The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018622	Virgibacillus dokdonensis strain 21D chromosome, complete genome	4263520	272	30133	4263520	terminase,integrase,capsid,portal,protease,tail,head	Bacillus_phage(25.81%)	43	983:997	27625:27639
WP_101932316.1|272_656_-	DUF3168 domain-containing protein	NA	A8ATA3	Listeria_phage	41.1	2.1e-17
WP_101932317.1|655_1048_-	hypothetical protein	NA	A0A2H4JA97	uncultured_Caudovirales_phage	52.7	3.1e-32
983:997	attL	TTGTTTGCCCAGTTT	NA	NA	NA	NA
WP_101932318.1|1044_1422_-|head,tail	phage head-tail adapter protein	head,tail	A8ATA1	Listeria_phage	47.4	3.9e-24
WP_101934165.1|1399_1666_-	hypothetical protein	NA	A0A059T7R0	Listeria_phage	56.5	1.2e-19
WP_101932319.1|1710_2844_-|capsid	phage major capsid protein	capsid	D2XR18	Bacillus_phage	73.5	3.0e-152
WP_101934166.1|2861_3602_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	62.7	3.2e-70
WP_101932320.1|3628_4771_-|portal	phage portal protein	portal	A0A2H4JBZ5	uncultured_Caudovirales_phage	54.8	1.5e-119
WP_101932321.1|4775_6446_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	64.9	5.9e-213
WP_101932322.1|6442_6745_-|terminase	terminase	terminase	A0A0U4B062	Bacillus_phage	69.6	7.2e-29
WP_101932323.1|6998_7349_-	HNH endonuclease	NA	A0A0U4JWW4	Bacillus_phage	56.6	6.7e-26
WP_077704982.1|7617_7959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932325.1|8038_8707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932326.1|8826_9096_+	DUF3892 domain-containing protein	NA	A0A059NT53	Lactococcus_phage	51.1	2.5e-12
WP_101932327.1|9216_9741_-	hypothetical protein	NA	Q5YA83	Bacillus_phage	65.8	4.0e-51
WP_101932328.1|9740_11120_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	51.4	9.7e-137
WP_101932329.1|11112_11400_-	VRR-NUC domain-containing protein	NA	A0A1L6BZE4	Pasteurella_phage	50.6	1.1e-18
WP_101934167.1|11710_14122_-	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	44.9	8.8e-202
WP_101932330.1|14265_14664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932331.1|14676_14979_-	hypothetical protein	NA	L7TJ47	Halovirus	47.5	1.3e-17
WP_101932332.1|14975_15584_-	HNH endonuclease	NA	M1PKJ5	Streptococcus_phage	41.1	3.6e-35
WP_101932333.1|15580_15820_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	60.8	3.5e-18
WP_101934168.1|15834_17811_-	DNA polymerase	NA	H7BVQ1	unidentified_phage	57.5	9.7e-215
WP_101934169.1|17810_18548_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	38.5	1.3e-26
WP_101932334.1|18628_19804_-	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	49.7	9.2e-96
WP_101932335.1|19803_20247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932336.1|20339_20642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932337.1|20864_21071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932338.1|21060_21240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164085235.1|21245_21746_-	hypothetical protein	NA	O64162	Bacillus_phage	45.2	2.7e-36
WP_101932340.1|21852_22113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164085244.1|22174_22384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101932342.1|22502_22724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164085246.1|22738_22885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932343.1|22881_23076_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	45.2	5.0e-07
WP_101932344.1|23168_23333_+	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	75.5	2.7e-14
WP_101932345.1|24279_24561_-	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	54.7	7.2e-23
WP_077705031.1|24587_24800_-	DNA-binding protein	NA	A6M975	Geobacillus_virus	55.6	4.5e-09
WP_077705034.1|24996_25329_+	XRE family transcriptional regulator	NA	R9TNF4	Paenibacillus_phage	62.0	1.6e-29
WP_101932346.1|25340_25802_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTX7	Clostridium_phage	48.3	3.9e-34
WP_077705040.1|25816_26950_+|integrase	site-specific integrase	integrase	S5MBZ0	Brevibacillus_phage	63.4	2.5e-138
WP_073007322.1|27026_28424_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
27625:27639	attR	TTGTTTGCCCAGTTT	NA	NA	NA	NA
WP_077705046.1|28488_28923_-	SUF system NifU family Fe-S cluster assembly protein	NA	A0A0P0M6T0	Mycobacterium_phage	37.0	2.8e-13
WP_077705049.1|28912_30133_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.9	1.5e-117
>prophage 2
NZ_CP018622	Virgibacillus dokdonensis strain 21D chromosome, complete genome	4263520	107075	114328	4263520		Streptococcus_phage(33.33%)	8	NA	NA
WP_101934170.1|107075_107291_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	45.8	1.7e-11
WP_101932380.1|108333_108921_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.3	1.7e-53
WP_073007535.1|108955_109210_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_101932381.1|109423_110368_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	37.5	2.3e-49
WP_101932382.1|110529_111489_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	35.3	1.0e-52
WP_101932383.1|111490_112372_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	5.4e-08
WP_077705270.1|112423_112894_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_123059375.1|113338_114328_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.3	1.5e-86
>prophage 3
NZ_CP018622	Virgibacillus dokdonensis strain 21D chromosome, complete genome	4263520	868249	932294	4263520	protease,transposase	Streptococcus_phage(25.0%)	57	NA	NA
WP_077702006.1|868249_869221_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_101932785.1|869301_870255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932786.1|870405_871116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101932787.1|871591_872944_-	Ktr system potassium transporter B	NA	NA	NA	NA	NA
WP_164085339.1|873552_875685_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	58.2	5.7e-229
WP_101932790.1|875650_876034_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	54.9	6.0e-28
