The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	10486	78851	2191149	integrase,transposase	Streptococcus_phage(30.77%)	51	13274:13291	91691:91708
WP_012211358.1|10486_11665_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
13274:13291	attL	GAAAAGATGATCAAGAAA	NA	NA	NA	NA
WP_101812846.1|16120_16807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|17782_18961_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_041806158.1|19426_20284_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_020828862.1|21086_21245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631389.1|23056_25078_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003624877.1|25089_25545_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003624875.1|25575_26970_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.6	3.7e-120
WP_012211204.1|27206_28136_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012211205.1|28252_29530_-|transposase	ISL3-like element ISLhe2 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.4e-12
WP_003624871.1|29696_30626_+	DegV family protein	NA	NA	NA	NA	NA
WP_101812549.1|30744_31623_+	ROK family protein	NA	NA	NA	NA	NA
WP_003631748.1|31774_31945_+	CsbD family protein	NA	NA	NA	NA	NA
WP_023191122.1|31995_32256_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_012211208.1|32316_33546_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_012211209.1|33629_34334_-	methyltransferase	NA	G3MA03	Bacillus_virus	43.6	2.1e-18
WP_101812550.1|34819_36838_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	30.2	8.0e-31
WP_012211358.1|36959_38138_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812551.1|38299_41077_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_101812552.1|41345_42314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812553.1|42439_42751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812554.1|42747_43830_+	cell division protein	NA	NA	NA	NA	NA
WP_101812555.1|43826_44369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812556.1|44538_45636_+	replication initiation protein	NA	A0A1W5PX59	unidentified_circular_ssDNA_virus	20.5	7.5e-07
WP_023061685.1|45695_45890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812557.1|45960_47160_+|integrase	site-specific integrase	integrase	Q9ZXG6	Leuconostoc_phage	23.2	8.4e-12
WP_101812558.1|47578_48865_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.3	1.7e-106
WP_014562792.1|49122_49476_-	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
WP_072749171.1|49472_49673_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065866708.1|49840_50479_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	31.8	7.6e-20
WP_014562795.1|50503_51262_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_101812559.1|53973_54561_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003633344.1|54665_55967_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_012211215.1|57634_59035_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_012211216.1|59131_59905_+	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_003624806.1|59943_60504_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_012211217.1|60504_61029_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003628011.1|61030_61441_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_012211218.1|61461_63696_-	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A222ZQ84	Mycobacterium_phage	33.2	2.5e-89
WP_012211219.1|63950_64985_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012211220.1|64981_65554_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_012211221.1|66973_67603_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012211222.1|68005_69127_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.0e-92
WP_012211223.1|69104_70271_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	46.9	2.6e-98
WP_012211224.1|70438_70753_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_003624787.1|73320_74082_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.6	6.5e-18
WP_012211225.1|74078_74975_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_101812560.1|74971_75964_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003628105.1|76311_77019_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_158648828.1|77275_77530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812561.1|77660_78851_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.7	8.4e-129
91691:91708	attR	GAAAAGATGATCAAGAAA	NA	NA	NA	NA
>prophage 2
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	109110	141520	2191149	protease,transposase	Bacillus_phage(25.0%)	26	NA	NA
WP_012211358.1|109110_110289_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023191277.1|110473_111595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812565.1|111868_113275_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003628548.1|114102_115005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190998.1|116980_117175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190500.1|118949_119156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211246.1|119484_120201_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.0e-41
WP_101812847.1|120267_122124_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	32.0	5.1e-32
WP_101812566.1|122104_123463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211249.1|123465_124290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211250.1|124305_125103_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.1	1.2e-30
WP_012211251.1|125189_126431_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.4	1.1e-17
WP_003628556.1|126895_127375_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_079227915.1|127485_127755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211252.1|127883_128768_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_012211253.1|128776_129430_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_012211254.1|129433_130783_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	3.3e-12
WP_012211255.1|130940_131882_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101812567.1|132970_133459_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	33.8	4.9e-11
WP_012211256.1|133550_134447_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003625378.1|134461_135022_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	33.7	1.2e-13
WP_012211257.1|135088_136195_-	cation transporter	NA	NA	NA	NA	NA
WP_003625382.1|136383_136788_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_012211358.1|137663_138842_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003548644.1|139969_140110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812568.1|140242_141520_-|transposase	ISL3-like element ISLhe2 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	8.1e-13
>prophage 3
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	199342	315445	2191149	holin,tRNA,transposase,protease	Lactobacillus_virus(13.33%)	97	NA	NA
WP_101812577.1|199342_199450_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_101812578.1|199607_200036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211302.1|200272_200488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812579.1|200536_200806_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_101812580.1|201337_202726_+	S-layer protein	NA	NA	NA	NA	NA
WP_101812581.1|203230_204502_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	39.1	1.4e-65
WP_056941122.1|204534_204945_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	36.4	1.1e-19
WP_101812582.1|205221_206445_+	N-acetylmuramidase	NA	S5M9Y4	Brevibacillus_phage	36.3	2.0e-13
WP_012211305.1|206463_207555_+	amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	26.9	1.3e-19
WP_003630530.1|207658_209494_+	potassium transporter	NA	NA	NA	NA	NA
WP_012211306.1|209611_210346_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	31.6	6.5e-31
WP_003630533.1|210691_211657_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_101812583.1|211666_212458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079227881.1|212545_213811_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_012211308.1|214903_215596_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_101812584.1|215818_216430_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_012212050.1|216555_217962_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003625545.1|218091_218652_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_101812585.1|218753_219863_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003630675.1|219862_220480_+	membrane protein	NA	NA	NA	NA	NA
WP_101812586.1|220515_223506_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_003630678.1|223591_224986_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_101812587.1|225239_226502_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	6.7e-84
WP_003630682.1|226923_227280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211317.1|227584_228898_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.0	2.6e-62
WP_012211318.1|228897_229551_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003630770.1|229719_231342_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003630771.1|231416_233048_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003625557.1|233204_234347_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	34.1	1.2e-63
WP_003625558.1|234521_235451_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003625559.1|235459_236491_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012211321.1|236506_237565_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	3.7e-19
WP_003625561.1|237585_238530_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	4.6e-21
WP_003625562.1|238611_239928_-	aminopeptidase E	NA	R4TV59	Phaeocystis_globosa_virus	36.1	1.0e-63
WP_003625563.1|240068_240515_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_143441508.1|241322_241673_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003627958.1|241712_241943_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627959.1|241917_243255_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_020829427.1|243558_244221_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003630784.1|244381_244981_-	DUF159 family protein	NA	NA	NA	NA	NA
WP_041806186.1|245136_246543_+|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_003625567.1|246712_247735_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003625568.1|247759_248239_+	hypothetical protein	NA	A7KUY9	Bacillus_phage	59.0	5.2e-37
WP_035509874.1|248219_248837_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_101812588.1|249135_251799_+	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	24.4	9.9e-37
WP_101812589.1|251891_253868_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	5.2e-99
WP_003625572.1|253867_254635_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003625573.1|254621_255188_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_020829424.1|255177_256053_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003625575.1|256133_256391_+	Veg protein	NA	NA	NA	NA	NA
WP_003625576.1|256491_257322_+	pur operon repressor	NA	NA	NA	NA	NA
WP_012211335.1|257368_258754_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	34.0	1.0e-29
WP_023191386.1|259542_259974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041806237.1|260068_261025_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	49.2	5.9e-93
WP_020829421.1|261342_262359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003630871.1|262494_263889_+	cell division protein	NA	NA	NA	NA	NA
WP_020829420.1|264129_265104_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.8	6.6e-47
WP_003630873.1|266132_266408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625586.1|266435_267800_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.1	1.4e-31
WP_003625587.1|267913_268315_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003625588.1|268361_268919_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003625589.1|269036_270656_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.2	5.6e-136
WP_101812590.1|270785_272087_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_101511782.1|272083_272941_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_023191958.1|273177_273399_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_080669042.1|273405_273795_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_012211344.1|273850_275275_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_012211345.1|275355_276180_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211346.1|276279_277554_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.9	1.4e-28
