The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	10451	129000	2209387	protease,transposase	Streptococcus_phage(21.43%)	93	NA	NA
WP_012211199.1|10451_11705_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.1	2.0e-08
WP_003624897.1|12374_13967_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	32.2	4.9e-15
WP_041810667.1|15604_15799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211200.1|16234_16843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211201.1|16950_18972_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_012211202.1|18983_19439_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_012211203.1|19469_20864_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.1	3.2e-119
WP_012211358.1|21071_22250_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211204.1|22480_23410_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012211205.1|23526_24804_-|transposase	ISL3-like element ISLhe2 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	1.4e-12
WP_101853673.1|24894_26172_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
WP_003624871.1|26440_27370_+	DegV family protein	NA	NA	NA	NA	NA
WP_035514160.1|27499_28351_+	ROK family protein	NA	NA	NA	NA	NA
WP_003631748.1|28502_28673_+	CsbD family protein	NA	NA	NA	NA	NA
WP_023191122.1|28723_28984_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_012211208.1|29044_30274_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_101853674.1|30357_31062_-	methyltransferase	NA	G3MA03	Bacillus_virus	44.4	1.6e-18
WP_101812558.1|31614_32901_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.3	1.7e-106
WP_014562792.1|33158_33512_-	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
WP_072749171.1|33508_33709_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065866708.1|33876_34515_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	31.8	7.6e-20
WP_014562795.1|34511_35270_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_065866706.1|37982_38570_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211214.1|38673_39975_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_035509017.1|41635_43036_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_101853675.1|43132_43906_+	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_003624806.1|43944_44505_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003624803.1|44505_45030_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003628011.1|45031_45442_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_012211218.1|45462_47697_-	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A222ZQ84	Mycobacterium_phage	33.2	2.5e-89
WP_012211219.1|47950_48985_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012211220.1|48981_49554_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_101853676.1|49733_50762_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.7	2.6e-46
WP_023190354.1|50897_51527_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012211222.1|51929_53051_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.0e-92
WP_012211223.1|53028_54195_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	46.9	2.6e-98
WP_012211224.1|54362_54677_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_003624787.1|57244_58006_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.6	6.5e-18
WP_012211225.1|58002_58899_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_101853677.1|58895_59888_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012211227.1|60236_60944_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_012211230.1|62019_62877_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.1	3.9e-59
WP_012211231.1|63215_65141_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	A0A1S5SF82	Streptococcus_phage	29.8	4.7e-65
WP_023190364.1|66153_67167_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.6	1.0e-50
WP_012211233.1|67293_68136_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003624751.1|68590_69418_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.5	3.4e-97
WP_012211234.1|70434_73266_+	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	24.9	4.7e-29
WP_101853678.1|73305_74433_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003624744.1|74605_75019_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.9	1.0e-09
WP_014918044.1|76999_77185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628364.1|81792_82422_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054607133.1|82576_82795_-	steroid-binding protein	NA	NA	NA	NA	NA
WP_012211238.1|82884_83754_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_101511789.1|83750_84584_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_020828881.1|84717_85674_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_003625326.1|85691_86528_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_072749203.1|86623_87442_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023191278.1|88300_89059_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_101853679.1|89187_90309_+	s-layer protein	NA	NA	NA	NA	NA
WP_012211358.1|90842_92021_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853680.1|92589_93492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052540648.1|94187_95303_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023190998.1|95467_95662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853681.1|96147_97326_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023190500.1|97445_97652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853682.1|99586_100303_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	6.7e-41
WP_072749133.1|100369_102226_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	32.0	5.1e-32
WP_101853683.1|102206_103565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211249.1|103567_104392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211250.1|104407_105205_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.1	1.2e-30
WP_012211251.1|105291_106533_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.4	1.1e-17
WP_003628556.1|106997_107477_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_079227915.1|107587_107857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211252.1|107985_108870_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_012211253.1|108878_109532_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_101853684.1|109535_110885_-	ABC transporter ATP-binding protein	NA	A0A1V0SI78	Klosneuvirus	23.1	2.1e-11
WP_012211358.1|111025_112204_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211255.1|112422_113364_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101812567.1|114452_114941_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	33.8	4.9e-11
WP_012211256.1|115032_115929_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003625378.1|115943_116504_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	33.7	1.2e-13
WP_012211257.1|116570_117677_-	cation transporter	NA	NA	NA	NA	NA
WP_003625382.1|117854_118259_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003548644.1|118591_118732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072749128.1|118837_119539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158648614.1|119719_120949_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.2	1.3e-124
WP_003629452.1|122108_122342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211259.1|122506_123154_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003629454.1|123154_124072_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_012211261.1|124124_124880_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.1e-28
WP_101853686.1|124879_126493_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_012211263.1|126820_127453_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
WP_101853687.1|127593_129000_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	179854	249343	2209387	protease,holin,tRNA,transposase	Klosneuvirus(13.33%)	57	NA	NA
WP_079227860.1|179854_179962_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_101853698.1|180119_180521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211302.1|180757_180973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101853699.1|181806_183141_+	S-layer protein	NA	NA	NA	NA	NA
WP_101853700.1|185143_186367_+	N-acetylmuramidase	NA	S5M9Y4	Brevibacillus_phage	36.3	7.8e-13
WP_012211305.1|186385_187477_+	amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	26.9	1.3e-19
WP_012211358.1|187626_188805_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853701.1|189033_190440_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003630530.1|190567_192403_+	potassium transporter	NA	NA	NA	NA	NA
WP_012211306.1|192520_193255_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	31.6	6.5e-31
WP_065866883.1|193431_194838_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003630533.1|195208_196174_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_035513470.1|196183_196975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211308.1|199421_200114_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_012211309.1|200336_200939_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_003625545.1|201002_201563_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_012211310.1|201664_202774_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211311.1|202773_203391_+	membrane protein	NA	NA	NA	NA	NA
WP_101853702.1|203426_206417_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_101853703.1|206502_207888_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_012211314.1|208141_209404_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	3.0e-84
WP_003630682.1|209825_210182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190539.1|210487_211801_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.0	3.3e-62
WP_072749122.1|211800_212457_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_072749101.1|212572_213715_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	34.0	1.3e-62
WP_012211323.1|215224_215650_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003625564.1|215896_216358_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_012211324.1|216446_217109_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_012211325.1|217269_217869_-	DUF159 family protein	NA	NA	NA	NA	NA
WP_012211326.1|217993_219016_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003625568.1|219040_219520_+	hypothetical protein	NA	A7KUY9	Bacillus_phage	59.0	5.2e-37
WP_012211327.1|219500_220118_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_101853704.1|220415_223079_+	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	24.4	1.3e-36
WP_012211329.1|223171_225148_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.3e-99
WP_012211330.1|225147_225915_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012211331.1|225901_226468_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_012211332.1|226457_227342_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003625575.1|227404_227662_+	Veg protein	NA	NA	NA	NA	NA
WP_012211334.1|227780_228611_+	pur operon repressor	NA	NA	NA	NA	NA
WP_012211335.1|228657_230043_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	34.0	1.0e-29
WP_012211336.1|230274_230880_+	S-layer protein	NA	NA	NA	NA	NA
WP_101853705.1|230965_232117_+	cell separation protein	NA	NA	NA	NA	NA
WP_041810677.1|232252_233647_+	cell division protein	NA	NA	NA	NA	NA
WP_012211338.1|233887_234862_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.8	8.6e-47
WP_012211339.1|235891_236167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211340.1|236194_237559_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.6	1.1e-31
WP_003625587.1|237672_238074_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_023190547.1|238120_238678_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003625589.1|238795_240415_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.2	5.6e-136
WP_012211342.1|240544_241840_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_072749096.1|242194_242584_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_012211344.1|242639_244064_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_012211345.1|244144_244969_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211346.1|245068_246343_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.9	1.4e-28
WP_012211347.1|246346_246925_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_035504367.1|247198_247801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146211431.1|248113_249343_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.4	2.7e-122
>prophage 3
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	254278	294382	2209387	protease,tRNA,transposase	Aeromonas_phage(11.11%)	28	NA	NA
WP_012211358.1|254278_255457_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003625618.1|255888_257124_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	1.2e-101
WP_012211356.1|257251_258529_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.3	3.8e-10
WP_101853706.1|261033_262212_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211358.1|262965_264144_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853707.1|264668_265736_+	cell surface protein	NA	NA	NA	NA	NA
WP_101853708.1|265936_267652_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
WP_041810683.1|267890_269075_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.8	2.6e-122
WP_012211360.1|269261_270092_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003625728.1|270276_270522_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003625729.1|270648_272016_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_012211361.1|272028_273540_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.1	3.8e-70
WP_003625735.1|273622_273979_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_012211362.1|273981_275112_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	7.2e-29
WP_003631233.1|275895_276603_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_101812593.1|276790_277762_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_012211364.1|277896_278454_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_101812594.1|278455_281953_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003625749.1|281964_282207_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_012211366.1|282272_282650_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_023190461.1|282649_283012_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014562984.1|283052_284309_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_012211368.1|284403_286569_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	47.8	3.0e-108
WP_003625760.1|286621_287512_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_101812595.1|287586_288615_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_023190458.1|288630_290181_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.6	1.5e-82
WP_003625767.1|291341_291797_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_023190455.1|291901_294382_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.3	4.8e-118
>prophage 4
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	375307	474707	2209387	transposase,holin,tRNA	Staphylococcus_phage(12.9%)	77	NA	NA