WP_101932791.1|876256_876496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101932792.1|876859_878245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101932793.1|878445_879777_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_101932794.1|879773_880466_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_101932795.1|881136_882366_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_101932796.1|882694_883924_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_101932797.1|884496_885852_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.6	1.4e-23
WP_101932798.1|886125_886896_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_101934199.1|887013_887217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932799.1|887640_888306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932800.1|888372_888810_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101932801.1|888910_889798_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_101932802.1|889990_890443_+	DNA gyrase inhibitor	NA	NA	NA	NA	NA
WP_101932803.1|890822_891128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932804.1|891132_891810_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_101932805.1|892196_893120_+	AEC family transporter	NA	NA	NA	NA	NA
WP_101934200.1|893124_893367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932806.1|893996_895481_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.3	1.3e-25
WP_077706321.1|895682_896615_-	hexose kinase	NA	NA	NA	NA	NA
WP_101932807.1|896925_897783_-	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_101932808.1|897794_898952_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_101932809.1|899080_899497_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_073009558.1|899540_900362_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_077706325.1|900351_901119_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_101932810.1|901144_901630_-	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_101932811.1|901865_903044_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_077706327.1|903138_903879_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101932812.1|904628_905246_+	class I SAM-dependent methyltransferase	NA	A0A0N9QQY7	Chrysochromulina_ericina_virus	32.3	5.1e-05
WP_101932813.1|905382_905919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101932814.1|906290_907475_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_101932815.1|907977_908919_-	DMT family transporter	NA	NA	NA	NA	NA
WP_101932816.1|909154_910333_+	galactokinase	NA	NA	NA	NA	NA
WP_101932817.1|910374_911883_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_101932818.1|911898_912933_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_101932819.1|913154_913625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077706335.1|913853_914477_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_101932820.1|915276_915486_-	YvrJ family protein	NA	NA	NA	NA	NA
WP_101932821.1|915915_916131_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_101932822.1|916163_916388_-	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_101932823.1|916662_917721_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_101932824.1|917914_918655_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_101932825.1|918697_919489_-	teichoic acids export ABC transporter ATP-binding subunit TagH	NA	NA	NA	NA	NA
WP_101932826.1|919518_920325_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_101934201.1|920437_922579_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_101932827.1|922779_923178_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	37.8	3.2e-16
WP_101932828.1|923170_924364_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_101932829.1|924703_925672_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101932830.1|925844_927455_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	30.6	1.7e-55
WP_101932831.1|927560_928646_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_164085341.1|928771_930808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101932833.1|931177_932294_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.1	1.2e-20
>prophage 4
NZ_CP018622	Virgibacillus dokdonensis strain 21D chromosome, complete genome	4263520	1557949	1628519	4263520	integrase,tRNA,coat,protease,transposase	Bacillus_phage(31.25%)	58	1557237:1557258	1577525:1577546
1557237:1557258	attL	AACAAATTTTATACTTTCTTAT	NA	NA	NA	NA
WP_077702084.1|1557949_1558717_+|integrase	YidC family membrane integrase SpoIIIJ	integrase	NA	NA	NA	NA
WP_077702083.1|1558713_1559328_+	protein jag	NA	NA	NA	NA	NA
WP_077702082.1|1559581_1560958_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_101933107.1|1560988_1562875_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_077702080.1|1562940_1563657_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_077702079.1|1564229_1565114_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	37.1	1.6e-15
WP_077702078.1|1565460_1566234_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.6	2.4e-23
WP_077702077.1|1566214_1567054_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	35.8	2.5e-18
WP_077702076.1|1567407_1568115_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_077702006.1|1568201_1569173_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077702075.1|1569472_1570075_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	29.3	9.1e-15
WP_101933108.1|1570163_1571189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933109.1|1571216_1572245_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_077702071.1|1573025_1573223_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_101933110.1|1573467_1574568_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_073010523.1|1574729_1575020_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_101933111.1|1575035_1575542_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	56.0	1.4e-45
WP_050350602.1|1575561_1575792_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_164085389.1|1575903_1576692_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_101933113.1|1576767_1577256_-	DUF1189 family protein	NA	NA	NA	NA	NA
WP_164085391.1|1577998_1578940_+	YybS family protein	NA	NA	NA	NA	NA
1577525:1577546	attR	ATAAGAAAGTATAAAATTTGTT	NA	NA	NA	NA