WP_012211347.1|277557_278136_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012211358.1|278409_279588_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_035504367.1|279789_280392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146211431.1|280704_281934_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.4	2.7e-122
WP_035514015.1|282432_282726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190992.1|282768_282921_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023190993.1|283160_284711_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	34.1	6.2e-23
WP_003625618.1|287099_288335_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	1.2e-101
WP_012211356.1|288462_289740_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.3	3.8e-10
WP_012211358.1|291196_292375_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211358.1|293967_295146_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003625723.1|295339_296416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146212038.1|296754_297939_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.1	2.3e-123
WP_012211360.1|298125_298956_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003625728.1|299140_299386_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003625729.1|299512_300880_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_101812592.1|300892_302416_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	38.4	2.5e-69
WP_003625735.1|302498_302855_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_012211362.1|302857_303988_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	7.2e-29
WP_003631233.1|304771_305479_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_101812593.1|305666_306638_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_012211364.1|306772_307330_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_101812594.1|307331_310829_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003625749.1|310840_311083_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_012211366.1|311148_311526_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_023190461.1|311525_311888_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014562984.1|311928_313185_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_012211368.1|313279_315445_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	47.8	3.0e-108
>prophage 5
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	417206	466970	2191149	holin,tRNA,transposase	uncultured_virus(15.79%)	45	NA	NA
WP_012211427.1|417206_417941_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_012211428.1|417924_418497_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_023061461.1|418547_419597_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	35.2	1.1e-50
WP_012211709.1|419665_420943_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.8e-12
WP_012211431.1|421120_423034_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.4	6.0e-60
WP_003625963.1|423207_423855_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_012211433.1|423994_424453_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211434.1|424449_425196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812609.1|426610_427141_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_101812565.1|427370_428777_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012211436.1|428891_429185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023061469.1|429328_429421_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_012211437.1|429718_430249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627770.1|430464_430749_+	co-chaperone GroES	NA	A0A221S304	uncultured_virus	40.7	1.2e-12
WP_012211438.1|430802_432425_+	chaperonin GroEL	NA	A0A240F766	uncultured_virus	54.0	4.4e-157
WP_012211439.1|432605_435182_+	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	25.2	4.6e-39
WP_012211440.1|435181_437092_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.7	5.8e-55
WP_012211441.1|437092_437683_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003627765.1|437731_438748_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	7.4e-09
WP_101812610.1|438797_439232_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_012211444.1|439367_440819_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	32.4	3.3e-63
WP_023190286.1|440811_441933_+	DNA polymerase IV	NA	A0A1P8CWP4	Bacillus_phage	24.5	3.1e-16
WP_012211446.1|441992_442949_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_012211447.1|442941_444303_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	4.4e-49
WP_012211358.1|445110_446289_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211450.1|447015_449655_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.0	6.1e-63
WP_003627753.1|449715_449973_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_012211451.1|449972_450401_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_012211452.1|450402_450714_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_012211453.1|450777_453135_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	48.7	9.7e-20
WP_012211455.1|453235_453547_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.7	3.8e-17
WP_012211456.1|453586_453964_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_012211457.1|454034_454892_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_101812850.1|454960_456226_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	4.0e-52
WP_012211458.1|456507_456921_-	YslB family protein	NA	NA	NA	NA	NA
WP_003627745.1|456997_457801_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003631882.1|457800_458421_+	XTP/dITP diphosphatase	NA	A0A2P1DNP2	Cassava_brown_streak_virus	34.0	8.8e-13
WP_012211459.1|458699_459929_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.2e-64
WP_012211460.1|460166_461426_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.1	2.9e-10
WP_012211461.1|461593_462445_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_012211462.1|462578_463004_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_012211463.1|463021_463393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211464.1|463458_464565_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012211465.1|464711_465713_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	26.3	1.1e-20
WP_012211358.1|465791_466970_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	521251	567714	2191149	tRNA,transposase	Orpheovirus(20.0%)	46	NA	NA
WP_023190427.1|521251_521863_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_012212178.1|522397_524083_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.4	6.0e-72
WP_012212177.1|524193_525105_+	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_012212176.1|525177_525696_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003629878.1|525698_525968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003629876.1|526115_526388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212175.1|526377_526989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212173.1|529150_529951_-	multidrug transporter	NA	NA	NA	NA	NA
WP_080516437.1|529931_530477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|530551_531730_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812614.1|531851_532106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|532504_533683_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003627229.1|533752_533974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023191232.1|534082_534373_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101812615.1|534539_534794_+	AbrB family toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_012212166.1|534858_535173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212164.1|538003_538489_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_012212163.1|538631_539471_+	DegV family protein	NA	NA	NA	NA	NA
WP_023191249.1|539784_539967_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_041810734.1|539963_540662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212162.1|542090_542606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049751283.1|542602_542785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212161.1|542795_543614_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_023191303.1|543664_543994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212159.1|544057_544810_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	30.7	1.4e-25
WP_003627210.1|545866_546013_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_101812616.1|546678_547857_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212157.1|548378_550436_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_003627204.1|550456_550807_+	YlbF family regulator	NA	NA	NA	NA	NA
WP_012212156.1|550815_552036_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_012212155.1|552016_554518_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003627200.1|554510_555488_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003627199.1|555530_555953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212154.1|556091_556994_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003627197.1|557111_557447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212153.1|557456_557894_-	HIT family protein	NA	NA	NA	NA	NA
WP_014918422.1|558388_558724_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_003627193.1|558738_559482_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	1.7e-18
WP_023191294.1|559474_560662_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012212149.1|560673_561327_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_012212148.1|561397_561718_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_012212147.1|561737_562385_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_041810733.1|562436_563744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025283820.1|565445_565643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041810732.1|565750_566359_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	42.0	5.2e-34
WP_012212125.1|566388_567714_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	7.3e-57
>prophage 7
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	573939	732973	2191149	integrase,tRNA,transposase,protease	Bacillus_phage(17.65%)	117	635070:635114	637105:637149
WP_012212145.1|573939_575217_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
WP_101812618.1|575530_576766_-|transposase	IS3-like element ISLhe6 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.3	9.8e-56
WP_003629734.1|576821_577466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041810731.1|577500_578133_-	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	62.2	4.1e-18
WP_012212143.1|578705_579158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627177.1|579312_580626_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_003627174.1|580680_581658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627172.1|581746_583261_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_012212141.1|583398_584376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812616.1|584754_585933_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212140.1|586162_586477_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003629702.1|586494_587376_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_041806223.1|587653_588832_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_006351623.1|590444_591806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812620.1|591941_595418_+	restriction endonuclease	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	23.3	4.6e-26
WP_101812621.1|595417_598912_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	23.7	1.6e-31
WP_006351619.1|599285_599816_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_020829343.1|599922_601743_+	FAD-dependent oxidoreductase	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	23.0	4.9e-11
WP_003630977.1|601755_602172_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_158648811.1|602125_602914_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_051356297.1|602906_603587_+	FMN-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	33.0	9.7e-05
WP_003630969.1|603604_605080_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	24.2	1.2e-20
WP_006351611.1|607052_607520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192420.1|607568_608618_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.1	6.0e-46
WP_020829340.1|609091_611755_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	31.0	2.9e-60