WP_012211427.1|375307_376042_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_012211428.1|376025_376598_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_023061461.1|376648_377698_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	35.2	1.1e-50
WP_012211430.1|377766_379044_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_012211431.1|379221_381135_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.4	6.0e-60
WP_003625963.1|381308_381956_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_012211433.1|382095_382554_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211434.1|382550_383297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812609.1|384711_385242_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_101853720.1|385456_387178_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.7e-88
WP_079227838.1|387196_387490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023061469.1|387633_387726_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_012211437.1|388023_388554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627770.1|388769_389054_+	co-chaperone GroES	NA	A0A221S304	uncultured_virus	40.7	1.2e-12
WP_012211438.1|389107_390730_+	chaperonin GroEL	NA	A0A240F766	uncultured_virus	54.0	4.4e-157
WP_101854060.1|390910_393487_+	DNA mismatch repair protein MutS	NA	F2QAF7	Pyramimonas_orientalis_virus	25.2	4.6e-39
WP_012211440.1|393486_395397_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.7	5.8e-55
WP_012211441.1|395397_395988_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003627765.1|396036_397053_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	32.5	7.4e-09
WP_101853721.1|397102_397537_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_101853722.1|397672_399124_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	32.2	9.7e-63
WP_023190286.1|399116_400238_+	DNA polymerase IV	NA	A0A1P8CWP4	Bacillus_phage	24.5	3.1e-16
WP_012211446.1|400297_401254_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_012211447.1|401246_402608_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	4.4e-49
WP_101854061.1|403224_403671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211450.1|403940_406580_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.0	6.1e-63
WP_003627753.1|406640_406898_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_014563089.1|406897_407326_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003627751.1|407327_407639_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_065866602.1|407702_410060_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	48.7	9.7e-20
WP_072749072.1|410160_410472_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.8	5.9e-18
WP_101853723.1|410531_411809_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.1	3.8e-10
WP_101853724.1|411984_412356_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_012211458.1|413665_414079_-	YslB family protein	NA	NA	NA	NA	NA
WP_101853725.1|414155_414959_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003631882.1|414958_415579_+	XTP/dITP diphosphatase	NA	A0A2P1DNP2	Cassava_brown_streak_virus	34.0	8.8e-13
WP_101853726.1|416010_417288_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.7	9.0e-12
WP_101853727.1|417390_418554_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	36.1	8.6e-54
WP_101853728.1|419136_419922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072749069.1|419925_420159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101853701.1|420310_421717_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_110557998.1|421824_422106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|422144_423323_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853729.1|423497_424388_+	MFS transporter	NA	NA	NA	NA	NA
WP_101853701.1|424797_426204_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_013854558.1|426357_426615_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013854557.1|426604_426994_+	MazF family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211358.1|427255_428434_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853730.1|429109_430339_-|transposase	IS110-like element ISLhe4 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.6	1.3e-63
WP_101853731.1|430576_431821_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.3	3.1e-09
WP_012211461.1|431988_432840_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_012211462.1|432973_433399_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_012211463.1|433416_433788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023191004.1|433853_434960_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_101853732.1|435106_436108_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	26.3	1.8e-20
WP_101853733.1|436188_437535_-	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	26.5	2.8e-11
WP_003627737.1|437651_437972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101853734.1|437986_439378_+	bifunctional metallophosphatase/5'-nucleotidase	NA	S4VPC4	Pandoravirus	23.2	5.0e-08
WP_012211468.1|439361_439985_+	YutD family protein	NA	NA	NA	NA	NA
WP_003632178.1|439984_440764_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_012211469.1|440760_441369_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_012211470.1|441382_442033_-	membrane protein	NA	NA	NA	NA	NA
WP_101812611.1|442041_442971_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	25.2	4.1e-14
WP_003627915.1|451881_453045_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_012211472.1|453058_454102_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014563108.1|454101_455124_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_012211474.1|455199_457257_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	1.3e-142
WP_003632304.1|457323_457557_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_012211475.1|457631_459971_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.8	9.5e-84
WP_003627921.1|459983_460442_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.4	2.1e-43
WP_158648615.1|460537_460678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014918044.1|462615_462801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212191.1|466160_467051_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_023190445.1|467502_468702_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.8	1.8e-139
WP_012212189.1|468720_470181_+	MFS transporter	NA	S4TR35	Salmonella_phage	24.2	4.9e-06
WP_023190442.1|471341_472004_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003627282.1|472292_474707_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.8	0.0e+00
>prophage 5
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	491119	537834	2209387	terminase,head,integrase,tRNA,transposase,portal,tail,capsid,plate	Lactobacillus_phage(83.33%)	61	490710:490729	531583:531602
490710:490729	attL	TGTTGCACAAATGTTGCACA	NA	NA	NA	NA
WP_101853736.1|491119_492241_-	lysin	NA	Q71JA9	Lactobacillus_phage	83.6	3.4e-180
WP_101853737.1|492303_492693_-	hypothetical protein	NA	L0P6Z4	Lactobacillus_phage	37.8	2.0e-10
WP_060472249.1|492694_492934_-	hypothetical protein	NA	L0P6E4	Lactobacillus_phage	72.2	1.6e-23
WP_101853738.1|492917_493199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853739.1|493211_493484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853740.1|493775_494504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853741.1|494906_495773_-	hypothetical protein	NA	F8J1C9	Lactobacillus_phage	34.4	1.3e-22
WP_101853742.1|495793_497212_-	hypothetical protein	NA	Q20DB8	Lactobacillus_phage	26.3	9.7e-07
WP_101853743.1|497208_497883_-	DUF2313 domain-containing protein	NA	L0P8N4	Lactobacillus_phage	48.3	2.4e-32
WP_101853744.1|497875_499021_-|plate	baseplate J/gp47 family protein	plate	L0P7C2	Lactobacillus_phage	78.2	5.5e-170
WP_101854062.1|499010_499424_-	DUF2634 domain-containing protein	NA	L0P6H1	Lactobacillus_phage	98.5	1.3e-68
WP_016077058.1|499449_499794_-	DUF2577 domain-containing protein	NA	L0P6Y6	Lactobacillus_phage	100.0	9.0e-60
WP_101853745.1|499766_500834_-	hypothetical protein	NA	L0P6D8	Lactobacillus_phage	92.4	1.2e-187
WP_101853746.1|500830_501529_-	hypothetical protein	NA	L0P8M9	Lactobacillus_phage	93.1	2.4e-115
WP_101854063.1|501535_502009_-	hypothetical protein	NA	L0P7B8	Lactobacillus_phage	84.1	7.5e-57
WP_101853747.1|504814_505231_-	hypothetical protein	NA	L0P6Y3	Lactobacillus_phage	97.1	1.6e-66
WP_101853748.1|505243_505717_-|tail	phage tail protein	tail	L0P6D4	Lactobacillus_phage	94.9	8.9e-82
WP_101853749.1|505730_507188_-|tail	phage tail protein	tail	L0P8M7	Lactobacillus_phage	90.3	1.4e-247
WP_060472264.1|507191_507395_-	hypothetical protein	NA	L0P7B3	Lactobacillus_phage	80.6	2.2e-21
WP_101853750.1|507363_507789_-	hypothetical protein	NA	L0P6G4	Lactobacillus_phage	94.3	1.8e-73
WP_101853751.1|507785_508187_-	HK97 gp10 family phage protein	NA	X2CXN4	Lactobacillus_phage	54.2	1.3e-38
WP_101853752.1|508183_508546_-	hypothetical protein	NA	A9D9T8	Lactobacillus_prophage	65.8	1.9e-39
WP_101853753.1|508542_508914_-	hypothetical protein	NA	L0P6D1	Lactobacillus_phage	89.4	4.5e-57
WP_101853754.1|508930_510007_-|capsid	capsid protein	capsid	L0P8M2	Lactobacillus_phage	92.2	1.5e-185
WP_101853755.1|510021_510561_-|capsid	phage capsid protein	capsid	L0P7B0	Lactobacillus_phage	93.9	2.0e-85
WP_101853756.1|511009_512095_-|head	phage head morphogenesis protein	head	Q20DD6	Lactobacillus_phage	58.2	3.8e-120
WP_101854064.1|512097_513549_-|portal	phage portal protein	portal	X2CY64	Lactobacillus_phage	67.9	3.0e-181
WP_101853757.1|513554_514778_-|terminase	PBSX family phage terminase large subunit	terminase	A9D9R9	Lactobacillus_prophage	58.0	7.8e-138
WP_101853758.1|514779_515283_-|terminase	terminase small subunit	terminase	Q20DD9	Lactobacillus_phage	60.4	2.0e-47
WP_101853759.1|515738_515960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853760.1|516834_517275_-	hypothetical protein	NA	L0P6G6	Lactobacillus_phage	91.1	2.2e-71
WP_101854065.1|517392_517932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853761.1|517924_518119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853762.1|518108_518447_-	VRR-NUC domain-containing protein	NA	L0P7E5	Lactobacillus_phage	81.1	1.6e-48
WP_101853763.1|518490_518736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853764.1|519135_520449_-	hypothetical protein	NA	U3PCP1	Lactobacillus_phage	50.6	1.0e-111
WP_110540398.1|520811_520913_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101853765.1|520902_521706_-	DNA primase	NA	U3PBE3	Lactobacillus_phage	65.4	3.1e-87
WP_101853766.1|521783_522086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853767.1|522102_522690_-	single-stranded DNA-binding protein	NA	U3PDN3	Lactobacillus_phage	48.7	1.8e-44
WP_101853768.1|522692_523454_-	AAA family ATPase	NA	U3PIS9	Lactobacillus_phage	60.8	6.4e-74
WP_101853769.1|523446_523650_-	helix-turn-helix transcriptional regulator	NA	Q6SE98	Lactobacillus_prophage	45.8	9.5e-09
WP_101853770.1|523729_524047_+	hypothetical protein	NA	A0A1B0YA89	Lactobacillus_phage	37.3	1.7e-12
WP_101853771.1|524043_524223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853772.1|524219_525491_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	57.3	9.6e-131
WP_101853773.1|525623_525968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853774.1|525970_526321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853775.1|526317_526794_-	hypothetical protein	NA	A0A0A1EL06	Lactobacillus_phage	40.3	2.5e-23
WP_101853776.1|527003_527303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853777.1|527313_528120_-	phage repressor protein/antirepressor Ant	NA	L0P8P6	Lactobacillus_phage	79.8	1.3e-112
WP_101853778.1|528125_528335_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101853779.1|528596_528944_+	helix-turn-helix transcriptional regulator	NA	A0A097QQ00	Enterococcus_phage	40.0	3.3e-09
WP_101853780.1|528948_529353_+	ImmA/IrrE family metallo-endopeptidase	NA	Q6SEA2	Lactobacillus_prophage	37.5	4.8e-20
WP_101853781.1|529398_530274_+	hypothetical protein	NA	Q38183	Lactococcus_phage	36.6	1.7e-17
WP_101853782.1|530435_531557_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	41.4	8.9e-72
WP_012212178.1|532450_534136_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.4	6.0e-72
531583:531602	attR	TGTTGCACAAATGTTGCACA	NA	NA	NA	NA
WP_003627244.1|534246_535158_+	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_023192090.1|535229_535748_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003627240.1|535750_536020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627237.1|536167_536452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|536655_537834_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	563463	676944	2209387	protease,transposase,integrase,tRNA	Bacillus_phage(31.82%)	87	630326:630370	632361:632405
WP_012212149.1|563463_564117_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_012212148.1|564187_564508_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_012212147.1|564527_565175_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_041810733.1|565226_566534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025283820.1|568235_568433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041810732.1|568540_569149_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	42.0	5.2e-34
WP_012212125.1|569178_570504_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	7.3e-57
WP_041810805.1|570868_571255_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_101812617.1|571592_576563_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	32.8	3.1e-15
WP_101853673.1|576690_577968_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
WP_101853787.1|578199_579477_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.2	2.2e-10
WP_101853788.1|579612_580848_-|transposase	IS3-like element ISLhe6 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.3	9.8e-56
WP_003629734.1|580903_581548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041810731.1|581582_582215_-	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	62.2	4.1e-18
WP_003629717.1|582392_582569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212143.1|582787_583240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212142.1|583394_584708_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_003627174.1|584762_585740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627172.1|585828_587343_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_012212141.1|587480_588458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212140.1|588864_589179_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003629702.1|589196_590078_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_012212137.1|593552_596087_+	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	20.8	2.6e-10
WP_012212136.1|596101_596845_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_012212135.1|596844_598818_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_012212134.1|598820_599672_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_012212133.1|599674_600331_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_012212132.1|600327_601359_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_014563208.1|601368_601659_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_101853789.1|604316_606980_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	30.6	8.9e-62
