427952_1429410_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_024743205.1|1429425_1429884_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_003487757.1|1430055_1430523_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_033003226.1|1430627_1430846_+	peptidase	NA	NA	NA	NA	NA
WP_024743204.1|1431452_1432049_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_033003224.1|1432104_1432647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743203.1|1432704_1433046_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_024743202.1|1433103_1433745_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_024743201.1|1433849_1434275_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_024743200.1|1434830_1435691_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_024743199.1|1435734_1436427_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_101807090.1|1436492_1437258_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743682.1|1437608_1438646_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_024743681.1|1438759_1439890_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_082324514.1|1440179_1440836_+	YitT family protein	NA	NA	NA	NA	NA
WP_024743679.1|1441938_1442511_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_024743678.1|1442507_1442942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003404.1|1442938_1443820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743677.1|1443787_1444354_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_024743676.1|1444346_1444814_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_024743675.1|1444827_1445775_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_024743674.1|1446211_1446646_+	OsmC family protein	NA	NA	NA	NA	NA
WP_024743673.1|1446798_1447398_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743672.1|1447695_1448577_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_024743669.1|1449669_1452279_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_024743668.1|1452262_1452721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743667.1|1452717_1454073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743666.1|1454053_1455460_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_053512934.1|1455776_1456598_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_058419088.1|1456692_1457661_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_024743020.1|1457915_1458914_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_024743021.1|1459189_1459723_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
WP_024743022.1|1460005_1461490_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	5.0e-14
WP_024743023.1|1461783_1462491_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_154221304.1|1463099_1463261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324511.1|1465002_1465680_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_158500229.1|1465801_1466248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016904074.1|1466216_1466441_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_024745822.1|1466440_1468513_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_050588044.1|1468796_1469603_+	pirin family protein	NA	NA	NA	NA	NA
WP_101807093.1|1469689_1470061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419141.1|1470464_1473281_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	4.7e-53
WP_024745912.1|1473280_1474177_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_082324298.1|1474660_1475140_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324297.1|1475289_1475769_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324296.1|1475855_1477592_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_082324203.1|1478372_1479749_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743650.1|1480399_1480996_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_058419169.1|1481421_1482798_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_024712501.1|1485701_1486163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625317.1|1487478_1488135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024742990.1|1488402_1489116_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_024742991.1|1489219_1489969_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_082324510.1|1491410_1492532_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_082324295.1|1492546_1493374_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_024743606.1|1493357_1494641_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_024743605.1|1494667_1495183_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743604.1|1495193_1497350_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.4e-09
WP_024743603.1|1497418_1499422_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1499440_1499770_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_131091743.1|1499800_1500028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743602.1|1500259_1503724_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|1504117_1504660_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033003388.1|1505084_1505993_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_024743600.1|1507523_1508336_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_024743598.1|1509281_1509893_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743597.1|1510011_1510896_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_024743596.1|1510917_1512009_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_024743595.1|1512077_1513481_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019302800.1|1513494_1514001_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743594.1|1514403_1514862_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743593.1|1515639_1515843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807094.1|1516006_1517150_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.9	1.2e-84
WP_101807095.1|1517259_1518276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807096.1|1518561_1519938_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
WP_033004102.1|1519965_1520856_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_024743817.1|1521542_1522139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131112934.1|1526149_1527181_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.7e-74
>prophage 10
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	1569871	1637838	4703982	tRNA,protease,transposase	Ralstonia_phage(33.33%)	56	NA	NA
WP_058419068.1|1569871_1570840_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744656.1|1571163_1571457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324504.1|1571535_1571949_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_033003771.1|1572640_1573627_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_053513278.1|1573677_1573911_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_024744651.1|1574384_1574678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807099.1|1575570_1576020_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_053513279.1|1576285_1577143_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
WP_024744648.1|1577347_1577959_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_024744647.1|1578057_1580700_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
WP_024744646.1|1581213_1581849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807100.1|1581871_1582900_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_101807101.1|1582896_1583796_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1583852_1584269_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_053513280.1|1584280_1585396_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_024744641.1|1586485_1586956_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_033003769.1|1587393_1588068_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024744639.1|1588378_1591489_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744638.1|1591955_1592690_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_024744637.1|1592828_1593401_+	Maf-like protein	NA	NA	NA	NA	NA
WP_024744636.1|1593400_1594900_+	ribonuclease G	NA	NA	NA	NA	NA
WP_024744635.1|1595040_1598961_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_024744634.1|1598966_1599719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744633.1|1599817_1601263_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_024744632.1|1601519_1602101_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_024744631.1|1602246_1603614_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_082324502.1|1603688_1604093_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744630.1|1604144_1604606_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744629.1|1604675_1605773_-|protease	protease	protease	NA	NA	NA	NA