WP_003627142.1|611763_612594_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	25.9	7.1e-18
WP_095662317.1|612590_613193_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003627138.1|613195_613663_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_014563221.1|613665_614997_+	helicase DnaB	NA	NA	NA	NA	NA
WP_012212130.1|615028_615937_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.1	9.2e-27
WP_003627134.1|616227_618162_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.4	1.6e-97
WP_003627133.1|618319_618841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023192349.1|618992_619523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627960.1|619713_620322_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_101812622.1|620351_621677_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.0	8.1e-56
WP_012212124.1|622860_623154_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003627127.1|623160_624411_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_080543081.1|626386_626920_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.8	5.2e-14
WP_003627120.1|626941_627142_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003627118.1|627185_627542_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003627115.1|627687_628212_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_003627114.1|628204_629314_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_003627113.1|629324_629981_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003627112.1|629961_630555_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003627111.1|630576_630924_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_012212118.1|630929_632081_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_023191246.1|632082_632637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627105.1|632799_633516_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.1	1.8e-25
WP_072748850.1|633502_635062_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
635070:635114	attL	AGGCTCTTTGTCAAATCCTGTTGATAGAGAGTAAATGAATAGAAT	NA	NA	NA	NA
WP_014563241.1|635164_636529_+	SlpX	NA	NA	NA	NA	NA
WP_014563242.1|636622_637000_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	42.2	2.9e-11
WP_101812851.1|637148_638459_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.5	8.6e-10
637105:637149	attR	AGGCTCTTTGTCAAATCCTGTTGATAGAGAGTAAATGAATAGAAT	NA	NA	NA	NA
WP_101812624.1|638541_639720_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
WP_072748852.1|639981_640470_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_023190783.1|640517_641486_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_014563247.1|641532_641805_-	acylphosphatase	NA	NA	NA	NA	NA
WP_012212113.1|641902_642670_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_012212112.1|642781_643132_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012212111.1|643416_644466_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	5.3e-34
WP_101812625.1|644469_646884_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012212109.1|646960_647437_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_012212108.1|647499_648414_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_035513757.1|648601_648943_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003627088.1|648911_649208_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023190294.1|650745_651669_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_012212106.1|651776_654368_-	YfhO family protein	NA	NA	NA	NA	NA
WP_023190296.1|654458_656567_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003548272.1|656643_656793_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003627079.1|656841_657402_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_012212104.1|657422_658103_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012212103.1|658103_658331_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_012212102.1|658389_658791_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_012212101.1|658869_659790_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003627067.1|661550_662888_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_012212100.1|663999_664905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190867.1|665005_666019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627059.1|667595_668588_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	5.3e-52
WP_012212098.1|668692_669649_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_012212097.1|669632_671519_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.5	3.1e-93
WP_012212095.1|672718_673726_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_101812852.1|676036_677956_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012212092.1|679185_680421_-|transposase	IS3-like element ISLhe6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.9	2.2e-55
WP_012212090.1|681888_683034_+	MFS transporter	NA	NA	NA	NA	NA
WP_012212089.1|684188_685850_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_003627031.1|685860_686349_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.1	4.8e-22
WP_101812853.1|686359_687478_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_012212087.1|687675_688392_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	39.1	9.7e-40
WP_003627027.1|688391_688643_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003627026.1|688642_689314_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012212086.1|689310_691542_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	38.9	7.8e-144
WP_095662284.1|691499_692951_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	5.3e-61
WP_003627023.1|692982_694032_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	43.9	9.2e-63
WP_023191126.1|694028_696164_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.6	2.5e-75
WP_003627020.1|696176_697433_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_012211358.1|697520_698699_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812626.1|699011_700289_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.8e-12
WP_101812627.1|701813_702653_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003627726.1|702683_703640_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072748863.1|703629_704793_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012212079.1|704773_706318_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.9	5.2e-14
WP_003627723.1|706386_707472_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	49.3	5.2e-77
WP_101812628.1|708306_709896_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	1.5e-11
WP_110549469.1|710151_710238_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_003627719.1|712219_713449_+	MFS transporter	NA	NA	NA	NA	NA
WP_012212078.1|713521_715396_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_003627712.1|717546_718095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158298623.1|719350_719488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|719640_720819_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212074.1|721271_722438_+	galactokinase	NA	NA	NA	NA	NA
WP_101812629.1|722459_723923_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_012212072.1|724043_725039_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_065866524.1|725159_725600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812630.1|725708_726536_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012212071.1|728399_729572_+	MFS transporter	NA	NA	NA	NA	NA
WP_003629414.1|729590_729998_+	OsmC family protein	NA	NA	NA	NA	NA
WP_012212070.1|730017_730722_+	oxidoreductase	NA	NA	NA	NA	NA
WP_101812631.1|731695_732973_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	2.9e-10
>prophage 8
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	737865	773917	2191149	transposase	Bacillus_virus(33.33%)	28	NA	NA
WP_012211358.1|737865_739044_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_060471342.1|739266_739686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|739916_741095_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023191206.1|741133_741343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812632.1|744801_745209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035514433.1|748493_748820_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_012212056.1|748821_749706_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_012212055.1|749720_750383_-	serine dehydratase	NA	NA	NA	NA	NA
WP_023191368.1|750915_751212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812633.1|751352_752402_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.3	4.6e-46
WP_096001377.1|752606_753776_+	MFS transporter	NA	NA	NA	NA	NA
WP_146211640.1|754024_754240_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627890.1|754312_754660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627889.1|754699_755209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014918530.1|755557_757303_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004561246.1|757401_757569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014918531.1|757956_758190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627894.1|758342_759002_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014563318.1|758982_759657_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_020829309.1|759666_760407_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-25
WP_003627897.1|760419_761280_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_035509557.1|761326_761623_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_158648829.1|762520_765802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627960.1|767347_767956_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_101812622.1|767985_769311_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.0	8.1e-56
WP_023192018.1|769682_770915_+	MFS transporter	NA	NA	NA	NA	NA
WP_101812635.1|771190_772420_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.1	1.2e-64
WP_101812636.1|772657_773917_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.1	2.4e-09
>prophage 9
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	857809	921517	2191149	protease,tRNA,transposase	Streptococcus_phage(11.11%)	54	NA	NA
WP_080516431.1|857809_858766_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.2e-26
WP_003627552.1|858880_859222_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003627550.1|859226_860657_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003627549.1|860748_861021_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003629074.1|861089_861605_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003627547.1|861594_862314_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003629071.1|862426_862774_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_012212015.1|863162_863822_+	uracil-DNA glycosylase	NA	A0A218MKQ4	uncultured_virus	30.9	2.8e-09
WP_012212014.1|863814_864600_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_012212013.1|864628_865255_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
WP_003627541.1|865405_865669_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_012212011.1|865731_865950_+	YneF family protein	NA	NA	NA	NA	NA
WP_012212010.1|866110_867388_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.7	4.5e-11
WP_023190303.1|867662_869606_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.2	3.6e-60
WP_012212008.1|869663_870845_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.1	4.7e-47
WP_003627532.1|870904_871519_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_023190304.1|871584_872616_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_023190305.1|872777_873551_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_023190306.1|873584_874610_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_014563421.1|874748_875474_+	UMP kinase	NA	NA	NA	NA	NA
WP_023190307.1|875473_876031_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_023190308.1|876033_876768_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.7	5.0e-23
WP_003629019.1|876769_877585_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_012212006.1|877595_878852_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_012212005.1|878894_880592_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012212004.1|880597_884914_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	34.1	1.2e-18
WP_012212003.1|885023_885500_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_012212002.1|885519_886701_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_012212001.1|886709_887006_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003627514.1|887008_887320_+	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