WP_101853790.1|606988_607819_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	25.9	1.6e-17
WP_023190881.1|607815_608418_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003627138.1|608420_608888_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_023190882.1|608890_610222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014918447.1|610253_611162_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.1	9.2e-27
WP_012212129.1|611452_613387_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.2	3.6e-97
WP_041810730.1|614199_614730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212126.1|614920_615529_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
WP_101853791.1|615558_616884_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	2.8e-56
WP_012212124.1|618088_618382_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_012212123.1|618388_619639_+	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_072748849.1|621624_622158_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.5	8.9e-14
WP_003627120.1|622179_622380_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003627118.1|622423_622780_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_012212121.1|622925_623450_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_012212120.1|623442_624552_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_065866556.1|624562_625237_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003627112.1|625217_625811_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003627111.1|625832_626180_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_012212118.1|626185_627337_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_023191246.1|627338_627893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627105.1|628055_628772_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.1	1.8e-25
WP_072748850.1|628758_630318_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
630326:630370	attL	AGGCTCTTTGTCAAATCCTGTTGATAGAGAGTAAATGAATAGAAT	NA	NA	NA	NA
WP_014563241.1|630420_631785_+	SlpX	NA	NA	NA	NA	NA
WP_014563242.1|631878_632256_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	42.2	2.9e-11
WP_101853792.1|632404_633682_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.5	1.9e-09
632361:632405	attR	AGGCTCTTTGTCAAATCCTGTTGATAGAGAGTAAATGAATAGAAT	NA	NA	NA	NA
WP_072748852.1|633859_634348_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_101853793.1|634395_635364_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_014563247.1|635410_635683_-	acylphosphatase	NA	NA	NA	NA	NA
WP_072748853.1|635780_636548_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_012212112.1|636659_637010_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012212111.1|637294_638344_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	5.3e-34
WP_012212110.1|638347_640762_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012212109.1|640838_641315_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_012212108.1|641377_642292_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_035513757.1|642479_642821_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003627088.1|642789_643086_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023190294.1|645881_646805_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_012211358.1|646950_648129_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212106.1|648292_650884_-	YfhO family protein	NA	NA	NA	NA	NA
WP_023190296.1|650974_653083_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_101853794.1|653159_653309_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003627079.1|653357_653918_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_012212104.1|653938_654619_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_012212103.1|654619_654847_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_012212102.1|654905_655307_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_012212101.1|655385_656306_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003627067.1|658068_659406_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_012212100.1|660517_661423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072748857.1|661523_662522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101853795.1|664092_665085_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	9.0e-52
WP_101853796.1|665189_666146_-	beta-galactosidase small subunit	NA	NA	NA	NA	NA
WP_101853797.1|666129_668016_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.5	5.3e-93
WP_101853798.1|668240_669044_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012212095.1|669241_670249_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_101854066.1|672559_674479_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_012212092.1|675708_676944_-|transposase	IS3-like element ISLhe6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.9	2.2e-55
>prophage 7
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	705781	784638	2209387	transposase	Burkholderia_virus(11.11%)	52	NA	NA
WP_012211358.1|705781_706960_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003627719.1|708769_709999_+	MFS transporter	NA	NA	NA	NA	NA
WP_012212078.1|710071_711946_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_065866883.1|712078_713485_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012212077.1|715706_716324_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_012212076.1|716326_716908_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_065866883.1|717568_718975_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012211358.1|719095_720274_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_158298623.1|720551_720689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212074.1|721091_722258_+	galactokinase	NA	NA	NA	NA	NA
WP_101853801.1|722279_723743_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_012212072.1|723863_724859_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_065866524.1|724979_725420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812630.1|725528_726356_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_012212071.1|728219_729392_+	MFS transporter	NA	NA	NA	NA	NA
WP_003629414.1|729410_729818_+	OsmC family protein	NA	NA	NA	NA	NA
WP_012212070.1|729837_730542_+	oxidoreductase	NA	NA	NA	NA	NA
WP_101853673.1|731515_732793_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
WP_012212067.1|734068_734575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|734849_736028_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853802.1|736111_737587_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_012211430.1|737647_738925_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	5.3e-12
WP_012212065.1|739187_742400_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	28.9	7.3e-10
WP_101853803.1|742420_743875_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	26.5	8.9e-24
WP_012212063.1|745344_745959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212062.1|746041_747286_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_012212061.1|747525_748710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101854067.1|750378_750999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035514433.1|754641_754968_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_012212056.1|754969_755854_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_012212055.1|755868_756531_-	serine dehydratase	NA	NA	NA	NA	NA
WP_101853805.1|756679_757858_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023191368.1|758443_758740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023191369.1|758874_760110_+	MFS transporter	NA	NA	NA	NA	NA
WP_101854068.1|760166_762791_-	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	30.0	1.1e-83
WP_101854069.1|763953_764337_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023191373.1|764720_764999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627631.1|765223_765847_-	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	32.9	9.1e-26
WP_003629217.1|765848_766553_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_101853806.1|766807_767731_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_101853807.1|767897_768440_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_079227881.1|768578_769844_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_101853808.1|770054_771011_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	34.1	3.7e-26
WP_101853809.1|771010_772288_+	dihydroorotase	NA	NA	NA	NA	NA
WP_012212046.1|772287_773373_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.1	1.3e-56
WP_012212413.1|773365_776554_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_157952330.1|778806_778959_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_101853810.1|779136_780000_+	sugar transporter	NA	NA	NA	NA	NA
WP_003627617.1|780115_780397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627616.1|780389_780815_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_101853811.1|780866_783248_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_012211358.1|783459_784638_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	791236	851900	2209387	tRNA,transposase	Enterococcus_phage(14.29%)	55	NA	NA
WP_012212126.1|791236_791845_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
WP_101853813.1|793404_794430_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_101853814.1|794568_795936_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_003627604.1|796102_796414_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003629151.1|796432_796723_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003627602.1|796832_797942_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_012212036.1|798025_798595_+	elongation factor P	NA	NA	NA	NA	NA
WP_012212035.1|798612_799038_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_012212034.1|799045_799438_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_052540998.1|799496_800345_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	43.1	2.5e-42
WP_101812650.1|800482_801532_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.4	1.4e-47
WP_052540998.1|801655_802504_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	43.1	2.5e-42
WP_003627596.1|802493_803837_+	exodeoxyribonuclease VII large subunit	NA	A0A160DEV2	Gordonia_phage	32.1	7.7e-30
WP_003627595.1|803839_804082_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_023190671.1|804084_804954_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_101812652.1|804954_805767_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_012212030.1|805777_807460_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_101853815.1|808098_809505_+|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_003627588.1|809638_810253_+	guanylate kinase	NA	A0A212Q4J6	Cowpox_virus	29.8	6.2e-19
WP_003627587.1|810255_810480_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_020829296.1|810530_812930_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_020829295.1|812943_813888_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.2	6.2e-10
WP_003627583.1|813838_815203_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003629102.1|815207_815963_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_003627581.1|815952_817968_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	Q8QNG7	Ectocarpus_siliculosus_virus	29.2	1.8e-19
WP_003627580.1|817968_818859_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_003627579.1|818871_819522_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_101853816.1|819521_820208_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_003627577.1|820249_820555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627575.1|820661_820847_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003547910.1|821002_821365_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003627574.1|821386_823048_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_012212019.1|823049_825080_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_020829293.1|825100_826102_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_003627571.1|826132_826375_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	56.1	8.1e-07
WP_003627570.1|826496_827531_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	7.8e-14
WP_003629095.1|827534_828521_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	3.7e-13
WP_012212411.1|828523_829483_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003627565.1|829497_830427_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_101853817.1|830631_832383_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_101853673.1|832580_833858_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
WP_003627561.1|835936_836623_+	ribonuclease III	NA	M1HR51	Paramecium_bursaria_Chlorella_virus	30.6	8.2e-20
WP_101853818.1|836638_840208_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_101853819.1|840208_841501_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_003627558.1|841543_842965_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003627557.1|843164_843452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003629078.1|843518_844946_-	amino acid permease	NA	NA	NA	NA	NA
WP_080516431.1|845071_846028_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.2e-26
WP_003627552.1|846142_846484_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003627550.1|846488_847919_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003627549.1|848009_848282_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003629074.1|848350_848866_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003629072.1|848855_849575_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003629071.1|849687_850035_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_101853701.1|850493_851900_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	855117	923840	2209387	protease,tRNA,transposase	Streptococcus_phage(18.75%)	45	NA	NA
WP_096001375.1|855117_856347_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.5e-64
WP_012211358.1|858761_859940_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_041806205.1|860322_861513_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.9	1.2e-122
WP_003629024.1|865923_867867_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.4	1.2e-60
WP_003629023.1|867924_869106_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.1	4.7e-47
WP_003629022.1|869160_869775_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003629021.1|869840_870872_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003627530.1|871033_871807_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003627529.1|871840_872866_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003629020.1|873004_873730_+	UMP kinase	NA	NA	NA	NA	NA
WP_003627525.1|873729_874287_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003627524.1|874289_875024_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.0	2.5e-22