WP_101807075.1|1606179_1606977_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745348.1|1607089_1607965_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_024745349.1|1607966_1608227_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_024745350.1|1608258_1609563_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_101807102.1|1609596_1611303_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_024745352.1|1611445_1612786_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_024745353.1|1612795_1613632_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024745354.1|1613878_1614370_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024745355.1|1614577_1615327_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_024745356.1|1615436_1615973_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_024745357.1|1616083_1616563_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_024745358.1|1616791_1618036_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_024745359.1|1618043_1619294_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053514015.1|1619290_1620661_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
WP_024744748.1|1622218_1622515_+	cysteine methyltransferase	NA	NA	NA	NA	NA
WP_024744749.1|1622555_1623254_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_058419134.1|1623504_1624473_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_101807103.1|1625056_1626082_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_130625326.1|1627199_1627661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743076.1|1628477_1630493_-	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_101807317.1|1631162_1632179_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	9.6e-49
WP_058419036.1|1632575_1633544_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_154221280.1|1633627_1634197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744531.1|1634562_1635414_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_024744530.1|1635509_1636079_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.9	4.5e-72
WP_024744529.1|1636113_1636299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419036.1|1636869_1637838_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 11
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	1698472	1768131	4703982	integrase,tRNA,transposase	Leptospira_phage(20.0%)	54	1696863:1696879	1771644:1771660
1696863:1696879	attL	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
WP_024743628.1|1698472_1699399_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003485583.1|1699555_1699816_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_024743627.1|1699982_1702097_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_024743626.1|1702470_1703511_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_101807108.1|1703574_1704450_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_024743624.1|1704446_1704716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743623.1|1704774_1705278_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
WP_024743622.1|1705274_1706420_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_024743621.1|1706561_1707140_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.6	8.4e-34
WP_024743620.1|1707261_1707582_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_053513476.1|1707578_1708322_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024743618.1|1708318_1708918_+	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_024743617.1|1709687_1712882_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743616.1|1712988_1714374_+	LOG family protein	NA	NA	NA	NA	NA
WP_024743615.1|1714543_1715059_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	42.5	1.1e-05
WP_024743614.1|1715055_1715532_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_024743613.1|1715528_1716695_+	PilW family protein	NA	NA	NA	NA	NA
WP_101836532.1|1716691_1717207_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_024743610.1|1718126_1721165_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_024743609.1|1721171_1721627_+	type IV pilin protein	NA	NA	NA	NA	NA
WP_019299933.1|1721803_1722346_-	fimbrial protein	NA	NA	NA	NA	NA
WP_024743608.1|1722484_1724506_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_024744187.1|1726300_1727029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744188.1|1727158_1728253_-	acyltransferase	NA	NA	NA	NA	NA
WP_024744189.1|1728680_1730348_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_024744190.1|1730364_1731222_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_024744191.1|1731406_1732948_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.8	2.7e-79
WP_024744192.1|1732961_1734167_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_024744193.1|1734227_1735598_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_024744194.1|1735951_1736656_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_024744195.1|1736812_1737823_-	membrane protein	NA	NA	NA	NA	NA
WP_024744196.1|1738389_1738953_-	phasin family protein	NA	NA	NA	NA	NA
WP_024744197.1|1739114_1739390_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_101807318.1|1739630_1740440_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_024744199.1|1740381_1741038_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_024744200.1|1741339_1742308_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_053513270.1|1742482_1743568_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	1.7e-75
WP_053513272.1|1743650_1744859_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_024744202.1|1744980_1746294_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_101807110.1|1746335_1747133_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107490046.1|1747328_1748430_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024744617.1|1748850_1749318_-	TonB family protein	NA	NA	NA	NA	NA
WP_058419031.1|1749748_1750717_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_082324283.1|1750838_1751606_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743448.1|1751612_1753004_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
WP_024743447.1|1753464_1754049_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_024743446.1|1754148_1755165_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082324494.1|1755788_1757207_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017154976.1|1757302_1757545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324282.1|1757538_1757880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490965.1|1758432_1759533_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	7.2e-42
WP_101807112.1|1759590_1763184_-	avirulence protein	NA	NA	NA	NA	NA
WP_024743886.1|1764558_1766670_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	1.3e-15
WP_107490049.1|1767165_1768131_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
1771644:1771660	attR	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
>prophage 12
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	1839081	1848969	4703982	tRNA	Micromonas_sp._RCC1109_virus(16.67%)	7	NA	NA
WP_053513920.1|1839081_1840758_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.1e-37
WP_011408885.1|1840846_1841488_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_019300309.1|1841660_1842695_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
WP_024745487.1|1842996_1843485_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_024745486.1|1843586_1846235_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
WP_003481884.1|1846374_1846587_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_101807119.1|1848477_1848969_+	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	67.7	4.6e-57
>prophage 13
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	1974570	2061176	4703982	tRNA,transposase	uncultured_Caudovirales_phage(34.78%)	53	NA	NA
WP_024745402.1|1974570_1976088_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	8.6e-86
WP_024745401.1|1976229_1977366_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_024745399.1|1977730_1979908_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.3e-47