WP_012212000.1|887324_889937_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	9.7e-21
WP_012211999.1|889956_890322_+	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_012211998.1|890373_891267_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_023190312.1|891287_892235_+	riboflavin biosynthesis protein RibF	NA	A0A1V0SD03	Indivirus	30.1	6.0e-05
WP_101812657.1|892404_893454_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_023190314.1|893469_894069_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_012211996.1|894086_895913_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	1.8e-143
WP_012211995.1|895994_897149_+	molecular chaperone DnaJ	NA	A0A167RAM8	Powai_lake_megavirus	29.0	1.4e-19
WP_158298622.1|898022_898199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211994.1|898592_900431_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	4.0e-21
WP_003627502.1|900433_901123_+	class A sortase	NA	NA	NA	NA	NA
WP_012211993.1|901243_903517_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.9	3.7e-77
WP_003628968.1|903621_904149_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012211992.1|904292_905222_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.5	2.2e-100
WP_012211991.1|905237_906032_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_012211989.1|907785_908286_+	putative lactocepin s-layer protein	NA	NA	NA	NA	NA
WP_012211988.1|908353_910627_-	HAD-IC family P-type ATPase	NA	A7IUR5	Paramecium_bursaria_Chlorella_virus	25.3	1.6e-43
WP_012211987.1|910755_911610_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158648813.1|912684_913875_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.2	1.3e-124
WP_014918653.1|916334_916871_+	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_101812659.1|917120_918299_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211984.1|918370_919537_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003627474.1|919716_920322_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_003628928.1|920488_921517_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.6	4.1e-47
>prophage 10
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	982445	1045481	2191149	integrase,transposase	Bacillus_virus(14.29%)	53	993006:993022	1059404:1059420
WP_101812565.1|982445_983852_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003627403.1|983993_984410_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211936.1|984485_985367_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.9	4.4e-10
WP_023190414.1|985569_986652_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_012211934.1|987166_987622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211933.1|987628_988120_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	36.1	5.0e-19
WP_099046778.1|988165_988783_-	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	44.2	1.9e-39
WP_012211358.1|989102_990281_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023190406.1|992453_992807_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211926.1|992837_993422_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	44.6	8.2e-29
993006:993022	attL	AATAATTTCTTTAGGAT	NA	NA	NA	NA
WP_012211925.1|993506_994442_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_023190405.1|994496_995459_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003626277.1|995609_998066_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.3	3.0e-96
WP_023190404.1|998082_1000029_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.0	2.7e-116
WP_003626280.1|1000125_1000752_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003626288.1|1002402_1002870_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_023190402.1|1002958_1003477_-	acetyltransferase	NA	NA	NA	NA	NA
WP_023190401.1|1003690_1004551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190398.1|1005287_1005878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190395.1|1006547_1006787_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_012211920.1|1006942_1007701_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_049751273.1|1009190_1009658_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023190390.1|1009721_1011062_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023190388.1|1011359_1011638_+	Na+/H+ antiporter family protein	NA	NA	NA	NA	NA
WP_012211917.1|1011894_1012515_-|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	36.4	7.4e-20
WP_012211916.1|1012630_1013269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626323.1|1013580_1014081_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	45.4	1.6e-33
WP_023190387.1|1014192_1015224_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	39.2	1.8e-34
WP_003613446.1|1016043_1016904_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003628728.1|1016915_1017656_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	4.1e-33
WP_003626333.1|1017665_1018340_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_101812665.1|1019207_1019840_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012211914.1|1020214_1020583_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158298621.1|1020780_1020915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211913.1|1021171_1021708_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012211912.1|1021719_1022811_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	23.1	1.4e-05
WP_023190383.1|1022800_1024138_-	tetrahydrofolate synthase	NA	NA	NA	NA	NA
WP_012211910.1|1024121_1025195_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	42.3	4.7e-38
WP_003614991.1|1025191_1025542_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_012211909.1|1026843_1027497_+	endonuclease III	NA	NA	NA	NA	NA
WP_012211908.1|1027668_1029381_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	3.0e-87
WP_003628700.1|1029366_1029642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211907.1|1029819_1030257_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035513345.1|1030258_1030672_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_012211905.1|1030707_1031205_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035513343.1|1032758_1032971_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012211903.1|1033006_1035745_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_101812666.1|1036727_1037639_-	serine hydrolase	NA	NA	NA	NA	NA
WP_023190346.1|1037938_1039342_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_101812667.1|1040697_1042077_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_023190890.1|1042459_1042795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211898.1|1043823_1044063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158648814.1|1044251_1045481_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.7	1.2e-125
1059404:1059420	attR	ATCCTAAAGAAATTATT	NA	NA	NA	NA
>prophage 11
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1072863	1131831	2191149	transposase	Streptococcus_phage(30.0%)	54	NA	NA
WP_101812671.1|1072863_1074042_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812672.1|1074207_1077933_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_101812673.1|1077942_1078542_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_101812674.1|1078541_1079147_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_101812675.1|1079264_1081232_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_101812676.1|1081441_1081843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014918813.1|1081975_1082728_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_014563598.1|1082855_1083485_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014563599.1|1083503_1084055_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_014563600.1|1084054_1084285_-	copper-binding protein	NA	NA	NA	NA	NA
WP_023061400.1|1084307_1086209_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.5	6.1e-89
WP_014918818.1|1087110_1088475_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	22.6	3.4e-09
WP_006351716.1|1088606_1088993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812677.1|1089065_1089998_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_012211358.1|1090101_1091280_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812678.1|1091461_1091920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126963166.1|1092495_1093020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079227780.1|1092949_1093147_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_101812679.1|1093451_1093835_-	virulence protein	NA	NA	NA	NA	NA
WP_101812680.1|1093864_1094233_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003626428.1|1094232_1094802_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_041810715.1|1094962_1095400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211874.1|1095548_1097129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1097370_1098549_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211873.1|1099332_1099785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211872.1|1099996_1100713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211871.1|1100712_1101447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211870.1|1101450_1102212_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.7	1.1e-22
WP_041810713.1|1102223_1102697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041809518.1|1102711_1102960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812682.1|1102952_1104557_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.4	5.1e-12
WP_023191193.1|1104531_1104819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812683.1|1108134_1109250_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211868.1|1109554_1111069_-	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	23.7	3.5e-23
WP_101812684.1|1111383_1111611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211867.1|1111657_1113517_-	hypothetical protein	NA	F2Y1C6	Organic_Lake_phycodnavirus	32.1	1.5e-07
WP_003626445.1|1113728_1114157_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_003628533.1|1114153_1114588_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023061886.1|1114772_1115360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061888.1|1115650_1115908_-	DUF3923 family protein	NA	NA	NA	NA	NA
WP_101812685.1|1115946_1118451_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.0	1.2e-137
WP_014918837.1|1118466_1118979_-	GNAT family N-acetyltransferase	NA	E4ZFP7	Streptococcus_phage	30.2	8.3e-17
WP_003626464.1|1119880_1120180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626469.1|1121581_1121929_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003628521.1|1121928_1122207_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_101812686.1|1122485_1125419_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.6	4.4e-86
WP_101812687.1|1126032_1126524_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_014563645.1|1126633_1126993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626474.1|1127383_1128007_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_020829165.1|1128009_1128771_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_012211860.1|1128786_1129206_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_012211859.1|1129469_1129946_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023191272.1|1130035_1130473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812688.1|1130652_1131831_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.5	1.3e-121
>prophage 12
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1146477	1187006	2191149	integrase,tRNA,transposase,protease	Anomala_cuprea_entomopoxvirus(11.11%)	37	1138497:1138513	1182323:1182339
1138497:1138513	attL	ATTATTCATCAAATTAT	NA	NA	NA	NA
WP_012211358.1|1146477_1147656_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_158648815.1|1147772_1147949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919599.1|1147941_1148658_-	AAA family ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	3.5e-13
WP_101812608.1|1149160_1150339_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003625059.1|1150820_1151111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211245.1|1151295_1152474_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
WP_101812690.1|1152589_1153141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191007.1|1153147_1154029_-	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_003628471.1|1154035_1155133_-	serine hydrolase	NA	NA	NA	NA	NA