WP_101853820.1|875025_875841_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_020829285.1|875851_877108_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_072748898.1|877150_878848_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012212004.1|878853_883170_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	34.1	1.2e-18
WP_012212003.1|883279_883756_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_101854070.1|883775_884957_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_012212001.1|884965_885262_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003627514.1|885264_885576_+	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
WP_101853821.1|885580_888193_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	9.7e-21
WP_012211999.1|888212_888578_+	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_003629013.1|888629_889523_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_023192476.1|889543_890491_+	riboflavin biosynthesis protein RibF	NA	A0A1V0SD03	Indivirus	30.1	6.0e-05
WP_101853822.1|890660_891710_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_101853823.1|891725_892325_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_012211996.1|892342_894169_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	1.8e-143
WP_012211995.1|894250_895405_+	molecular chaperone DnaJ	NA	A0A167RAM8	Powai_lake_megavirus	29.0	1.4e-19
WP_072748903.1|895879_897718_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	5.2e-21
WP_003627502.1|897720_898410_+	class A sortase	NA	NA	NA	NA	NA
WP_012211993.1|898530_900804_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.9	3.7e-77
WP_101853824.1|900908_901436_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012211992.1|901579_902509_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.5	2.2e-100
WP_023061378.1|902524_903319_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_012211989.1|905072_905573_+	putative lactocepin s-layer protein	NA	NA	NA	NA	NA
WP_101853825.1|905726_907430_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	5.1e-87
WP_101853826.1|907435_909709_-	HAD-IC family P-type ATPase	NA	A7IUR5	Paramecium_bursaria_Chlorella_virus	25.3	1.6e-43
WP_012211987.1|909837_910692_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211358.1|912052_913231_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_014918653.1|916796_917333_+	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_072748906.1|917453_918620_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003627474.1|918799_919405_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_101853676.1|919571_920600_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.7	2.6e-46
WP_012211982.1|921149_922028_-	YitT family protein	NA	NA	NA	NA	NA
WP_101853701.1|922433_923840_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	967322	1025348	2209387	transposase,integrase,tRNA	Bacillus_phage(14.29%)	48	967389:967404	1030888:1030903
WP_012211950.1|967322_968621_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	27.8	2.3e-47
967389:967404	attL	TGGTTAACAGATAAAA	NA	NA	NA	NA
WP_012211949.1|968706_969351_+	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	36.0	4.2e-10
WP_012211948.1|969352_969973_+	endonuclease III	NA	NA	NA	NA	NA
WP_101853830.1|970188_972468_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_101853831.1|972464_973097_-	Holliday junction resolvase RecU	NA	A0A1B1P798	Bacillus_phage	31.2	1.6e-17
WP_012211945.1|973160_973730_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_101853832.1|973820_974237_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_012211943.1|974700_975825_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_101853833.1|977402_979079_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_012211941.1|979085_979550_+	signal peptidase II	NA	NA	NA	NA	NA
WP_012211940.1|979542_980454_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.1	1.0e-09
WP_101853834.1|980456_981512_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_012211938.1|981515_984707_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_012211937.1|984774_986469_-	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	40.0	3.2e-09
WP_101853835.1|986617_987034_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211936.1|987109_987991_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.9	4.4e-10
WP_101853706.1|988220_989399_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_014563506.1|989573_990656_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_012211934.1|991171_991627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211933.1|991633_992125_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	36.1	5.0e-19
WP_099046778.1|992170_992788_-	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	44.2	1.9e-39
WP_080516429.1|992985_993357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626263.1|993406_993610_-	gametolysin	NA	NA	NA	NA	NA
WP_012211358.1|994726_995905_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023190409.1|996182_996428_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_012211358.1|997576_998755_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023190406.1|1001009_1001363_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211926.1|1001392_1001977_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	44.6	8.2e-29
WP_012211925.1|1002061_1002997_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_101853836.1|1003029_1003992_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101853837.1|1004142_1006599_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.3	3.0e-96
WP_023190404.1|1006615_1008562_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.0	2.7e-116
WP_003626280.1|1008658_1009285_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003626288.1|1010935_1011403_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_023190402.1|1011491_1012010_-	acetyltransferase	NA	NA	NA	NA	NA
WP_023190401.1|1012223_1013084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003628766.1|1013820_1014411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190395.1|1015080_1015320_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_012211920.1|1015475_1016234_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023190392.1|1016941_1017550_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_049751273.1|1017707_1018175_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101853701.1|1018331_1019738_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_023190390.1|1019845_1021186_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023190388.1|1021483_1021762_+	Na+/H+ antiporter family protein	NA	NA	NA	NA	NA
WP_012211917.1|1022018_1022639_-|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	36.4	7.4e-20
WP_012211916.1|1022754_1023393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626323.1|1023704_1024205_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	45.4	1.6e-33
WP_014563535.1|1024316_1025348_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	39.2	1.8e-34
1030888:1030903	attR	TTTTATCTGTTAACCA	NA	NA	NA	NA
>prophage 11
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1042469	1101619	2209387	transposase	Streptococcus_phage(22.22%)	42	NA	NA
WP_065866883.1|1042469_1043876_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_101853842.1|1044921_1045935_-	serine hydrolase	NA	NA	NA	NA	NA
WP_012211901.1|1046136_1047540_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_101853788.1|1047593_1048829_-|transposase	IS3-like element ISLhe6 family transposase	transposase	A0A1B1P773	Bacillus_phage	47.3	9.8e-56
WP_101853843.1|1048898_1050278_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_023190890.1|1050660_1050996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211898.1|1052029_1052269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812669.1|1053799_1054441_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_041810719.1|1054485_1054716_-	replication-associated protein RepA	NA	NA	NA	NA	NA
WP_012211895.1|1054879_1055413_-	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_101854072.1|1057318_1058566_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_101854073.1|1061271_1062432_-	amidohydrolase	NA	NA	NA	NA	NA
WP_101853706.1|1062569_1063748_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023191318.1|1064536_1065868_-	amino acid permease	NA	NA	NA	NA	NA
WP_003619518.1|1066164_1066530_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_101853701.1|1066667_1068074_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_072748931.1|1068315_1070262_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.8	3.0e-59
WP_101853844.1|1070448_1072341_-	hypothetical protein	NA	Q6SEF9	Lactobacillus_prophage	50.5	2.0e-15
WP_072748932.1|1072400_1074887_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_101853845.1|1075071_1075461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1075528_1076707_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_041810715.1|1076866_1077304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853846.1|1077452_1079033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211872.1|1079140_1079857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061630.1|1079856_1080591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211870.1|1080594_1081356_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.7	1.1e-22
WP_023061631.1|1081367_1081580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853847.1|1081858_1083265_+|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_012211358.1|1083608_1084787_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101812682.1|1085082_1086687_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.4	5.1e-12
WP_023191193.1|1086661_1086949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628570.1|1087300_1088914_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_023061883.1|1090886_1092401_-	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	23.7	1.2e-23
WP_101812684.1|1092715_1092943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211867.1|1092989_1094849_-	hypothetical protein	NA	F2Y1C6	Organic_Lake_phycodnavirus	32.1	1.5e-07
WP_003626445.1|1095060_1095489_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_003628533.1|1095485_1095920_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023061886.1|1096104_1096692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023061888.1|1096982_1097240_-	DUF3923 family protein	NA	NA	NA	NA	NA
WP_101812685.1|1097278_1099783_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.0	1.2e-137
WP_101853848.1|1099798_1100341_-	GNAT family N-acetyltransferase	NA	E4ZFP7	Streptococcus_phage	30.2	8.8e-17
WP_101853706.1|1100440_1101619_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1105197	1169387	2209387	protease,tRNA,integrase,transposase	Aureococcus_anophage(14.29%)	55	1121209:1121225	1155208:1155224
WP_101812686.1|1105197_1108131_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.6	4.4e-86
WP_101812687.1|1108744_1109236_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_014563645.1|1109345_1109705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626474.1|1110095_1110719_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_020829165.1|1110721_1111483_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_012211860.1|1111498_1111918_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_012211859.1|1112181_1112658_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023191272.1|1112747_1113185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101853849.1|1113364_1114543_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.5	8.3e-121
WP_101812689.1|1114653_1115364_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_003626488.1|1115452_1116634_+	MFS transporter	NA	NA	NA	NA	NA
WP_003628501.1|1116699_1117281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211856.1|1117370_1117988_-	Fic family protein	NA	NA	NA	NA	NA
WP_014563664.1|1118250_1118796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191942.1|1118708_1119212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211854.1|1119384_1119762_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003628493.1|1119774_1120515_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_012211853.1|1120521_1122105_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	26.5	1.1e-19
1121209:1121225	attL	ATTATTCATCAAATTAT	NA	NA	NA	NA
WP_014563667.1|1122094_1123642_-	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	22.1	1.2e-15
WP_101853673.1|1123918_1125196_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
WP_003628488.1|1125341_1125692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023191010.1|1126233_1126446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211851.1|1126451_1127738_-	peptidase T	NA	NA	NA	NA	NA
WP_012211850.1|1127896_1129231_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_012211849.1|1129279_1130485_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_012211848.1|1130566_1131124_-	membrane protein	NA	NA	NA	NA	NA
WP_101853850.1|1131130_1131892_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_101853851.1|1131924_1133103_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211846.1|1133398_1134496_-	serine hydrolase	NA	NA	NA	NA	NA
WP_012211845.1|1134620_1135235_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_012211844.1|1135335_1135968_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003628456.1|1136196_1136646_-	Trp operon repressor	NA	NA	NA	NA	NA
WP_012211358.1|1136873_1138052_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023190807.1|1138134_1139907_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.6	2.9e-77
WP_101853852.1|1141335_1142019_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_012211842.1|1142085_1143345_-	aluminum resistance protein	NA	NA	NA	NA	NA
WP_012211840.1|1143361_1145458_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_065866883.1|1147121_1148528_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003628346.1|1150361_1150739_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_003628344.1|1150740_1151124_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	3.1e-08
WP_101853853.1|1152784_1153600_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_014563689.1|1154667_1155567_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
1155208:1155224	attR	ATTATTCATCAAATTAT	NA	NA	NA	NA
WP_101853854.1|1155719_1157123_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	25.3	9.8e-28
WP_003628338.1|1157133_1157658_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_003626495.1|1157666_1158575_-	tyrosine recombinase	NA	A0A1P8DJJ6	Virus_Rctr41k	25.1	2.3e-14
WP_023191156.1|1158574_1159891_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_012211826.1|1159924_1162039_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.2	1.5e-96
WP_003628334.1|1162110_1162959_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.8	4.9e-30
WP_012211825.1|1163019_1163772_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.6	1.3e-26