WP_019299970.1|1979919_1980789_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_024745398.1|1980965_1982648_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	2.1e-32
WP_024745396.1|1983297_1986066_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1986213_1986462_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1986458_1986869_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024745395.1|1986934_1989526_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_101807129.1|1989879_1990695_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_101807130.1|1991350_1993594_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024745392.1|1993702_1994779_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010365269.1|1994775_1995372_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_019302811.1|1995368_1996235_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_082324264.1|1996480_1998871_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	3.9e-08
WP_082324486.1|1998949_1999294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002806488.1|1999648_2000131_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_082324263.1|2000266_2001064_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_053513169.1|2002105_2004367_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_053513167.1|2004778_2007040_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	2.5e-12
WP_024742986.1|2007631_2010106_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	1.9e-10
WP_107490044.1|2010151_2011183_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_053514012.1|2014210_2016454_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.4e-14
WP_082324099.1|2016712_2018089_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_053513639.1|2018370_2020584_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-09
WP_053513641.1|2020781_2023151_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.7e-09
WP_024744836.1|2023164_2023926_-	transporter	NA	NA	NA	NA	NA
WP_101807131.1|2029433_2031695_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	2.8e-08
WP_158525110.1|2032116_2032281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743066.1|2032593_2034603_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|2034636_2035002_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_010375641.1|2034998_2035307_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_101807132.1|2035407_2036430_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743068.1|2036426_2037209_-	ParA family protein	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
WP_024743069.1|2037210_2038185_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_014503259.1|2038191_2038932_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_024743070.1|2039020_2039374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003138.1|2041660_2042368_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
WP_082330725.1|2042370_2043315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625354.1|2042947_2043883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743072.1|2043884_2046104_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
WP_024743073.1|2046358_2046811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324484.1|2047702_2050744_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082324483.1|2050988_2051267_-	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	70.3	9.0e-34
WP_058419068.1|2051422_2052391_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024744204.1|2052874_2053309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807133.1|2054703_2055925_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.7	2.1e-103
WP_082324260.1|2056021_2056423_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745516.1|2056419_2056929_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.0	1.3e-09
WP_024745515.1|2056909_2057251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324259.1|2057264_2057861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419060.1|2057966_2059343_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_058419060.1|2059799_2061176_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 14
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	2139416	2201857	4703982	tRNA,protease,transposase	Ralstonia_phage(25.0%)	48	NA	NA
WP_101807140.1|2139416_2140553_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024744409.1|2140549_2141008_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024744410.1|2141258_2141579_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
WP_024744411.1|2141721_2144004_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
WP_002813418.1|2144211_2144430_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024744412.1|2144510_2145263_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_024744413.1|2145396_2146026_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
WP_154221278.1|2146217_2146439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744414.1|2146701_2147823_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_101807141.1|2147880_2148849_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.0e-64
WP_101807142.1|2149132_2151490_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_024744416.1|2151652_2153581_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_082324480.1|2153687_2154317_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_033003706.1|2154429_2158596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744419.1|2158832_2160209_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	4.0e-74
WP_024744420.1|2160240_2160567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324256.1|2160563_2160971_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
WP_024744422.1|2161002_2161353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744423.1|2161349_2162681_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	4.3e-41
WP_024744424.1|2163001_2164207_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_024744425.1|2164371_2166744_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_053513574.1|2166768_2167401_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2167619_2168045_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_024744427.1|2168063_2169269_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_024744428.1|2169279_2170068_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_024744429.1|2170064_2170925_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024744430.1|2170995_2171634_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_082324255.1|2171630_2172851_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_024744432.1|2172861_2174259_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_024744433.1|2174573_2175794_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_082330762.1|2176285_2177446_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_101807324.1|2178294_2179311_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	3.3e-49
WP_101807143.1|2179648_2180248_-	DUF1264 domain-containing protein	NA	NA	NA	NA	NA
WP_101807144.1|2180393_2181362_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324479.1|2181510_2181900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744965.1|2181838_2182216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003964.1|2182421_2183675_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_101807145.1|2183712_2184282_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_024744963.1|2184265_2184628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744960.1|2187002_2187980_-	siroheme synthase	NA	NA	NA	NA	NA
WP_024744957.1|2189301_2189490_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024744956.1|2189502_2189778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019302775.1|2190422_2190680_+	stress-induced protein	NA	NA	NA	NA	NA
WP_101807146.1|2190905_2191874_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_024744883.1|2192515_2193001_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807147.1|2193107_2194028_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_024744881.1|2195217_2197029_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_058419089.1|2200888_2201857_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
>prophage 15
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	2220793	2367010	4703982	plate,transposase	Tupanvirus(42.86%)	51	NA	NA
WP_107490085.1|2220793_2221894_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	3.2e-42