WP_023191006.1|1155257_1155872_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_101812691.1|1155973_1156606_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003628456.1|1156834_1157284_-	Trp operon repressor	NA	NA	NA	NA	NA
WP_012211358.1|1157457_1158636_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_041810791.1|1158772_1160545_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.6	3.8e-77
WP_012211842.1|1161602_1162862_-	aluminum resistance protein	NA	NA	NA	NA	NA
WP_012211840.1|1162878_1164975_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_101812692.1|1165177_1166035_-|transposase	IS982-like element ISLhe5 family transposase	transposase	NA	NA	NA	NA
WP_101812693.1|1166850_1168080_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	6.7e-65
WP_101812694.1|1168317_1169577_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.5	1.3e-10
WP_023191050.1|1170159_1170429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628419.1|1170484_1170718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143441508.1|1172715_1173066_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003627958.1|1173105_1173336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627959.1|1173310_1174648_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_101812695.1|1174655_1175117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812696.1|1175159_1175570_+	maturase	NA	NA	NA	NA	NA
WP_012211836.1|1175707_1177294_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.5	7.7e-13
WP_003628411.1|1177294_1177675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211835.1|1177919_1178777_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_003628346.1|1178857_1179235_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_003628344.1|1179236_1179620_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	3.1e-08
WP_012211833.1|1179900_1180716_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_012211831.1|1181782_1182682_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
1182323:1182339	attR	ATTATTCATCAAATTAT	NA	NA	NA	NA
WP_012211830.1|1182834_1184238_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	24.9	5.8e-28
WP_003628338.1|1184248_1184773_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_003626495.1|1184781_1185690_-	tyrosine recombinase	NA	A0A1P8DJJ6	Virus_Rctr41k	25.1	2.3e-14
WP_023191156.1|1185689_1187006_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
>prophage 13
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1224053	1285424	2191149	tRNA,transposase	Lactobacillus_phage(16.67%)	52	NA	NA
WP_101812701.1|1224053_1224851_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012211801.1|1224987_1225350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812702.1|1225363_1225954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812703.1|1225931_1227686_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	1.8e-87
WP_012211799.1|1227982_1228498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211798.1|1229208_1230144_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_023191213.1|1231339_1231936_+	DedA family protein	NA	NA	NA	NA	NA
WP_012211795.1|1232042_1233428_+	amino acid permease	NA	NA	NA	NA	NA
WP_023191208.1|1235376_1236213_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	36.3	1.5e-36
WP_012211793.1|1236384_1237578_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.4	1.7e-41
WP_101812704.1|1238082_1239489_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012211791.1|1239617_1240802_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012211790.1|1240890_1242744_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.4	2.2e-11
WP_012211789.1|1242749_1244036_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.3	1.8e-20
WP_101812705.1|1244343_1244781_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_101812706.1|1244780_1247021_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.0	1.3e-10
WP_079227775.1|1247035_1247485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211786.1|1247453_1248401_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_012211785.1|1248461_1248971_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_003628193.1|1250668_1251175_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_012211784.1|1251277_1252624_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_012211783.1|1252793_1253747_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012211782.1|1253748_1254081_+	hypothetical protein	NA	A0A0P0I7G8	Lactobacillus_phage	43.6	4.4e-19
WP_012211781.1|1254335_1254716_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_012211780.1|1254847_1255405_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012211779.1|1255417_1257127_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	1.3e-18
WP_012211778.1|1257119_1257953_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_023191034.1|1258163_1258619_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_023190293.1|1260003_1260822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211776.1|1261226_1262768_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_012211775.1|1262757_1263672_-	citrate lyase	NA	NA	NA	NA	NA
WP_003628158.1|1263672_1263966_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_012211774.1|1263955_1265008_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_012211772.1|1265098_1265890_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012211771.1|1265969_1267436_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_012211770.1|1267754_1269068_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.3	1.5e-57
WP_101812707.1|1269293_1270553_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.8	4.0e-12
WP_080516421.1|1270811_1272041_+|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.6	1.7e-63
WP_012211767.1|1272320_1272854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812708.1|1272876_1273587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211765.1|1275981_1276908_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_023190708.1|1277222_1277870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190709.1|1277939_1278254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190710.1|1278322_1278568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211763.1|1278564_1279401_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_003626645.1|1279435_1279603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628125.1|1279650_1279953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812709.1|1279939_1280632_-	mucus-binding protein	NA	NA	NA	NA	NA
WP_023190712.1|1280622_1280943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628121.1|1281237_1282614_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.3	5.8e-57
WP_012211762.1|1282625_1284029_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_012211358.1|1284245_1285424_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1298381	1348596	2191149	protease,transposase	Bacillus_virus(40.0%)	34	NA	NA
WP_012211358.1|1298381_1299560_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211752.1|1300835_1301411_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_101812710.1|1301555_1303292_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	2.1e-88
WP_012211750.1|1304332_1305619_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
WP_012211749.1|1306450_1306939_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_101812711.1|1308100_1309483_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_023191145.1|1309482_1310424_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_012211747.1|1310582_1311824_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	9.7e-120
WP_012211746.1|1312574_1313297_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211745.1|1314292_1314997_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	25.5	2.2e-07
WP_065866350.1|1315321_1317025_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
WP_012211742.1|1317147_1318587_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.4	1.5e-95
WP_012211741.1|1318583_1319138_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	42.4	2.1e-34
WP_041810699.1|1320726_1320939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812712.1|1320935_1322213_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	3.1e-12
WP_012211739.1|1322940_1323576_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211738.1|1326260_1327190_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_012211737.1|1327252_1327768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1328270_1329449_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211736.1|1329755_1331366_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_079227764.1|1331410_1331986_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003628084.1|1332042_1333143_-	serine hydrolase	NA	NA	NA	NA	NA
WP_012211734.1|1333246_1334305_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003626723.1|1334316_1335483_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_023190283.1|1335503_1336283_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_012211732.1|1336275_1337211_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_012211731.1|1337212_1338367_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003626729.1|1338369_1339080_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_012211730.1|1339099_1340416_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_065866341.1|1340888_1342262_+	aspartate kinase	NA	NA	NA	NA	NA
WP_012211728.1|1342254_1343259_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_101812713.1|1345040_1346777_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	2.1e-88
WP_012211726.1|1346741_1347332_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_012211725.1|1347321_1348596_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.6	1.7e-132
>prophage 15
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1393584	1448358	2191149	integrase,tRNA,transposase	Lactobacillus_virus(18.18%)	53	1439558:1439580	1445828:1445850
WP_012211358.1|1393584_1394763_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003628051.1|1394963_1395296_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_003627675.1|1395390_1395525_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_012211696.1|1395565_1396105_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012211695.1|1396104_1396956_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_012211694.1|1397001_1398006_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003627679.1|1398101_1398725_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_101812719.1|1398763_1399441_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_012211692.1|1399430_1400705_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012211691.1|1400705_1403345_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.4	4.8e-161
WP_023190380.1|1405766_1407083_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	38.9	1.5e-65
WP_012211688.1|1407353_1408280_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	49.3	1.7e-76
WP_012211687.1|1408276_1408693_-	GtrA family protein	NA	NA	NA	NA	NA
WP_101812855.1|1411888_1412380_+	DUF3232 domain-containing protein	NA	NA	NA	NA	NA
WP_003628028.1|1412560_1412734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211681.1|1412868_1414086_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_012211680.1|1414085_1415246_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	31.7	1.7e-38
WP_012211679.1|1415337_1417047_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_012211358.1|1417169_1418348_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003628026.1|1418709_1419321_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_003626181.1|1419410_1419878_+	YueI family protein	NA	NA	NA	NA	NA
WP_012211678.1|1419877_1421191_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	49.3	6.2e-101
WP_101812565.1|1421329_1422736_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003626176.1|1423097_1423379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626174.1|1423446_1423911_+	universal stress protein	NA	NA	NA	NA	NA