WP_012211824.1|1163761_1164613_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_012211823.1|1164636_1166229_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003626511.1|1166276_1166507_-	YozE family protein	NA	NA	NA	NA	NA
WP_003626512.1|1166509_1167340_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.9	5.3e-21
WP_003628329.1|1167456_1168149_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_012211821.1|1168187_1169387_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.1	8.6e-49
>prophage 13
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1196938	1348850	2209387	protease,tRNA,transposase	Bacillus_virus(16.13%)	117	NA	NA
WP_012211457.1|1196938_1197796_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_146226400.1|1197872_1198205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101812702.1|1198248_1198839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211799.1|1199056_1199572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211798.1|1200282_1201218_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_023191213.1|1202418_1203015_+	DedA family protein	NA	NA	NA	NA	NA
WP_101853860.1|1203121_1204507_+	amino acid permease	NA	NA	NA	NA	NA
WP_101853861.1|1207259_1207778_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_023191208.1|1207824_1208661_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	36.3	1.5e-36
WP_012211793.1|1208832_1210026_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.4	1.7e-41
WP_065866883.1|1210530_1211937_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_012211791.1|1212065_1213250_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012211790.1|1213338_1215192_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	24.4	2.2e-11
WP_012211789.1|1215197_1216484_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.3	1.8e-20
WP_101853687.1|1216845_1218252_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_012211788.1|1218398_1218836_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_101812706.1|1218835_1221076_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.0	1.3e-10
WP_079227775.1|1221090_1221540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211786.1|1221508_1222456_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_012211785.1|1222516_1223026_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_101853862.1|1224683_1225862_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003628193.1|1226103_1226610_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_072748971.1|1226712_1228059_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_012211782.1|1229196_1229529_+	hypothetical protein	NA	A0A0P0I7G8	Lactobacillus_phage	43.6	4.4e-19
WP_012211781.1|1229783_1230164_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_003628186.1|1230295_1230853_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012211779.1|1230865_1232575_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	1.3e-18
WP_012211778.1|1232567_1233401_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_003628182.1|1233611_1234067_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_023190293.1|1235451_1236270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211776.1|1236674_1238216_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_012211775.1|1238205_1239120_-	citrate lyase	NA	NA	NA	NA	NA
WP_003628158.1|1239120_1239414_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_012211774.1|1239403_1240456_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_012211772.1|1240546_1241338_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012211771.1|1241416_1242883_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_072748978.1|1243201_1244515_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.3	1.1e-57
WP_101853863.1|1244612_1245146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853864.1|1248273_1249200_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_023190708.1|1249514_1250162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072748979.1|1250231_1250546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023190710.1|1250614_1250860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853865.1|1250856_1251693_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_003626645.1|1251727_1251895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628125.1|1251942_1252245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853866.1|1252231_1252918_-	mucus-binding protein	NA	NA	NA	NA	NA
WP_101853867.1|1252914_1253235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025283502.1|1253529_1254906_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.1	2.9e-56
WP_012211762.1|1254917_1256321_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003626652.1|1256508_1256733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211759.1|1258201_1258903_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012211758.1|1258895_1259957_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.1e-30
WP_012211757.1|1259969_1260830_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_101853868.1|1261180_1263598_-	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	20.2	2.1e-17
WP_023190626.1|1263697_1263880_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023190625.1|1263892_1264096_-	hypothetical protein	NA	Q9AZG0	Lactococcus_phage	50.0	5.6e-09
WP_012211755.1|1264215_1264734_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.5	2.2e-25
WP_003626673.1|1264748_1265705_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	3.6e-114
WP_012211358.1|1266409_1267588_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_065866883.1|1268947_1270354_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_079227905.1|1270627_1270699_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_012211753.1|1270720_1271089_+	antitoxin HicB	NA	A0A0A7S1E5	Clostridium_phage	38.9	9.2e-10
WP_012211358.1|1271424_1272603_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853869.1|1273785_1274394_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_101853870.1|1274505_1276260_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	5.2e-87
WP_012211750.1|1277281_1278568_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
WP_012211749.1|1279399_1279888_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_065866353.1|1281051_1282434_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_023191145.1|1282433_1283375_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_101853871.1|1283533_1284775_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	2.8e-119
WP_012211746.1|1285525_1286248_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003626695.1|1287242_1287947_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	25.5	1.6e-07
WP_003626697.1|1289654_1291094_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.8	1.5e-95
WP_003626700.1|1291090_1291645_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.8	4.7e-34
WP_003626706.1|1293787_1294423_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211738.1|1297107_1298037_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_101854074.1|1298223_1299510_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.8	4.3e-54
WP_101853872.1|1299570_1300086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1300808_1301987_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853873.1|1302070_1303684_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_079227764.1|1303728_1304304_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012211358.1|1305192_1306371_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012211734.1|1306944_1308003_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003626723.1|1308014_1309181_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_025283482.1|1309201_1309981_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_012211732.1|1309973_1310909_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_012211731.1|1310910_1312065_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003626729.1|1312067_1312778_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_012211730.1|1312797_1314114_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_065866341.1|1314585_1315959_+	aspartate kinase	NA	NA	NA	NA	NA
WP_012211728.1|1315951_1316956_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_101853874.1|1318737_1320474_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	3.6e-88
WP_101853875.1|1320438_1321029_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_101853876.1|1321018_1322293_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.4	5.1e-132
WP_101853877.1|1322423_1323782_-	trigger factor	NA	NA	NA	NA	NA
WP_012211723.1|1323932_1325123_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	27.3	2.3e-30
WP_012211722.1|1325312_1326146_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_101853878.1|1326148_1327921_-	ribonuclease J	NA	NA	NA	NA	NA
WP_003628079.1|1328077_1328347_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_014919008.1|1328545_1328803_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003627943.1|1328863_1329850_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_012211720.1|1329846_1332135_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.0	8.2e-24
WP_012211719.1|1332103_1332799_-	competence protein	NA	NA	NA	NA	NA
WP_012211718.1|1332876_1333911_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_003627939.1|1333894_1334389_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.2	9.7e-23
WP_012211717.1|1334391_1334940_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_101853879.1|1334936_1335281_-	YlbG family protein	NA	NA	NA	NA	NA
WP_023190858.1|1335277_1336459_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_003628073.1|1336554_1338399_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	41.5	3.6e-22
WP_003628072.1|1338651_1339206_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.7	3.6e-10
WP_003627933.1|1339556_1339778_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_101853880.1|1339784_1341464_+	ribonuclease J	NA	NA	NA	NA	NA
WP_101853882.1|1342648_1343926_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.1	3.8e-10
WP_012211712.1|1343974_1346326_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	27.0	2.1e-59
WP_072748999.1|1346325_1346970_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012211710.1|1346969_1347629_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012211708.1|1347722_1348850_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1352221	1508150	2209387	terminase,integrase,transposase,tRNA,portal,holin,tail,capsid	Lactobacillus_phage(45.45%)	162	1458939:1458960	1498724:1498745
WP_012211704.1|1352221_1355005_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.9	1.2e-88
WP_065866336.1|1355225_1356023_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_003627654.1|1355998_1356799_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_003627655.1|1356798_1357101_-	YggT family protein	NA	NA	NA	NA	NA
WP_012211702.1|1357100_1357538_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_023190849.1|1357555_1358875_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_012211700.1|1358889_1360248_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_012211699.1|1360310_1361168_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_012211698.1|1361184_1362291_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_003627666.1|1362292_1363672_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_003627667.1|1363681_1364650_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_003628054.1|1366804_1367167_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_012211697.1|1367180_1368128_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_003627673.1|1368132_1368564_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_101853884.1|1368759_1369938_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003628051.1|1370138_1370471_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_003627675.1|1370565_1370700_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_012211696.1|1370740_1371280_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012211695.1|1371279_1372131_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_101853885.1|1372176_1373181_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003627679.1|1373276_1373900_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_012211693.1|1373938_1374616_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_012211692.1|1374605_1375880_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012211691.1|1375880_1378520_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.4	4.8e-161
WP_101853886.1|1379046_1380225_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
WP_012211690.1|1380615_1381806_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.7	2.4e-123
WP_012211688.1|1383905_1384832_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	49.3	1.7e-76
WP_012211687.1|1384828_1385245_-	GtrA family protein	NA	NA	NA	NA	NA
WP_023190373.1|1385791_1386214_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003628039.1|1386228_1386939_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_158648616.1|1387623_1387761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155248849.1|1387774_1387924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155248848.1|1387971_1388130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025283454.1|1388111_1388366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211685.1|1388553_1389354_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101854075.1|1389526_1390330_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101853888.1|1390573_1391383_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101854076.1|1391786_1392149_+	DUF3232 domain-containing protein	NA	NA	NA	NA	NA
WP_101853889.1|1392297_1393035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853890.1|1393299_1394562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1394613_1395792_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853891.1|1396030_1396687_-	hypothetical protein	NA	Q4Z8Z5	Staphylococcus_phage	31.9	8.4e-06
WP_146211464.1|1396688_1397186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158648617.1|1397685_1397850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101853884.1|1398305_1399484_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853893.1|1399666_1400716_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.9	5.4e-47
WP_101511663.1|1402964_1403429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853894.1|1403385_1403727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003631082.1|1403782_1404640_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_101853706.1|1404799_1405978_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853895.1|1406012_1406753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1407362_1408541_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853896.1|1408562_1409222_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101853897.1|1410439_1411249_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101853898.1|1411265_1411847_-	DUF3232 domain-containing protein	NA	NA	NA	NA	NA
WP_101853882.1|1412097_1413375_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.1	3.8e-10