WP_101807325.1|2222233_2222596_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_101807151.1|2222652_2226546_+	avirulence protein	NA	NA	NA	NA	NA
WP_101807152.1|2226677_2229764_+	avirulence protein	NA	NA	NA	NA	NA
WP_101807153.1|2229895_2234203_+	avirulence protein	NA	NA	NA	NA	NA
WP_024743648.1|2236134_2237028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743647.1|2237281_2238934_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.5	9.1e-41
WP_082324252.1|2239027_2239987_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.8	5.7e-11
WP_131112935.1|2240039_2244038_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.7	4.6e-54
WP_130625348.1|2244041_2244524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743561.1|2244434_2247074_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	4.1e-67
WP_024743560.1|2247001_2247709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101836533.1|2247939_2267421_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.1	9.2e-132
WP_101807157.1|2267426_2289839_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	1.1e-133
WP_101807158.1|2289835_2304322_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	1.4e-124
WP_024744003.1|2304853_2305948_+	type III polyketide synthase	NA	NA	NA	NA	NA
WP_024744002.1|2305987_2306731_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024744001.1|2306727_2308005_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_024744000.1|2307992_2309348_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743999.1|2309344_2310142_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024743998.1|2310218_2311925_+	cyclic peptide export ABC transporter	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	22.4	2.0e-06
WP_003468470.1|2312023_2312242_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_101807326.1|2312624_2314208_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743719.1|2317851_2320977_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024743718.1|2321028_2322141_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_053513440.1|2322264_2322843_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053512987.1|2325397_2327485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743837.1|2329422_2332512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033007312.1|2334796_2335504_+	response regulator	NA	NA	NA	NA	NA
WP_101807160.1|2335500_2336493_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033003485.1|2336489_2338949_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_033003483.1|2339062_2340043_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807161.1|2340051_2341080_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_024743830.1|2341252_2341579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513001.1|2341575_2344479_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	1.9e-09
WP_024743828.1|2344475_2345198_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_053513003.1|2345194_2345842_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_053513005.1|2345838_2349297_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_024743825.1|2349300_2350617_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_024743824.1|2350618_2351956_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743823.1|2351952_2353341_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_024743822.1|2353337_2353877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743821.1|2353885_2355823_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	7.7e-39
WP_024743820.1|2356086_2356548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743819.1|2356650_2356854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324173.1|2357898_2359275_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419068.1|2359437_2360406_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024743894.1|2360847_2363619_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
WP_024743895.1|2363651_2364662_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024743896.1|2364625_2366503_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743897.1|2366506_2367010_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 16
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	2601588	2706517	4703982	tRNA,protease,transposase	Ralstonia_phage(20.0%)	60	NA	NA
WP_058419031.1|2601588_2602557_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_053513013.1|2602937_2604773_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	9.5e-23
WP_024744752.1|2605044_2606136_+	ribonuclease D	NA	NA	NA	NA	NA
WP_082324230.1|2608185_2608350_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_024744755.1|2608574_2608976_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024744756.1|2609786_2610872_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_024744757.1|2610914_2611424_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024744758.1|2611435_2613094_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.6	2.7e-08
WP_082324229.1|2616154_2616571_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_014503014.1|2617142_2617583_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.0	7.1e-25
WP_024744763.1|2617661_2618297_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_082324468.1|2618693_2619437_-	cytochrome c1	NA	NA	NA	NA	NA
WP_024744765.1|2619444_2620704_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_024744766.1|2620703_2621348_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_024744767.1|2621875_2622862_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_050588012.1|2624214_2624508_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_024744770.1|2624803_2626258_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_024744771.1|2626681_2627668_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
WP_033003832.1|2628098_2628743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744772.1|2628797_2629283_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_024744773.1|2629282_2629801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744774.1|2629895_2630774_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024744775.1|2630770_2632051_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_024744776.1|2632066_2633068_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_033003835.1|2633219_2634584_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_101807173.1|2635058_2635907_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744779.1|2635903_2636815_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744780.1|2636943_2638077_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
WP_082324228.1|2638222_2639734_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024744782.1|2639720_2641307_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_024744783.1|2641303_2642506_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_058419102.1|2643354_2644323_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
WP_024743152.1|2646942_2648328_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_024743150.1|2648974_2650354_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_033003186.1|2650353_2651670_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_082330729.1|2651806_2653051_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
WP_024743147.1|2653356_2654637_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_082324226.1|2654938_2655247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743145.1|2655206_2657555_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_024743144.1|2657551_2658397_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_024743143.1|2658403_2660083_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_024743142.1|2660611_2661964_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743141.1|2662024_2665156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743140.1|2665320_2666175_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
WP_101807174.1|2666345_2667650_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_024743138.1|2667791_2671886_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	5.0e-56