WP_012211677.1|1423976_1425170_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003626171.1|1425191_1425419_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_012211676.1|1425427_1425721_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_012211675.1|1425734_1426724_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_012211674.1|1426807_1427038_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_012211673.1|1427101_1427542_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_003628021.1|1427553_1428993_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_012211672.1|1429015_1429978_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_012211671.1|1429988_1431500_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_012211670.1|1431514_1432063_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_012211669.1|1432062_1432572_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_012211668.1|1432623_1432857_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_012211667.1|1432876_1433590_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_101812721.1|1433713_1434343_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003628018.1|1434426_1435428_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.1	1.2e-48
WP_023190612.1|1435433_1436276_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003626148.1|1436268_1437357_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	1.4e-05
WP_003626146.1|1437373_1437973_-	thymidine kinase	NA	C1KFH3	Lactobacillus_virus	50.8	2.4e-47
WP_023190613.1|1438123_1439476_+	Mur ligase family protein	NA	NA	NA	NA	NA
1439558:1439580	attL	TTACTATTGAGATATTGGGGCTC	NA	NA	NA	NA
WP_020829096.1|1439653_1440811_-|integrase	site-specific integrase	integrase	P97010	Streptococcus_pyogenes_phage	38.2	4.9e-57
WP_101812722.1|1440949_1441537_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101812723.1|1441685_1441886_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101812724.1|1441888_1442113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812725.1|1442115_1442391_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_101812856.1|1442895_1444032_+	hypothetical protein	NA	U3PCP1	Lactobacillus_phage	46.0	1.2e-87
WP_101511660.1|1445132_1445504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211663.1|1446065_1447079_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	26.1	1.2e-06
1445828:1445850	attR	TTACTATTGAGATATTGGGGCTC	NA	NA	NA	NA
WP_012211358.1|1447179_1448358_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1454601	1591782	2191149	protease,tRNA,transposase	Streptococcus_phage(31.03%)	113	NA	NA
WP_158648816.1|1454601_1455792_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	54.9	2.0e-114
WP_012211657.1|1455884_1457342_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.8	3.6e-33
WP_012211656.1|1457341_1458064_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.6e-37
WP_014563890.1|1458063_1458456_-	SdpI family protein	NA	NA	NA	NA	NA
WP_012211655.1|1458490_1459456_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_012211653.1|1462098_1463283_-	acetate kinase	NA	NA	NA	NA	NA
WP_012211652.1|1463331_1464333_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023190563.1|1464502_1465003_-	ComGF family competence protein	NA	NA	NA	NA	NA
WP_023190562.1|1465010_1465280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626115.1|1465276_1465708_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_023190561.1|1465676_1466027_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_035513498.1|1466037_1467039_-	type II secretion system protein F	NA	NA	NA	NA	NA
WP_023190559.1|1467007_1467982_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_003626106.1|1468130_1468859_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023190558.1|1468949_1469465_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003626102.1|1469559_1469745_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_158648817.1|1469843_1471028_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.1	1.8e-123
WP_020829089.1|1472807_1473764_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_020829088.1|1475438_1477460_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_072749025.1|1478642_1479797_+	glycerate kinase	NA	NA	NA	NA	NA
WP_003633503.1|1479801_1480269_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_012211358.1|1480825_1482004_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_072749027.1|1482382_1483198_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_101812728.1|1483207_1484023_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_065866305.1|1484117_1485470_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_023190581.1|1485500_1486460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003633493.1|1486456_1487299_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_012211640.1|1487356_1488430_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_072749029.1|1488426_1489242_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012211639.1|1489238_1490051_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012211638.1|1490040_1491138_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.1	2.5e-34
WP_012211637.1|1491203_1492100_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_012211636.1|1492197_1492731_+	exonuclease	NA	M1PFD8	Streptococcus_phage	36.6	6.8e-22
WP_012211635.1|1492737_1493238_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_023190579.1|1493237_1494227_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_012211633.1|1494238_1494937_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	43.0	2.7e-42
WP_023190578.1|1495005_1495887_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012211631.1|1495893_1496415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211630.1|1496745_1497504_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_023190577.1|1497529_1498741_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_101812729.1|1498853_1499870_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_012211627.1|1499925_1500957_-	central glycolytic genes regulator	NA	NA	NA	NA	NA
WP_065866300.1|1505769_1506585_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_012211626.1|1506639_1508265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211625.1|1508451_1509036_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	3.7e-53
WP_012211624.1|1509087_1510023_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.2	1.4e-46
WP_012211623.1|1510015_1511059_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	50.2	2.4e-87
WP_101812730.1|1511069_1511945_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.2e-07
WP_012211621.1|1512033_1512576_-	membrane protein	NA	NA	NA	NA	NA
WP_072749032.1|1512640_1515481_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	1.7e-305
WP_072749033.1|1515470_1517519_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_012211618.1|1517621_1519346_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	46.0	2.6e-147
WP_012211617.1|1519446_1519899_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_101812731.1|1520078_1521302_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.5	3.5e-122
WP_012211358.1|1521650_1522829_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812732.1|1523067_1524327_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.8	8.9e-12
WP_101812733.1|1524564_1525740_+|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	37.9	4.6e-55
WP_101812734.1|1525824_1527003_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003626023.1|1527488_1528508_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_101812735.1|1528549_1529392_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_012211614.1|1529381_1530350_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_012211613.1|1530366_1530645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101511653.1|1530652_1531769_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_012211612.1|1531836_1534236_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_012211611.1|1534375_1534921_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_012211610.1|1535001_1535697_-	ComF family protein	NA	NA	NA	NA	NA
WP_012211609.1|1535693_1536980_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	43.8	2.9e-82
WP_012211608.1|1537024_1537687_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.8	3.4e-39
WP_101812736.1|1537713_1538871_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_012211606.1|1538978_1540610_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_012211605.1|1540729_1541827_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.8	7.2e-119
WP_012211604.1|1542010_1542571_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012211603.1|1542593_1543712_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003633413.1|1543779_1544508_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003625998.1|1544508_1545765_-	insulinase family protein	NA	A0A2P1EIE5	Megavirus	28.1	1.0e-12
WP_101812737.1|1545761_1546994_-	insulinase family protein	NA	NA	NA	NA	NA
WP_012211601.1|1546962_1549380_-	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	48.0	1.7e-83
WP_003625992.1|1549400_1549790_-	DUF1149 family protein	NA	NA	NA	NA	NA
WP_003625990.1|1549789_1550350_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_012211600.1|1550400_1551600_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012211599.1|1552068_1554825_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.6	1.1e-75
WP_101812738.1|1554977_1556006_+	lactonase family protein	NA	NA	NA	NA	NA
WP_012211597.1|1556112_1556805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211596.1|1558725_1559622_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.5	2.3e-06
WP_012211595.1|1559605_1560418_-	NAD kinase	NA	NA	NA	NA	NA
WP_003627775.1|1560414_1561047_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003633400.1|1561170_1561785_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_012211594.1|1561863_1562481_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101812739.1|1562489_1563353_-	competence protein	NA	NA	NA	NA	NA
WP_012211592.1|1563415_1564156_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_012211591.1|1564247_1564646_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_012211590.1|1564877_1566611_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_012211589.1|1566610_1566877_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003627783.1|1566989_1567184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065866883.1|1567461_1568868_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012211586.1|1569806_1571996_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	40.5	8.8e-124
WP_012211585.1|1572147_1572429_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_003627787.1|1572496_1574068_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.2	5.5e-35
WP_072749037.1|1574067_1574940_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003627789.1|1575047_1575509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627790.1|1575510_1575993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829071.1|1576003_1576819_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003627793.1|1576940_1578323_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.2	3.9e-69
WP_003627794.1|1579034_1579619_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012211582.1|1579667_1580123_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627796.1|1580126_1580396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812740.1|1580749_1581838_+|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	38.5	4.9e-51
WP_143441508.1|1582072_1582423_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003627958.1|1582462_1582693_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627959.1|1582667_1584005_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_003626750.1|1584597_1587462_-	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	27.0	1.9e-33
WP_012211245.1|1587878_1589057_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
WP_012211358.1|1590603_1591782_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1596006	1654672	2191149	protease,bacteriocin,transposase	Lactobacillus_virus(23.08%)	45	NA	NA
WP_023192390.1|1596006_1597335_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	41.3	2.7e-59
WP_003626768.1|1597399_1598299_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.1	6.4e-73
WP_012211577.1|1598360_1599284_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003633294.1|1599292_1600120_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003626773.1|1600263_1600710_+	flavodoxin	NA	NA	NA	NA	NA
WP_003626776.1|1600702_1601242_+	GtrA family protein	NA	NA	NA	NA	NA
WP_003633292.1|1601265_1602408_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.3	5.5e-29
WP_023192258.1|1602515_1602704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003633289.1|1602871_1604200_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003633288.1|1604196_1605429_-	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.5	1.2e-34