WP_101853899.1|1413502_1413892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853714.1|1414729_1415587_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_101854077.1|1415901_1416594_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_126963158.1|1416654_1416909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080890085.1|1416884_1417130_+	DUF3232 domain-containing protein	NA	NA	NA	NA	NA
WP_003628028.1|1417310_1417484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626189.1|1417618_1418836_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_014563860.1|1418835_1419996_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	31.8	2.3e-38
WP_101853900.1|1420088_1421798_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_101853687.1|1422005_1423412_+|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_003628026.1|1423694_1424306_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_023190607.1|1424396_1424864_+	YueI family protein	NA	NA	NA	NA	NA
WP_012211678.1|1424863_1426177_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	49.3	6.2e-101
WP_003626176.1|1426476_1426758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003626174.1|1426825_1427290_+	universal stress protein	NA	NA	NA	NA	NA
WP_012211677.1|1427355_1428549_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003626171.1|1428570_1428798_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_012211676.1|1428806_1429100_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_101853901.1|1429113_1430103_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003626167.1|1430186_1430417_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_012211673.1|1430480_1430921_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_101853902.1|1430932_1432372_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_012211672.1|1432394_1433357_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_012211671.1|1433367_1434879_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_101853903.1|1434893_1435442_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_012211669.1|1435441_1435951_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_012211668.1|1436002_1436236_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_012211667.1|1436255_1436969_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_101812721.1|1437092_1437722_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003628018.1|1437805_1438807_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.1	1.2e-48
WP_023190612.1|1438812_1439655_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003626148.1|1439647_1440736_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	1.4e-05
WP_003626146.1|1440752_1441352_-	thymidine kinase	NA	C1KFH3	Lactobacillus_virus	50.8	2.4e-47
WP_023190613.1|1441540_1442893_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_012211663.1|1443212_1444226_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	26.1	1.2e-06
WP_003626134.1|1447205_1448546_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_101853904.1|1448621_1449236_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003626130.1|1449360_1451532_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.2	1.6e-149
WP_101853905.1|1453034_1454492_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.8	3.6e-33
WP_101853906.1|1454491_1455214_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.7e-36
WP_014563890.1|1455213_1455606_-	SdpI family protein	NA	NA	NA	NA	NA
WP_012211655.1|1455640_1456606_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_012211654.1|1456698_1457856_-	putative C-S lyase	NA	NA	NA	NA	NA
1458939:1458960	attL	TTCGGTCATTTTTCGGTCAAAA	NA	NA	NA	NA
WP_101853907.1|1458989_1459232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853908.1|1459487_1460381_-	lysin	NA	Q38373	Lactococcus_phage	55.3	6.4e-89
WP_101853909.1|1460370_1460829_-|holin	phage holin	holin	U3PBD0	Lactobacillus_phage	38.8	3.6e-11
WP_101853910.1|1460825_1461023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853911.1|1461035_1461431_-	hypothetical protein	NA	A9UJV1	Lactobacillus_phage	32.6	9.9e-10
WP_101853912.1|1461393_1461552_-	XkdX family protein	NA	NA	NA	NA	NA
WP_101853913.1|1461551_1462133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853914.1|1462263_1462890_-	hypothetical protein	NA	A0A2P0ZLE1	Lactobacillus_phage	33.0	4.1e-10
WP_101853915.1|1462984_1464565_-	DUF2479 domain-containing protein	NA	NA	NA	NA	NA
WP_101853916.1|1464524_1464761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110540405.1|1464769_1468222_-	endopeptidase	NA	B8R659	Lactobacillus_phage	23.8	8.6e-33
WP_101853917.1|1468221_1469004_-|tail	phage tail protein	tail	Q9T1E6	Lactobacillus_phage	26.8	8.8e-18
WP_101853918.1|1468993_1475572_-	tape measure protein	NA	A0A0A7DMV4	Lactobacillus_phage	43.6	3.7e-117
WP_101853919.1|1475571_1476219_-	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	32.6	3.4e-15
WP_101853920.1|1476228_1476663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101854079.1|1476678_1477287_-|capsid	phage capsid protein	capsid	O03972	Lactobacillus_phage	49.6	1.5e-28
WP_101854080.1|1477311_1477719_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_101853921.1|1477732_1478131_-|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	36.5	1.7e-14
WP_101853922.1|1478130_1478481_-|capsid	minor capsid protein	capsid	O03932	Lactobacillus_phage	38.8	3.1e-15
WP_101853923.1|1478473_1478866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853924.1|1478879_1479911_-	replication protein	NA	O03966	Lactobacillus_phage	61.1	5.4e-108
WP_101853925.1|1479921_1480542_-	scaffolding protein	NA	U3PIU5	Lactobacillus_phage	25.3	5.2e-05
WP_101853926.1|1480641_1480854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158648618.1|1480834_1481092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101854082.1|1481099_1482233_-|capsid	minor capsid protein	capsid	U3PFU0	Lactobacillus_phage	50.4	2.2e-102
WP_101854081.1|1482216_1483785_-|portal	phage portal protein	portal	Q38341	Lactococcus_phage	53.6	2.4e-144
WP_101853928.1|1483853_1485110_-|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	63.9	4.2e-163
WP_101853929.1|1485126_1485801_-	helix-turn-helix domain-containing protein	NA	A0A1S5SAK3	Streptococcus_phage	46.1	3.7e-33
WP_101853932.1|1486241_1486574_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_101853933.1|1487003_1487474_-	hypothetical protein	NA	Q6SE89	Lactobacillus_prophage	31.5	4.5e-09
WP_158648619.1|1487485_1487668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853935.1|1487860_1488127_-	hypothetical protein	NA	A9D9Q0	Lactobacillus_prophage	37.5	4.9e-05
WP_101854083.1|1488138_1488315_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_101853936.1|1488383_1488860_-	hypothetical protein	NA	L0P6G1	Lactobacillus_phage	91.7	3.9e-85
WP_023191853.1|1488831_1489122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1489207_1490386_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101854084.1|1490565_1491366_-	ATP-binding protein	NA	L0P6I8	Lactobacillus_phage	98.9	2.0e-150
WP_101853937.1|1491400_1492261_-	hypothetical protein	NA	L0P704	Lactobacillus_phage	92.4	1.9e-58
WP_101853938.1|1492263_1492971_-	DUF1071 domain-containing protein	NA	X2CXM9	Lactobacillus_phage	48.0	3.8e-44
WP_101853939.1|1492963_1493221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853940.1|1493230_1493506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158648620.1|1493580_1493736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853941.1|1493735_1493969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853942.1|1493978_1494293_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_101853943.1|1494252_1494495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853944.1|1494506_1495220_-	phage regulatory protein	NA	A0A0A7DN29	Lactobacillus_phage	55.2	7.4e-32
WP_101853945.1|1495252_1495459_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101853946.1|1495624_1495978_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	39.3	1.4e-10
WP_101853947.1|1495986_1496388_+	ImmA/IrrE family metallo-endopeptidase	NA	O48433	Lactobacillus_phage	44.7	3.7e-20
WP_101853948.1|1496374_1497511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101853949.1|1497600_1498707_+|integrase	site-specific integrase	integrase	Q6SEG4	Lactobacillus_prophage	45.1	5.8e-84
WP_012211653.1|1499215_1500400_-	acetate kinase	NA	NA	NA	NA	NA
1498724:1498745	attR	TTCGGTCATTTTTCGGTCAAAA	NA	NA	NA	NA
WP_012211652.1|1500448_1501450_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003626117.1|1501619_1502120_-	ComGF family competence protein	NA	NA	NA	NA	NA
WP_003626116.1|1502127_1502397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003626115.1|1502393_1502825_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_003626112.1|1502793_1503144_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_035509571.1|1503155_1504157_-	type II secretion system protein F	NA	NA	NA	NA	NA
WP_003626108.1|1504125_1505100_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_003626106.1|1505247_1505976_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_101853950.1|1506066_1506582_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003626102.1|1506676_1506862_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_146211424.1|1506959_1508150_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	56.4	1.2e-119
>prophage 15
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1555817	1687960	2209387	protease,bacteriocin,tRNA,transposase	Streptococcus_phage(14.29%)	106	NA	NA
WP_101812731.1|1555817_1557041_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.5	3.5e-122
WP_101853953.1|1557426_1558704_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.2	2.4e-12
WP_003626023.1|1558801_1559821_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_101812735.1|1559862_1560705_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_012211614.1|1560694_1561663_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_012211613.1|1561679_1561958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101511653.1|1561965_1563082_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_012211612.1|1563149_1565549_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_012211611.1|1565688_1566234_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_012211610.1|1566314_1567010_-	ComF family protein	NA	NA	NA	NA	NA
WP_012211609.1|1567006_1568293_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	43.8	2.9e-82
WP_012211608.1|1568337_1569000_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.8	3.4e-39
WP_101812736.1|1569026_1570184_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_012211606.1|1570291_1571923_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_065866894.1|1572041_1573139_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.1	3.2e-119
WP_012211604.1|1573322_1573883_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012211603.1|1573905_1575024_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003633413.1|1575091_1575820_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003625998.1|1575820_1577077_-	insulinase family protein	NA	A0A2P1EIE5	Megavirus	28.1	1.0e-12
WP_101812737.1|1577073_1578306_-	insulinase family protein	NA	NA	NA	NA	NA
WP_023191333.1|1578274_1580692_-	DNA translocase FtsK	NA	Q853W3	Mycobacterium_phage	48.0	1.7e-83
WP_003625992.1|1580712_1581102_-	DUF1149 family protein	NA	NA	NA	NA	NA
WP_003625990.1|1581101_1581662_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_012211600.1|1581712_1582912_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012211599.1|1583380_1586137_-	cation-transporting P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.6	1.1e-75
WP_012211598.1|1586289_1587318_+	lactonase family protein	NA	NA	NA	NA	NA
WP_012211597.1|1587424_1588117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023190421.1|1590036_1590933_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.0	3.6e-07
WP_012211595.1|1590916_1591729_-	NAD kinase	NA	NA	NA	NA	NA
WP_003627775.1|1591725_1592358_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003633400.1|1592481_1593096_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_012211594.1|1593174_1593792_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_012211358.1|1594119_1595298_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853954.1|1596107_1596848_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_012211591.1|1596939_1597338_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_012211590.1|1597569_1599303_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_012211589.1|1599302_1599569_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003627783.1|1599682_1599877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853955.1|1600041_1600761_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_101853956.1|1600890_1603080_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	40.5	8.8e-124
WP_012211585.1|1603231_1603513_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_003627787.1|1603580_1605152_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.2	5.5e-35
WP_072749037.1|1605151_1606024_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003627789.1|1606130_1606592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003627790.1|1606593_1607076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020829071.1|1607086_1607902_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003627793.1|1608023_1609406_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.2	3.9e-69
WP_003627794.1|1610117_1610702_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012211582.1|1610750_1611206_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627796.1|1611209_1611479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853957.1|1613166_1613541_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_003627958.1|1613552_1613783_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003627959.1|1613757_1615095_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
WP_003626750.1|1615687_1618552_-	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	27.0	1.9e-33
WP_012211245.1|1618968_1620147_+|transposase	IS256-like element IS1201 family transposase	transposase	NA	NA	NA	NA
WP_003626759.1|1621625_1621910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211579.1|1621948_1623112_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_012211578.1|1623111_1624323_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003633307.1|1624322_1625483_-	thiolase family protein	NA	NA	NA	NA	NA
WP_101854085.1|1625716_1627045_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	41.3	3.5e-59
WP_101853958.1|1627109_1628009_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.1	6.4e-73
WP_012211577.1|1628070_1628994_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003633294.1|1629002_1629830_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_101853701.1|1629962_1631369_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003626773.1|1631579_1632026_+	flavodoxin	NA	NA	NA	NA	NA
WP_003626776.1|1632018_1632558_+	GtrA family protein	NA	NA	NA	NA	NA