WP_058419204.1|2672978_2673947_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_024743589.1|2674433_2679443_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_101807175.1|2679720_2680380_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743591.1|2680394_2681702_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_101807176.1|2681714_2684885_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024744846.1|2687576_2688572_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024744845.1|2688732_2691249_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_024744844.1|2691245_2692202_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_024744843.1|2692360_2694103_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_082324465.1|2694421_2695558_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_024712661.1|2698984_2699710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324130.1|2700188_2701205_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807177.1|2703780_2704524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807178.1|2705140_2706517_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 17
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	2901949	3018459	4703982	tRNA,protease,transposase	Ralstonia_phage(13.33%)	84	NA	NA
WP_058419096.1|2901949_2902918_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_082324130.1|2904309_2905326_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_101807194.1|2905498_2906401_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_101807195.1|2906598_2907966_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.9	1.6e-112
WP_024743338.1|2908217_2908730_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_082324207.1|2908659_2908899_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_024743337.1|2909241_2910741_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743336.1|2910737_2911670_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743335.1|2911850_2914679_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_024743334.1|2914721_2915924_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_014502759.1|2916165_2917602_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
WP_024743333.1|2917800_2918394_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
WP_082324453.1|2918658_2919252_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_024743331.1|2919248_2921018_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
WP_024743330.1|2921260_2922115_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743329.1|2922111_2923515_+	TolC family protein	NA	NA	NA	NA	NA
WP_024743328.1|2923866_2924061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743327.1|2924340_2925462_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_024743326.1|2925458_2926376_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_101807196.1|2926903_2928034_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
WP_024743324.1|2928193_2930119_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
WP_011258741.1|2930260_2930779_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_101807197.1|2930879_2931932_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_024743322.1|2932048_2933713_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_082324204.1|2934155_2934581_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011258737.1|2934670_2935066_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_024743320.1|2935412_2935688_-	RnfH family protein	NA	NA	NA	NA	NA
WP_024743319.1|2935701_2936133_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010366344.1|2936193_2936697_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
WP_024743318.1|2936861_2939309_-	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	26.7	2.6e-15
WP_058419096.1|2941058_2942027_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_101807198.1|2942249_2943626_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	7.3e-60
WP_033003395.1|2944394_2945087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625332.1|2945205_2945631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|2945778_2946880_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_033003338.1|2947859_2948108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082330739.1|2948384_2949539_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_024743456.1|2949538_2950861_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_024743457.1|2950887_2951928_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_082324452.1|2951945_2952806_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_101807199.1|2952841_2953441_+	LysE family translocator	NA	NA	NA	NA	NA
WP_082324200.1|2953507_2954443_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_082324199.1|2954508_2955861_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_058419055.1|2956409_2957786_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_158525112.1|2957782_2958880_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.5e-76
WP_101807049.1|2958928_2960030_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_024743394.1|2963380_2964355_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
WP_024743393.1|2966217_2966943_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
WP_101807075.1|2967405_2968203_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324197.1|2968211_2969666_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.5	4.4e-47
WP_024743064.1|2969732_2971163_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
WP_024743063.1|2971384_2971939_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
WP_024743062.1|2972155_2974096_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
WP_024743061.1|2974271_2974910_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444392.1|2978976_2979768_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743060.1|2979913_2980129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743059.1|2980128_2980896_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_024743058.1|2980957_2981788_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_024743057.1|2981860_2982289_+	cytochrome c	NA	NA	NA	NA	NA
WP_024743056.1|2982420_2982900_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|2983150_2983366_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_024743055.1|2983593_2984079_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_024744839.1|2986697_2988929_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
WP_058419090.1|2989072_2990449_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419089.1|2991567_2992536_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
WP_101836935.1|2992857_2993931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807200.1|2994103_2995072_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_033004173.1|2996162_2996798_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_053513872.1|2996933_2998451_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_024745369.1|2998785_3000666_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
WP_024745370.1|3000854_3001634_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|3001715_3002201_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_082330790.1|3004658_3004898_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_024745371.1|3005147_3005861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745372.1|3007374_3007881_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024745373.1|3008042_3008621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745374.1|3008712_3009213_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807203.1|3009279_3010125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588027.1|3010175_3010454_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745377.1|3010673_3010862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503886.1|3011275_3011884_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024745379.1|3013080_3014898_+	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745380.1|3015026_3017216_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_101807204.1|3017661_3018459_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	3409672	3464156	4703982	tRNA,transposase	Acidithiobacillus_phage(33.33%)	35	NA	NA
WP_107490063.1|3409672_3410775_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.9e-42
WP_024744212.1|3411086_3411998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744213.1|3412122_3414708_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_024744214.1|3415153_3415459_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_024744215.1|3415839_3418455_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.5	2.8e-28