WP_020829052.1|1605428_1606133_-	lysozyme	NA	NA	NA	NA	NA
WP_023190478.1|1607473_1608043_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	27.6	4.9e-10
WP_012211571.1|1608149_1609511_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003633284.1|1610325_1610583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812624.1|1610777_1611956_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
WP_101812741.1|1613451_1614117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101511644.1|1614389_1615688_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_041806183.1|1617476_1618667_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.2	5.6e-125
WP_023192373.1|1619402_1619957_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003631137.1|1619997_1620846_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_158648818.1|1623157_1623400_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_023192377.1|1623451_1624240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812742.1|1624402_1625251_-	patatin family protein	NA	NA	NA	NA	NA
WP_003633240.1|1625318_1627718_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_020829049.1|1628784_1629150_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003626804.1|1629236_1629560_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003626806.1|1629559_1630963_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003626807.1|1630955_1631417_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_003626808.1|1631403_1632642_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	1.0e-97
WP_003626809.1|1632616_1633894_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003626810.1|1633905_1634700_-	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.6	7.3e-12
WP_003633232.1|1635821_1636640_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003633228.1|1636704_1637028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158648819.1|1637147_1638338_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	56.7	4.2e-120
WP_003626821.1|1639429_1640356_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_101812744.1|1640472_1642488_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.6	5.0e-65
WP_012211245.1|1642597_1643776_-|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
WP_095662215.1|1643926_1644619_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003633198.1|1644618_1645545_-	ribokinase	NA	A0A2H4N7X4	Lake_Baikal_phage	37.5	6.3e-07
WP_003626825.1|1645628_1646432_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_003633177.1|1648194_1648464_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003626829.1|1648482_1649826_+	PFL family protein	NA	NA	NA	NA	NA
WP_012211547.1|1649974_1651276_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_101812745.1|1651474_1652752_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	3.4e-11
WP_158648621.1|1653448_1654672_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.3	3.0e-121
>prophage 18
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1684192	1754188	2191149	holin,tRNA,transposase	Lactococcus_phage(17.65%)	55	NA	NA
WP_041806186.1|1684192_1685599_+|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_012211526.1|1685816_1686017_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	1.4e-20
WP_101812704.1|1687192_1688599_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003626890.1|1689087_1690440_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.2	1.9e-116
WP_012211522.1|1690804_1692181_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_012211358.1|1692779_1693958_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003626896.1|1694121_1694826_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012211521.1|1694869_1695562_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_012211520.1|1695628_1696549_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.8	2.1e-18
WP_101812753.1|1696573_1698004_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_101812754.1|1698008_1699448_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003633051.1|1699447_1699756_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_020829042.1|1699769_1700918_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_012211516.1|1700930_1702937_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	7.1e-104
WP_012211515.1|1702977_1705224_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.3	6.9e-132
WP_023190274.1|1705309_1705957_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	47.7	1.0e-27
WP_012211513.1|1706194_1706665_-	SprT family protein	NA	NA	NA	NA	NA
WP_012211512.1|1706652_1707351_-	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	26.5	9.6e-08
WP_012211511.1|1707353_1708784_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_012211510.1|1708788_1709943_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_101812755.1|1712955_1714197_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.0	9.1e-118
WP_012211508.1|1714392_1715223_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.4	5.7e-68
WP_101812756.1|1715219_1716698_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.9	1.1e-114
WP_023191091.1|1716785_1717886_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_101812757.1|1717893_1718622_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003633007.1|1719946_1720333_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A0F7LBI5	uncultured_marine_virus	47.2	7.1e-13
WP_003633005.1|1720396_1721098_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211504.1|1721186_1722302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211503.1|1722691_1723243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191336.1|1723361_1723517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211501.1|1726590_1727286_-	glycerophosphoryl diester phosphodiesterase	NA	M1ICP4	Paramecium_bursaria_Chlorella_virus	25.8	1.8e-14
WP_101812759.1|1727337_1728555_-	phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	37.9	8.3e-15
WP_012211499.1|1728555_1729134_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.1	3.3e-22
WP_041810784.1|1729203_1730262_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_012211497.1|1730399_1731095_-	hypothetical protein	NA	A0A249XZV3	Enterococcus_phage	50.0	3.2e-11
WP_003632978.1|1731477_1731594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211496.1|1732794_1733187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564083.1|1733288_1733498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003632976.1|1733596_1733995_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_101812760.1|1734148_1735900_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	1.8e-87
WP_012211494.1|1736106_1737348_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.5	9.7e-120
WP_012211493.1|1737622_1738777_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003626963.1|1738793_1739507_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012212050.1|1740519_1741926_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012211491.1|1742107_1742965_+|transposase	IS982-like element ISLhe7 family transposase	transposase	NA	NA	NA	NA
WP_023191358.1|1744001_1744751_+	TIGR02452 family protein	NA	NA	NA	NA	NA
WP_003626968.1|1744768_1745140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626977.1|1748514_1748928_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003632732.1|1749088_1749316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812761.1|1750237_1751422_-	acetate kinase	NA	NA	NA	NA	NA
WP_041810783.1|1751753_1752236_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_012211488.1|1752319_1752856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211487.1|1752809_1753277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211486.1|1753258_1753861_+	amino acid permease	NA	NA	NA	NA	NA
WP_080516411.1|1754074_1754188_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 19
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1798676	1853812	2191149	protease,transposase	Enterobacteria_phage(25.0%)	41	NA	NA
WP_101812765.1|1798676_1799918_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	56.7	2.0e-117
WP_012212211.1|1800098_1800506_-	DUF3290 domain-containing protein	NA	NA	NA	NA	NA
WP_012212212.1|1800593_1801334_-	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	83.1	6.8e-121
WP_012212213.1|1802183_1803788_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.3	1.3e-15
WP_101812565.1|1803959_1805366_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012212214.1|1805515_1806430_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_012212215.1|1806519_1807521_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_012212216.1|1807568_1808072_+	nucleoside deoxyribosyltransferase	NA	C1KFI2	Lactobacillus_virus	31.2	1.2e-12
WP_080516438.1|1808471_1808891_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012212217.1|1809074_1810376_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_012212218.1|1810428_1811001_-	elongation factor P	NA	NA	NA	NA	NA
WP_012212219.1|1811035_1811950_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.2	3.6e-31
WP_012212220.1|1812008_1812569_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_012212221.1|1814115_1816422_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_023191160.1|1816571_1817258_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003627817.1|1817319_1817970_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_023191139.1|1818186_1819986_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_012212224.1|1819998_1820748_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	3.7e-34
WP_101812766.1|1820894_1822166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212226.1|1822254_1822926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212227.1|1823349_1824354_-	asparaginase	NA	NA	NA	NA	NA
WP_023191135.1|1825235_1825604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095662341.1|1825669_1825945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212228.1|1826417_1826924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812858.1|1826940_1827336_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023190817.1|1828116_1828992_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	1.2e-76
WP_097550426.1|1829156_1831262_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_012212233.1|1831486_1832938_+	APC family permease	NA	NA	NA	NA	NA
WP_023061007.1|1834895_1836194_-	MFS transporter	NA	NA	NA	NA	NA
WP_012211358.1|1839406_1840585_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812767.1|1841053_1842040_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	37.8	1.3e-29
WP_101812768.1|1842056_1842665_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.3	2.5e-44
WP_101812769.1|1842686_1843571_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.5	4.7e-92
WP_101812770.1|1843575_1844613_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	47.1	3.4e-86
WP_101812771.1|1845124_1846297_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_101812772.1|1846324_1847458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812773.1|1847687_1849241_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	27.4	3.4e-29
WP_012211358.1|1849669_1850848_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_158648820.1|1850969_1851209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812774.1|1851646_1852387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812734.1|1852633_1853812_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1858124	1921976	2191149	transposase	Streptococcus_phage(15.38%)	54	NA	NA
WP_012211358.1|1858124_1859303_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812778.1|1859424_1859862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812779.1|1861470_1862937_-	flippase	NA	NA	NA	NA	NA
WP_101812780.1|1862960_1863926_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101812781.1|1865505_1866411_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101812859.1|1866413_1867523_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	73.4	1.3e-163
WP_101812782.1|1867738_1868788_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.6	5.4e-47
WP_101812860.1|1869149_1870133_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_158648822.1|1871367_1871940_-	hypothetical protein	NA	A0A1V0SD50	Indivirus	35.3	6.6e-07