WP_003633292.1|1632581_1633724_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.3	5.5e-29
WP_023192258.1|1633831_1634020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003633289.1|1634187_1635516_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003633288.1|1635512_1636745_-	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.5	1.2e-34
WP_020829052.1|1636744_1637449_-	lysozyme	NA	NA	NA	NA	NA
WP_023190478.1|1638790_1639360_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	27.6	4.9e-10
WP_012211571.1|1639466_1640828_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_012211570.1|1641642_1641915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211569.1|1642040_1642526_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_012211567.1|1647218_1648067_-	patatin family protein	NA	NA	NA	NA	NA
WP_101853959.1|1648233_1649511_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	9.0e-12
WP_012211566.1|1649609_1652009_-	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_012211565.1|1652305_1653070_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_012211564.1|1653075_1653441_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_012211563.1|1653527_1653851_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_101853960.1|1653850_1655254_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_012211561.1|1655246_1655708_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_012211560.1|1655694_1656933_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	4.7e-98
WP_012211559.1|1656907_1658185_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003626810.1|1658196_1658991_-	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.6	7.3e-12
WP_012211557.1|1660043_1660862_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_012211556.1|1660951_1661245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211554.1|1663641_1664568_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_101853961.1|1664685_1666701_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.2	1.9e-64
WP_012211552.1|1666761_1667454_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_012211551.1|1667453_1668380_-	ribokinase	NA	A0A2H4N7X4	Lake_Baikal_phage	37.5	6.3e-07
WP_012211550.1|1668493_1669297_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_012211549.1|1669517_1670924_+|transposase	ISLre2-like element ISLhe13 family transposase	transposase	NA	NA	NA	NA
WP_012211548.1|1671078_1671348_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003626829.1|1671360_1672704_+	PFL family protein	NA	NA	NA	NA	NA
WP_012211547.1|1672852_1674154_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_101853962.1|1674352_1675630_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	3.4e-11
WP_158648621.1|1676326_1677550_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.3	3.0e-121
WP_012211545.1|1678092_1678746_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012211544.1|1678760_1679402_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012211543.1|1679401_1680220_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012211542.1|1680230_1680971_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	7.2e-38
WP_012211358.1|1681195_1682374_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_023190970.1|1684551_1685184_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.5	6.2e-38
WP_012211358.1|1686781_1687960_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1704162	1847962	2209387	holin,tRNA,integrase,transposase	Lactobacillus_virus(13.79%)	107	1768492:1768551	1794411:1796009
WP_041806184.1|1704162_1705353_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.7	3.1e-123
WP_041806185.1|1707038_1708364_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	35.8	4.0e-55
WP_003627960.1|1708393_1709002_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
WP_020829066.1|1709104_1709605_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101853965.1|1709815_1711222_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_035509267.1|1712493_1712922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003633083.1|1713130_1713331_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	2.4e-20
WP_012211524.1|1714685_1715642_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.0	2.9e-39
WP_003633078.1|1715759_1716317_-	YdhK family protein	NA	NA	NA	NA	NA
WP_003633076.1|1716498_1716750_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_003633074.1|1716795_1717143_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003633072.1|1717216_1717678_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_003626886.1|1719539_1720331_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_101853966.1|1720351_1721530_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003633061.1|1721548_1722511_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_003626890.1|1723980_1725333_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.2	1.9e-116
WP_003626892.1|1725698_1727075_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_003626893.1|1727111_1727453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853965.1|1728670_1730077_+|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_003633053.1|1730217_1730922_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_003633052.1|1731714_1732635_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.8	2.7e-18
WP_003626901.1|1732659_1734090_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003626902.1|1734094_1735534_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003633051.1|1735533_1735842_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_020829042.1|1735855_1737004_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_012211516.1|1737016_1739023_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	7.1e-104
WP_003633049.1|1739063_1741301_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.5	5.2e-132
WP_003633047.1|1741386_1742034_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	47.7	1.0e-27
WP_003626912.1|1742271_1742742_-	SprT family protein	NA	NA	NA	NA	NA
WP_003626913.1|1742729_1743428_-	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	27.6	2.1e-07
WP_003633045.1|1743430_1744861_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003633044.1|1744865_1746020_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_041806182.1|1748958_1750200_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.4	5.3e-118
WP_003626929.1|1750396_1751227_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.1	1.3e-67
WP_003633021.1|1751223_1752702_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.6	1.3e-115
WP_003633019.1|1752789_1753890_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_020829039.1|1753897_1754626_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_101853967.1|1754878_1756069_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.5	2.4e-128
WP_003633007.1|1756179_1756566_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A0F7LBI5	uncultured_marine_virus	47.2	7.1e-13
WP_003633005.1|1756628_1757330_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003633002.1|1757418_1758534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003633000.1|1758923_1759475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853968.1|1764138_1765356_-	phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	37.9	8.3e-15
WP_023190837.1|1765356_1765935_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	37.1	2.5e-22
WP_041810784.1|1766004_1767063_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_101853969.1|1767200_1767890_-	hypothetical protein	NA	A0A249XZV3	Enterococcus_phage	52.2	2.8e-12
WP_003632978.1|1768272_1768389_+	hypothetical protein	NA	NA	NA	NA	NA
1768492:1768551	attL	TCTAAGTGTATAATTTTTTGCGGTAAGTTGAATAATTAATTAAAAAAGCTCAAATCCTTT	NA	NA	NA	NA
WP_101853701.1|1768628_1770035_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003626959.1|1771186_1771579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1771789_1772968_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853970.1|1773051_1773270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046813904.1|1773368_1773767_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_101853971.1|1774072_1775314_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	58.3	4.3e-120
WP_012211493.1|1775579_1776734_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_101853972.1|1776750_1777464_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146211448.1|1777682_1777868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853974.1|1778289_1779492_-|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZE80	Staphylococcus_phage	24.4	5.5e-11
WP_101853975.1|1779555_1779750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853976.1|1779795_1780839_-	replication initiation protein	NA	A0A2K9LWK0	uncultured_virus	28.5	6.4e-08
WP_101853977.1|1780852_1781191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853978.1|1781187_1781589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101854086.1|1781785_1782157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853979.1|1782379_1782724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853980.1|1782720_1783794_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_101853981.1|1783796_1784111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|1784994_1786173_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_158648622.1|1786289_1786442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853982.1|1787477_1791824_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_101853701.1|1794547_1795954_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_158648623.1|1796946_1798131_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.1	8.1e-124
1794411:1796009	attR	TCTAAGTGTATAATTTTTTGCGGTAAGTTGAATAATTAATTAAAAAAGCTCAAATCCTTTGAAATTGGACTTGAGCTCAAACAAAAAGACCAGTAGTCTGATGTTAACGAAAAAAACACATTAGAAGCTGGTCTTTTATGGAATCTATTATAACTGATATCGTAAAAATTATTAAGTCTGAAAATAATGTTATTGCCCGTGAAAAGGCATTAATGTGCTATTTCTTTGATCTGATTAGAGAATTGATGACAGCAGCACTAGAAGAAGTTGATGCCGGCTTAGTTGAAGAGACTAAAAAGCAAGGCTATCAGATCGAGAAGAAAAATAAGCGTTCAGTTGTGACTGCCTTTGGTGAAATCAGCTATTGGCGCAGAAGATATGCTTGTCCTGGCAAAAAGGCTAAATATCCACTGGATAAGCTGATGGGCTATGACAAATATAAGCGTTACAGTGTTTTGGCAGTGAAGGATATTTTGCAGGTTAGCGCCGTGGCAACTTACCGCAATACTGCTTTAGCTGTTAATACTCTCTCCTGTTTCAATATTAGCCATAGTCAAGTTGGCAAGCTGATTGTGCAAGCAGGCAAACAGATTAAAGTACAGCAGCAGTCTGAGGAAAGATACGATGGTATTACTCAAAAGAAAAAGGTGCCAGTGCTTTATCTTGAAGGCGATGGCGTTGTGATTAAAGGCACCAAGAAGCGACTGGAATTTCATCGCTATCAAGTCTGCGAGGATATTATTAATTTAAGCAAGACGCGCAGAAAGAGAGTACAGGCCAAAGAGTTTGTTTCTTTAAGCCGCTTGGATGCTTTACAAGAAATTAAAGCTTATTTAGCCAATACCTATGACTTAAGCGATACTTTAATCATCAGTAATGCCGATGGCGGTGCTGGCTATGCCAAGAAAGACTTTGATGAAATAGTTGGCTATTGCCGGCAGCACGAGCACTTCTTAGACGTCTTCCACTTGAACAAAAAGATTAAAGATCGTCTAAGCTTCATGCCACCCATGCCAGGCAAATTGATCAGTGCAGTTGAGTTTAAATATGACCGTCACTTAACTGATGTGATTTTAGACACGATTGAAAGCAATCTGATTGATGAGCTGAATACGCCAGAAAATCATGAGAATTTAAGGCGCCTGCGCAGCTATCTTCATCGTCGCTGGGTGGATATTAAGCCGTTTAAGATGCGTCATTTGTCAGTAATTAAGGCAATTGGCTGCTGTGAGAGCAATCACCGCAAGTATACTTATCGCGTCAAAGGGCAAGGAAAATACTGGTCAGAAGATGGTGCCGAAGGAATTCTGCGTGTGCTGACTTGCATTAAAAACAAAGAGCTGGAATACTGGCTAAGCAGTGAGTTTGCAGGTGGACAGCTCGATATTGGTGATCAGGAAGAATTGAAAGGTGCAGTTCGTGCCAGCCTAAGAAAGACGCATGAAGCTCATCTGGGCATTCATCACGGCGCCATTGAAAGCTTAACAGCAGGACATAGCTATTTAAACGATTTTAGCAGAAAAATAAATCAAATAAATATTTAAGAAATTAAGGTCAGACTAATGGTTAATAGCCTACCGCAAAAATATTGACACTTAC	NA	NA	NA	NA
WP_012211358.1|1799279_1800458_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003626966.1|1800611_1801361_+	TIGR02452 family protein	NA	NA	NA	NA	NA
WP_003626968.1|1801378_1801750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853984.1|1802018_1803209_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.7	1.9e-125
WP_101853673.1|1805015_1806293_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
WP_003626979.1|1807112_1807340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853985.1|1808261_1809449_-	acetate kinase	NA	NA	NA	NA	NA
WP_012211358.1|1809599_1810778_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_158648624.1|1811078_1811873_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_101853986.1|1811799_1812192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211487.1|1812145_1812613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211486.1|1812594_1813197_+	amino acid permease	NA	NA	NA	NA	NA
WP_080516411.1|1813410_1813524_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_012211485.1|1813707_1814001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012211484.1|1814074_1815886_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.2	8.1e-91
WP_023191057.1|1816080_1818705_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_065866883.1|1819078_1820485_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_023191058.1|1820626_1822000_+	amino acid permease	NA	NA	NA	NA	NA
WP_101812857.1|1822037_1822529_-	acetyltransferase	NA	NA	NA	NA	NA
WP_101853987.1|1822628_1823807_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853988.1|1824091_1824922_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211481.1|1824966_1825335_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_012211480.1|1825338_1826259_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_012211479.1|1826287_1827100_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_012211478.1|1827118_1828129_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_101853701.1|1828269_1829676_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_101853989.1|1831930_1832332_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_012211476.1|1832529_1833381_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014918044.1|1836658_1836844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212192.1|1838977_1840285_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	1.4e-92
WP_012212193.1|1840508_1841060_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012212194.1|1841059_1841668_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	38.5	4.7e-35
WP_012212195.1|1841797_1842595_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_041810741.1|1842750_1843452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095661977.1|1843535_1844918_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003627852.1|1844963_1845998_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_101853990.1|1846261_1847962_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
>prophage 17
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1859880	1922598	2209387	protease,transposase	Lactobacillus_phage(16.67%)	51	NA	NA
WP_012211358.1|1859880_1861059_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212206.1|1861271_1862699_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_012212207.1|1862740_1863595_-	DNA nuclease	NA	NA	NA	NA	NA
WP_012212208.1|1863685_1864639_-	DNA polymerase III subunit epsilon	NA	A0A0K2SUJ2	Clostridium_phage	33.1	8.8e-12
WP_012212209.1|1864647_1865469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158298624.1|1865483_1865642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101853994.1|1865735_1866977_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	6.3e-119
WP_012212211.1|1867157_1867565_-	DUF3290 domain-containing protein	NA	NA	NA	NA	NA