WP_024744216.1|3418755_3419370_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_024744217.1|3419803_3422050_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_024744218.1|3422173_3422581_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_024744219.1|3422921_3424412_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005989873.1|3425030_3425438_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_024744220.1|3425582_3426341_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_024744221.1|3426405_3426918_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011258141.1|3426961_3427219_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_024744222.1|3427328_3428126_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_050588001.1|3429365_3430601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744223.1|3430749_3432126_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407903.1|3432510_3433302_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_024744224.1|3433588_3434638_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_024744225.1|3434877_3436461_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_101807217.1|3436648_3437447_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_033003517.1|3438541_3440503_-	response regulator	NA	NA	NA	NA	NA
WP_024743903.1|3440486_3441374_-	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	9.3e-24
WP_024743904.1|3441370_3442381_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_024743905.1|3442371_3442767_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_014504248.1|3442763_3443126_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743906.1|3443127_3443970_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743907.1|3444644_3446969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324164.1|3446993_3448964_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.5e-15
WP_053513727.1|3451264_3452056_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_101836534.1|3452273_3452555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807218.1|3453362_3454757_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_101807336.1|3455064_3456167_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.8e-43
WP_101807219.1|3456344_3457721_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_058419060.1|3460561_3461938_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_158525114.1|3463043_3464156_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	59.9	6.5e-59
>prophage 19
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	3553095	3573861	4703982	tRNA,transposase	Ralstonia_phage(60.0%)	15	NA	NA
WP_058419069.1|3553095_3554064_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_130625388.1|3554158_3554350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745347.1|3554422_3554815_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_130625389.1|3556600_3557491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419068.1|3557958_3558927_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_082324099.1|3559171_3560548_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_107490060.1|3561550_3562653_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_101807338.1|3563513_3564516_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	4.2e-97
WP_024744854.1|3567600_3567801_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_024744855.1|3568163_3568958_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014504352.1|3569259_3570018_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014504353.1|3570093_3571956_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_024744856.1|3572013_3572355_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_014504356.1|3572613_3572889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807223.1|3573062_3573861_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	3819009	3885684	4703982	tRNA,protease,transposase	Staphylococcus_phage(14.29%)	46	NA	NA
WP_058419057.1|3819009_3819978_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024744620.1|3820179_3820602_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
WP_024744619.1|3821199_3821589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744618.1|3821581_3823234_+|protease	serine protease	protease	NA	NA	NA	NA
WP_101807233.1|3823685_3824492_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
WP_024745219.1|3824544_3825723_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	6.9e-51
WP_050588023.1|3826109_3827039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324136.1|3827203_3828604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745216.1|3828551_3830459_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101807234.1|3830471_3831494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745214.1|3831623_3832463_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745213.1|3833073_3834231_+	phosphotransferase	NA	NA	NA	NA	NA
WP_053513843.1|3834266_3836429_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_053513841.1|3836803_3837379_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_024745210.1|3837484_3838213_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_024745209.1|3838643_3839483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745208.1|3839479_3841783_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	24.4	1.5e-09
WP_101807235.1|3841779_3842610_-	general secretion pathway protein GspN	NA	NA	NA	NA	NA
WP_024745206.1|3842599_3843253_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_024745205.1|3843236_3844358_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|3844354_3845206_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_024745204.1|3845202_3845838_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_024745203.1|3845834_3846251_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_024745202.1|3846247_3846757_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|3846766_3847198_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257722.1|3847465_3848683_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_082324135.1|3848682_3848862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324134.1|3848858_3850598_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_024745200.1|3850715_3852599_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.7	7.0e-21
WP_053513836.1|3852819_3858900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745197.1|3859877_3863930_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	5.8e-121
WP_024745196.1|3864345_3865143_-	DsbC family protein	NA	NA	NA	NA	NA
WP_024745195.1|3865626_3866598_-	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	30.3	1.9e-14
WP_024745194.1|3867023_3867491_+	RDD family protein	NA	NA	NA	NA	NA
WP_082324133.1|3867588_3867900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745193.1|3867904_3869011_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_053513834.1|3869007_3870090_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_024745191.1|3870197_3871670_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
WP_024745189.1|3872025_3872451_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_082324132.1|3872461_3873694_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324131.1|3873696_3874344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745188.1|3874472_3877415_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.2	2.2e-130
WP_053513831.1|3878137_3880111_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.3e-14
WP_101807236.1|3880567_3881944_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	9.2e-63
WP_082324130.1|3882297_3883314_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_082324130.1|3884667_3885684_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
>prophage 21
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	3905484	3911854	4703982		Enterobacteria_phage(50.0%)	6	NA	NA
WP_011407616.1|3905484_3906831_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_024743259.1|3906876_3908280_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
WP_024743260.1|3908396_3909305_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
WP_024743261.1|3909301_3909859_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
WP_011407613.1|3909855_3910743_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|3910798_3911854_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
>prophage 22
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	4260144	4336924	4703982	transposase	Acidithiobacillus_phage(21.43%)	56	NA	NA