WP_101812784.1|1871932_1873216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812785.1|1873230_1874007_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_101812786.1|1874027_1875107_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101812787.1|1875106_1875604_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101812788.1|1875603_1876053_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_101812861.1|1876068_1876719_-	sugar transferase	NA	NA	NA	NA	NA
WP_101812789.1|1876838_1877609_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_101812790.1|1877608_1878403_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_101812791.1|1878413_1879298_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_023190764.1|1879309_1880371_-	exopolysaccharide biosynthesis protein	NA	A0A1X9I5X1	Streptococcus_phage	31.1	1.1e-15
WP_101812792.1|1880845_1882111_+	GTPase HflX	NA	NA	NA	NA	NA
WP_101812793.1|1882132_1883143_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_101812794.1|1883353_1884286_-	hydrolase	NA	M9MUG9	Rhodococcus_phage	36.9	5.9e-13
WP_101812795.1|1885289_1886396_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_101812796.1|1886799_1887081_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_010620892.1|1887127_1887313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812797.1|1887389_1887668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002819869.1|1887690_1887900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812798.1|1888170_1890231_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_101812799.1|1890360_1890936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812800.1|1891065_1891779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812801.1|1891771_1893247_-	PglZ domain-containing protein	NA	NA	NA	NA	NA
WP_101812802.1|1893249_1895925_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	26.0	1.1e-40
WP_101812803.1|1895960_1898507_-	DNA methylase	NA	NA	NA	NA	NA
WP_101812862.1|1898511_1901337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812804.1|1902216_1902636_-	BREX-3 system P-loop-containing protein BrxF	NA	NA	NA	NA	NA
WP_101812805.1|1902767_1903555_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_057138772.1|1903986_1904481_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_101812806.1|1904813_1905131_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_101812807.1|1905409_1906294_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_063487919.1|1906459_1907017_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.1	6.9e-33
WP_087510982.1|1907210_1907912_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_158648823.1|1908090_1908933_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.2	1.1e-154
WP_002816285.1|1908986_1909238_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_010010267.1|1909698_1910505_+	ParA family protein	NA	A0A1V0DZZ0	Clostridioides_phage	30.1	2.3e-21
WP_002825834.1|1910518_1910767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014919425.1|1913492_1914836_-	PFL family protein	NA	NA	NA	NA	NA
WP_014919426.1|1914848_1915118_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_014919428.1|1916155_1916932_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	47.2	1.3e-18
WP_035509074.1|1917149_1917512_-	ATPase	NA	NA	NA	NA	NA
WP_051356298.1|1917848_1919432_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_014919431.1|1919364_1920015_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	45.2	5.2e-40
WP_128888834.1|1920080_1920386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158648824.1|1920448_1920601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158648825.1|1920752_1921976_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.8	9.2e-123
>prophage 21
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1926606	1975585	2191149	bacteriocin,transposase	Lactobacillus_phage(18.75%)	49	NA	NA
WP_158648826.1|1926606_1927797_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.7	2.8e-124
WP_012212257.1|1928112_1928460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812811.1|1928572_1929109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812812.1|1929348_1930590_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.0	8.2e-119
WP_101812813.1|1930736_1931453_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_020828971.1|1931658_1932144_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_003630150.1|1932146_1932917_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_012212262.1|1932927_1934469_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.0	3.7e-44
WP_023190894.1|1934477_1934855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812814.1|1935019_1935544_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101812815.1|1935703_1936945_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	1.4e-118
WP_101812816.1|1936959_1937676_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_101812817.1|1937744_1938986_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101812818.1|1939157_1940954_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_080516441.1|1941241_1941535_+	Fic family protein	NA	NA	NA	NA	NA
WP_023190802.1|1942452_1943829_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_101812819.1|1944266_1945061_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_101812820.1|1945060_1945708_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	9.8e-15
WP_065866776.1|1945739_1946717_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_003630183.1|1946979_1947252_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012212270.1|1949474_1950389_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_041810005.1|1950388_1951144_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	5.0e-18
WP_003630190.1|1951503_1951671_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_012212272.1|1951651_1951960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919460.1|1952230_1952422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630196.1|1952721_1952943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919462.1|1952932_1953160_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041810756.1|1953307_1953631_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_012212275.1|1955362_1956112_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_101812821.1|1956120_1957692_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_101812822.1|1957742_1958891_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.7	2.0e-18
WP_101812823.1|1958894_1959581_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.3e-36
WP_012212278.1|1959760_1961620_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.2	4.8e-46
WP_101812824.1|1961629_1963354_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	2.2e-37
WP_012212281.1|1963467_1964250_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_003627361.1|1964258_1965359_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_003627362.1|1965417_1965681_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_012212282.1|1965673_1966558_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.7	1.9e-16
WP_003627364.1|1966535_1967315_-	ParA family protein	NA	Q8JL10	Natrialba_phage	31.5	4.3e-25
WP_012212283.1|1967330_1968170_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	44.0	2.7e-17
WP_012212284.1|1968184_1968907_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_012212285.1|1969068_1969605_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003627368.1|1969646_1970576_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_012212286.1|1970584_1971376_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003627370.1|1971468_1972017_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	38.8	1.1e-27
WP_023190786.1|1972030_1972570_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023190785.1|1972712_1973336_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012212288.1|1973620_1974946_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	2.1e-56
WP_101812825.1|1974979_1975585_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
>prophage 22
NZ_CP015498	Lactobacillus helveticus strain FAM22155 chromosome, complete genome	2191149	1987756	2064318	2191149	transposase	Lactococcus_phage(15.38%)	54	NA	NA
WP_012211358.1|1987756_1988935_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003627391.1|1989122_1989482_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
WP_012212298.1|1989545_1990526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212299.1|1990675_1991923_+	MFS transporter	NA	NA	NA	NA	NA
WP_158648827.1|1992054_1993236_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	54.6	1.1e-112
WP_013853819.1|1995788_1997303_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	24.2	3.5e-23
WP_101812828.1|1998275_1999703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|2000543_2001722_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212301.1|2001956_2003534_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	34.0	8.8e-25
WP_012212302.1|2005092_2006802_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.6	3.9e-87
WP_101812829.1|2006798_2008967_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.6	1.1e-171
WP_012211358.1|2009030_2010209_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812830.1|2010330_2010762_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	8.8e-12
WP_023190550.1|2010745_2011753_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	2.7e-96
WP_041806223.1|2012096_2013275_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812864.1|2013395_2013749_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003630326.1|2014056_2014614_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_003627923.1|2014579_2015764_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_012212307.1|2015785_2016697_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.7	2.8e-60
WP_035514011.1|2017972_2018191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|2019010_2020189_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_080516448.1|2020734_2021037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812653.1|2021217_2022624_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012212313.1|2023129_2023603_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003625266.1|2023756_2026042_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_080668919.1|2026019_2026925_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_101812865.1|2027297_2028374_+	guanine permease	NA	NA	NA	NA	NA
WP_014564291.1|2028376_2028934_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003625260.1|2030495_2031038_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_012212316.1|2031111_2032101_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_012212317.1|2032148_2032907_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_012212318.1|2032966_2033737_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_003630373.1|2033729_2034572_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_012212319.1|2034552_2035932_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003625250.1|2035945_2036362_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_012212320.1|2036366_2036837_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_012212321.1|2036840_2038070_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_012212322.1|2038091_2038823_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	2.1e-13
WP_012212323.1|2038822_2039740_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_003625239.1|2039749_2039992_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_101812831.1|2040050_2041034_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003625235.1|2041030_2041498_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625233.1|2041527_2041974_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002831196.1|2043697_2043946_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_012212126.1|2045871_2046480_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
WP_020828941.1|2049044_2049932_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003625209.1|2052215_2054483_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	2.4e-60
WP_012212328.1|2054947_2055466_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_012212329.1|2055809_2057036_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.3	1.8e-38
WP_023191345.1|2057093_2057417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630431.1|2057673_2058423_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_003630433.1|2058851_2059898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812833.1|2059985_2062460_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_101812834.1|2062923_2064318_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