WP_012212212.1|1867652_1868393_-	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	83.1	6.8e-121
WP_012212213.1|1869242_1870847_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.3	1.3e-15
WP_101853687.1|1871018_1872425_+|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_012212214.1|1872574_1873489_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_012212215.1|1873578_1874580_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_012212216.1|1874627_1875131_+	nucleoside deoxyribosyltransferase	NA	C1KFI2	Lactobacillus_virus	31.2	1.2e-12
WP_080516438.1|1875530_1875950_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_012212217.1|1876133_1877435_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_012212218.1|1877487_1878060_-	elongation factor P	NA	NA	NA	NA	NA
WP_012212219.1|1878094_1879009_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.2	3.6e-31
WP_012212220.1|1879067_1879628_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_023191161.1|1881174_1883481_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_023191160.1|1883630_1884317_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003627817.1|1884378_1885029_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_023191139.1|1885245_1887045_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_101853995.1|1887057_1887807_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	2.9e-34
WP_101853884.1|1888157_1889336_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853996.1|1889357_1890605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212226.1|1890693_1891365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212227.1|1891788_1892793_-	asparaginase	NA	NA	NA	NA	NA
WP_023191135.1|1893674_1894043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095662341.1|1894108_1894384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012212228.1|1894856_1895363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101812858.1|1895379_1895775_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012212231.1|1896555_1897431_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	7.1e-77
WP_097550426.1|1897595_1899701_-	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_012212233.1|1899925_1901377_+	APC family permease	NA	NA	NA	NA	NA
WP_101853997.1|1904819_1906286_-	flippase	NA	NA	NA	NA	NA
WP_101853998.1|1906309_1907272_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101853987.1|1907469_1908648_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853999.1|1909125_1910184_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.4	7.1e-47
WP_101854000.1|1910196_1911174_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_101854001.1|1911327_1912506_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_158648625.1|1912589_1912730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101854002.1|1912906_1913881_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_101854003.1|1913966_1915058_-	EpsG family protein	NA	NA	NA	NA	NA
WP_101854004.1|1915131_1915953_-	glycosyltransferase family 2 protein	NA	A0A2P1ELT8	Moumouvirus	31.9	4.0e-05
WP_101854005.1|1915967_1916870_-	capsular polysaccharide synthesis family protein	NA	NA	NA	NA	NA
WP_056970778.1|1916869_1917682_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	45.5	3.2e-15
WP_101854006.1|1917672_1918797_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_101854007.1|1918802_1919456_-	sugar transferase	NA	NA	NA	NA	NA
WP_101853687.1|1919603_1921010_-|transposase	ISLre2-like element ISLhe10 family transposase	transposase	NA	NA	NA	NA
WP_101854008.1|1921320_1922598_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.2	2.9e-10
>prophage 18
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1932803	1976104	2209387	bacteriocin,transposase	Lactobacillus_virus(27.27%)	43	NA	NA
WP_051356298.1|1932803_1934387_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_014919431.1|1934319_1934970_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	45.2	5.2e-40
WP_023062121.1|1935035_1935356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023192438.1|1935403_1935613_-	Protein of unknown function	NA	NA	NA	NA	NA
WP_158648626.1|1935707_1936931_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	58.5	6.0e-122
WP_003627295.1|1937019_1937289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627296.1|1937382_1937934_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	44.4	1.2e-18
WP_020828975.1|1938123_1938669_-	AAA family ATPase	NA	A0A218KC48	Bacillus_phage	31.7	7.2e-11
WP_101854015.1|1938763_1939063_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_101854016.1|1939155_1940661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072748773.1|1940675_1941317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101854017.1|1941561_1942755_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	57.0	2.3e-118
WP_012211358.1|1942838_1944017_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101853987.1|1944388_1945567_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101854018.1|1945823_1946168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003627306.1|1946280_1946817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101854019.1|1946992_1948222_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	55.4	4.9e-116
WP_101853673.1|1948472_1949750_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
WP_012212260.1|1949997_1950483_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_012212261.1|1950485_1951256_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_012212262.1|1951266_1952808_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.0	3.7e-44
WP_023190894.1|1952816_1953194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041810751.1|1953358_1953883_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101853673.1|1956190_1957468_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
WP_101854020.1|1957518_1958760_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211358.1|1958891_1960070_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101854021.1|1960311_1962108_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_080516441.1|1962395_1962689_+	Fic family protein	NA	NA	NA	NA	NA
WP_023190802.1|1963606_1964983_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_003627328.1|1965420_1966215_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_012212267.1|1966214_1966862_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.1	2.1e-17
WP_095662157.1|1966893_1967811_-	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_003630183.1|1968073_1968346_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012211358.1|1968567_1969746_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101854022.1|1969929_1971927_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_012212270.1|1971947_1972862_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_041810005.1|1972861_1973617_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	5.0e-18
WP_003630190.1|1973976_1974144_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_012212272.1|1974124_1974433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919460.1|1974703_1974895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630196.1|1975194_1975416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919462.1|1975405_1975633_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101854023.1|1975780_1976104_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 19
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1996079	2037452	2209387	transposase	Lactococcus_phage(16.67%)	34	NA	NA
WP_012212324.1|1996079_1997405_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.3	2.1e-56
WP_065866771.1|1997434_1998043_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	2.0e-33
WP_012212289.1|1998220_1998463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212290.1|1998564_1999977_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003630234.1|2000021_2000696_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.7e-33
WP_101854025.1|2000697_2001759_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003630236.1|2001759_2002287_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101854026.1|2002397_2002997_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012212294.1|2003152_2003908_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012212295.1|2003904_2004666_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_012212296.1|2004724_2005369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012211358.1|2005813_2006992_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_101854027.1|2008830_2011365_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.0	3.8e-70
WP_003627391.1|2011590_2011950_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
WP_101854028.1|2012014_2013292_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
WP_101854029.1|2013483_2014464_-	cytochrome C5	NA	NA	NA	NA	NA
WP_023190700.1|2014614_2015862_+	MFS transporter	NA	NA	NA	NA	NA
WP_146212403.1|2015993_2017178_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	59.6	3.6e-124
WP_052541595.1|2017349_2017712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101854031.1|2018408_2019587_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_054607623.1|2021136_2022840_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	3.5e-88
WP_101854032.1|2022841_2025010_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.5	1.9e-171
WP_020828951.1|2025002_2025425_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_003630318.1|2025408_2026416_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	2.7e-96
WP_101853681.1|2026759_2027938_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_079227888.1|2028058_2028412_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_065866763.1|2028719_2029277_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_023190615.1|2029242_2030427_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_012212307.1|2030448_2031360_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.7	2.8e-60
WP_035514011.1|2032635_2032854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051359594.1|2032954_2033827_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023190989.1|2033938_2035213_-	MFS transporter	NA	NA	NA	NA	NA
WP_023190988.1|2035308_2036157_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012211358.1|2036273_2037452_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	2060058	2138454	2209387	protease,bacteriocin,transposase	Streptococcus_phage(11.76%)	55	NA	NA
WP_012211358.1|2060058_2061237_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212126.1|2063119_2063728_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
WP_025283976.1|2066289_2067177_+	EamA family transporter	NA	NA	NA	NA	NA
WP_065866753.1|2069507_2071775_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	1.2e-59
WP_012212328.1|2072239_2072758_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_101854035.1|2073101_2074328_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.5	4.9e-39
WP_023191345.1|2074385_2074709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003630431.1|2074965_2075715_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_101854036.1|2076143_2077190_-	fucose-binding lectin II	NA	NA	NA	NA	NA
WP_101854037.1|2077277_2079698_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_012212331.1|2080161_2081556_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_035515559.1|2082385_2083282_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_101854038.1|2083269_2084934_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	2.4e-20
WP_003630445.1|2084941_2085652_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_023191339.1|2086759_2087095_+	EutP/PduV family microcompartment system protein	NA	NA	NA	NA	NA
WP_101854039.1|2087557_2088835_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	2.6e-11
WP_012212335.1|2088976_2090326_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.3	7.0e-124
WP_035514399.1|2090695_2090908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101854040.1|2092510_2093350_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_065866748.1|2093373_2094534_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	22.1	5.7e-05
WP_101853882.1|2094738_2096016_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.1	3.8e-10
WP_046814537.1|2097339_2097750_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023191696.1|2097852_2097951_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_101812836.1|2098329_2098473_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101854041.1|2098590_2099832_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_101853673.1|2100236_2101514_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.4	1.3e-10
WP_014564328.1|2103724_2104498_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_023061636.1|2106177_2106987_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003625106.1|2107268_2107955_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_079227881.1|2108015_2109281_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	5.2e-52
WP_101854042.1|2109495_2109978_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	43.3	3.2e-18
WP_012212364.1|2110136_2111108_-	EamA family transporter	NA	NA	NA	NA	NA
WP_014564334.1|2111175_2111820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101854043.1|2111837_2112338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101854044.1|2112921_2113779_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_023190665.1|2113930_2114410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212366.1|2114507_2114870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212367.1|2114938_2116237_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	1.7e-18
WP_012212368.1|2116240_2117530_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.3	5.8e-67
WP_023190666.1|2117740_2118733_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	67.3	1.7e-130
WP_101854045.1|2119171_2120194_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_012211358.1|2120261_2121440_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_012212371.1|2122053_2123067_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.4	2.1e-64
WP_012211358.1|2123556_2124735_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_082990701.1|2126067_2126904_-	McbB family protein	NA	NA	NA	NA	NA
WP_014919599.1|2126896_2127613_-	AAA family ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	3.5e-13
WP_023190658.1|2127609_2128341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003625059.1|2128395_2128686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079227714.1|2129247_2129400_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012212372.1|2129420_2130812_-	APC family permease	NA	NA	NA	NA	NA
WP_065866740.1|2131861_2133235_-	amino acid permease	NA	NA	NA	NA	NA
WP_101854046.1|2133280_2134633_-	amino acid permease	NA	NA	NA	NA	NA
WP_101854047.1|2134724_2135489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012212376.1|2135582_2136224_-	signal peptidase I	NA	NA	NA	NA	NA
WP_012212377.1|2136330_2138454_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.4	2.9e-116