WP_058419036.1|4260144_4261113_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_050588016.1|4261556_4262027_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024744929.1|4262711_4264844_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_082324401.1|4265330_4265693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744927.1|4265694_4266546_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_024744926.1|4266598_4267480_+	TolB-like protein	NA	NA	NA	NA	NA
WP_024744925.1|4268145_4270707_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_101807267.1|4270939_4271692_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.3	2.8e-21
WP_053513030.1|4271819_4272734_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024744922.1|4272826_4273804_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_014505063.1|4273991_4274984_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_033003934.1|4275204_4275453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744920.1|4275658_4276129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744919.1|4276229_4278020_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_024744918.1|4278224_4280462_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_101807344.1|4282055_4283072_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
WP_082324203.1|4283242_4284619_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743126.1|4287037_4288048_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743127.1|4288448_4289642_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024712051.1|4289638_4290385_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_024743128.1|4290416_4292018_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4292078_4292279_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024743129.1|4292275_4292863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743130.1|4293311_4293584_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024743131.1|4293649_4294639_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_082324107.1|4294708_4295470_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_024743133.1|4295572_4296568_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.5e-26
WP_033003179.1|4296585_4297377_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743135.1|4297378_4297963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033003181.1|4298081_4299020_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_101807269.1|4299133_4299337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|4299376_4300478_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|4300906_4302283_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024744975.1|4302863_4303412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053512924.1|4303899_4304184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744977.1|4304768_4306046_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011257407.1|4306325_4306652_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_024744978.1|4306623_4307118_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	2.7e-17
WP_024744979.1|4307125_4308451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712257.1|4308525_4309569_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.1	1.1e-151
WP_101807270.1|4309766_4312265_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	66.9	4.1e-303
WP_024744981.1|4312880_4313924_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	4.8e-80
WP_024744982.1|4314030_4316739_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024744983.1|4317025_4317640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257400.1|4317711_4319079_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744985.1|4319768_4321592_+	potassium transporter KefB	NA	NA	NA	NA	NA
WP_082330734.1|4323135_4325079_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	37.3	2.6e-79
WP_024743306.1|4324928_4326728_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_082324102.1|4326791_4327121_-	phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_024743307.1|4327147_4330468_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011407425.1|4330460_4330721_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_024743308.1|4330939_4332139_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_024743309.1|4332138_4332912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743310.1|4332908_4333730_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024743311.1|4333726_4335349_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_101807272.1|4335547_4336924_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	2.2e-64
>prophage 23
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	4406419	4576375	4703982	tRNA,transposase	Acidithiobacillus_phage(16.67%)	104	NA	NA
WP_101807275.1|4406419_4407388_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_082324392.1|4407513_4407879_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_024743782.1|4407875_4409177_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_024743781.1|4409357_4410134_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743780.1|4410610_4411195_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_024743779.1|4411387_4414837_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_024743778.1|4415588_4418231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743777.1|4418334_4420734_-	NdvB protein	NA	NA	NA	NA	NA
WP_024743776.1|4420736_4422119_-	MFS transporter	NA	NA	NA	NA	NA
WP_024743775.1|4422276_4422861_+	gluconokinase	NA	NA	NA	NA	NA
WP_024743774.1|4423696_4425427_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	36.1	1.7e-82
WP_082324100.1|4425758_4426064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|4425966_4426407_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_024743773.1|4426426_4426855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490046.1|4428401_4429503_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807277.1|4429522_4430491_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_058419036.1|4431921_4432890_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_053513161.1|4433153_4437011_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_024743466.1|4437007_4438789_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_024743464.1|4441974_4443564_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_024743463.1|4443563_4445822_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_024743462.1|4445979_4446888_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_024743461.1|4446977_4448792_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_158525116.1|4449185_4457645_-	hypothetical protein	NA	A0A1S5SDF1	Streptococcus_phage	32.0	1.3e-10
WP_011409712.1|4458597_4459350_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_024745621.1|4459409_4460309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745620.1|4460461_4461217_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_024745619.1|4461213_4461786_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4461801_4462029_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_024745618.1|4462101_4463007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745617.1|4463160_4464126_+	ferrochelatase	NA	NA	NA	NA	NA
WP_024745616.1|4464128_4464980_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	31.3	1.3e-06
WP_024745615.1|4465060_4465519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745614.1|4465789_4466575_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745613.1|4467190_4468096_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.2	1.4e-43
WP_024745612.1|4468159_4469077_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_024744967.1|4471272_4472340_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_101807280.1|4472494_4474690_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_101807281.1|4474686_4476651_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_101807282.1|4476662_4477922_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_101807349.1|4477921_4479622_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_101807283.1|4479624_4482339_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_101807284.1|4482561_4484082_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	2.5e-45
WP_107490031.1|4484076_4485108_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_082324355.1|4485290_4486667_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_033003464.1|4486843_4487947_+	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
WP_024743784.1|4488038_4488413_-	VOC family protein	NA	NA	NA	NA	NA
WP_082324356.1|4489113_4490130_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_024743734.1|4490752_4491808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743735.1|4492034_4493453_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_024743736.1|4493493_4494471_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_082324358.1|4495875_4497357_-	MFS transporter	NA	NA	NA	NA	NA
WP_082324566.1|4497698_4500572_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743740.1|4500670_4502158_+	MFS transporter	NA	NA	NA	NA	NA
WP_024743741.1|4502189_4503224_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_024743742.1|4503565_4504099_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_101807285.1|4504380_4505349_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	6.6e-100
WP_154221296.1|4505400_4505739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807286.1|4505815_4506621_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.0	7.7e-09
WP_024743989.1|4506822_4507395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011349116.1|4507533_4507752_+	YdcH family protein	NA	NA	NA	NA	NA
WP_024743991.1|4508388_4509369_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_024743992.1|4509564_4512228_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_024743993.1|4512227_4513202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324359.1|4513200_4513446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743994.1|4513614_4514667_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513382.1|4514831_4517870_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_058419058.1|4518708_4520085_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_024743574.1|4522833_4524363_+	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.5	3.9e-46
WP_024743573.1|4524669_4525449_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_024743572.1|4525445_4526456_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_101807288.1|4526735_4527401_+	YceH family protein	NA	NA	NA	NA	NA
WP_101807290.1|4528799_4530776_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	6.3e-113
WP_024743567.1|4530982_4531612_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
WP_024743566.1|4532070_4533309_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_024743565.1|4533451_4535050_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_082324360.1|4535118_4536210_-	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_033003378.1|4536442_4537258_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
WP_058419055.1|4537546_4538923_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024744511.1|4545401_4547306_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.0e-19
WP_024744510.1|4547302_4547905_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_024744509.1|4548005_4549265_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_024744508.1|4549555_4551718_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_024744507.1|4551870_4552077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807291.1|4552284_4552674_-	YchJ family protein	NA	NA	NA	NA	NA
WP_082330766.1|4552731_4553553_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_101807292.1|4553677_4555054_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	4.3e-60
WP_053513660.1|4555185_4556367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513661.1|4556464_4559896_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024745665.1|4560043_4560742_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_024745666.1|4560725_4562198_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_024745667.1|4562194_4562782_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_024745668.1|4562781_4563978_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324363.1|4564051_4564681_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	4.2e-47
WP_050588040.1|4564774_4565272_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513662.1|4566685_4567210_+	FUSC family protein	NA	NA	NA	NA	NA
WP_101807293.1|4567181_4568198_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_024744628.1|4568604_4569966_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
WP_101807219.1|4570146_4571523_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_082324568.1|4572211_4572925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745343.1|4572955_4573462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745344.1|4573735_4573942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745345.1|4573928_4575041_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_107490090.1|4575273_4576375_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.2e-42
>prophage 24
NZ_CP019086	Xanthomonas oryzae pv. oryzae strain MAI73 chromosome, complete genome	4703982	4585101	4642979	4703982	transposase	Acidithiobacillus_phage(30.77%)	44	NA	NA
WP_058419060.1|4585101_4586478_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024742954.1|4587002_4587314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742953.1|4587573_4588056_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_024742952.1|4588352_4589522_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_024742951.1|4589763_4589952_+	CsbD family protein	NA	NA	NA	NA	NA
WP_074038671.1|4590596_4590854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742950.1|4590978_4591428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742949.1|4591584_4592565_+	ATP-binding cassette domain-containing protein	NA	K7PHD1	Enterobacteria_phage	46.4	7.0e-73
WP_082324366.1|4593484_4593841_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743547.1|4593883_4596664_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743548.1|4596950_4597973_+	sugar kinase	NA	NA	NA	NA	NA
WP_154221263.1|4598429_4598570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743549.1|4598593_4599802_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_024743552.1|4601773_4602940_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_154221305.1|4604228_4604597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419197.1|4604891_4606268_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_082324367.1|4606278_4606572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324368.1|4606682_4608878_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
WP_024712580.1|4608976_4610179_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024743645.1|4610449_4611460_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
WP_024743646.1|4611734_4612202_+	DUF4410 domain-containing protein	NA	NA	NA	NA	NA
WP_082324173.1|4613578_4614955_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_158500224.1|4615070_4615388_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101807296.1|4615500_4616469_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625425.1|4616893_4617124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625426.1|4617287_4619933_+	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_131085815.1|4619973_4620720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807297.1|4620741_4622037_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_050587973.1|4622056_4624183_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.3	7.9e-29
WP_101807298.1|4624439_4625687_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.1e-61
WP_082324571.1|4626979_4627390_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_033003354.1|4627649_4628105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625428.1|4628037_4628298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807299.1|4628328_4629216_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_033003355.1|4629549_4631127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743499.1|4631621_4632449_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_058419165.1|4633175_4634234_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_107490046.1|4635977_4637079_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807300.1|4637316_4637877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807296.1|4637875_4638844_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625431.1|4638938_4639241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745548.1|4639312_4640050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033004251.1|4640067_4640760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807103.1|4641953_4642979_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