WP_101933115.1|1579313_1581284_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_101933116.1|1581280_1581727_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_077702058.1|1582067_1583426_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.7	1.6e-123
WP_077702056.1|1583961_1585248_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	35.9	8.1e-69
WP_077702295.1|1585912_1587142_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_073010498.1|1587414_1588119_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.7	5.8e-45
WP_077702051.1|1588128_1589961_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.3	8.0e-38
WP_101933117.1|1589960_1591277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933118.1|1591280_1592225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077702045.1|1592221_1593004_+	MBL fold metallo-hydrolase	NA	A0A0A0RVF5	Bacillus_phage	23.8	8.5e-13
WP_101933119.1|1593175_1594393_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.4	1.3e-20
WP_077702042.1|1594975_1595350_-	DoxX family protein	NA	NA	NA	NA	NA
WP_077702041.1|1595574_1597290_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	8.3e-53
WP_101933120.1|1597587_1598250_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_101933121.1|1598349_1599777_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_101933122.1|1599902_1600475_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073010723.1|1600656_1601004_+	ligand-binding protein SH3	NA	NA	NA	NA	NA
WP_073010466.1|1601003_1601318_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_101933123.1|1601707_1602448_+	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	25.7	4.1e-09
WP_101934229.1|1602545_1604381_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_101933124.1|1604451_1606167_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_101934230.1|1606206_1606986_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_101933125.1|1607003_1607735_+	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
WP_101933126.1|1607765_1608407_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_101933127.1|1608390_1609203_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_077702018.1|1609365_1610538_+	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	32.2	1.3e-46
WP_101933128.1|1610556_1612335_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_101933129.1|1612345_1612951_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	43.6	3.4e-25
WP_101933130.1|1613178_1613448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933131.1|1613670_1614240_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_101933132.1|1614777_1615644_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.8	1.3e-57
WP_164085393.1|1617311_1622756_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_101933134.1|1623024_1623384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933135.1|1623817_1625347_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_101933136.1|1625338_1625827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101934231.1|1625889_1626651_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_101934232.1|1628258_1628519_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP018622	Virgibacillus dokdonensis strain 21D chromosome, complete genome	4263520	2212434	2296357	4263520	terminase,integrase,tRNA,holin,portal,capsid,plate,protease,tail,transposase	Bacillus_phage(20.45%)	94	2196403:2196427	2295410:2295434
2196403:2196427	attL	ACGCTGTCGTTTTTCTTATACTATA	NA	NA	NA	NA
WP_077702498.1|2212434_2212884_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_101933376.1|2212908_2213604_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_077706820.1|2213611_2214067_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_101933377.1|2214059_2215070_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	44.4	7.0e-68
WP_077702501.1|2215273_2216446_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_077702502.1|2216727_2218656_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.2e-52
WP_073013424.1|2219003_2219666_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_077702503.1|2220097_2220298_-	YdiK family protein	NA	NA	NA	NA	NA
WP_077702504.1|2220431_2221136_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_077702505.1|2221963_2222248_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.3e-19
WP_077702506.1|2222307_2223945_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.0	1.8e-158
WP_101933378.1|2224033_2225236_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	45.6	4.3e-80
WP_164085443.1|2225239_2225401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933379.1|2225375_2225903_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	39.9	8.8e-22
WP_101933380.1|2225919_2226366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933381.1|2226370_2226844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933382.1|2227070_2227976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164085444.1|2228358_2228724_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101933384.1|2228892_2229159_+	helix-turn-helix transcriptional regulator	NA	Q6SEA0	Lactobacillus_prophage	46.0	5.6e-09
WP_101933385.1|2229170_2229902_+	phage regulatory protein	NA	A0A1B1P7T7	Bacillus_phage	40.6	5.5e-38
WP_101933386.1|2229901_2230210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933387.1|2230313_2230589_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_101933388.1|2230670_2230943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933389.1|2231041_2231257_+	hypothetical protein	NA	A0A290GDU5	Caldibacillus_phage	45.3	5.5e-07
WP_164085446.1|2231349_2231520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933390.1|2231512_2232445_+	hypothetical protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	58.8	3.0e-105
WP_101933391.1|2232446_2233259_+	recombinase RecT	NA	A0A0A7RUP3	Clostridium_phage	59.6	2.5e-84
WP_164085448.1|2233370_2233532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933392.1|2233545_2234469_+	DnaD domain protein	NA	A0EWX4	Staphylococcus_phage	26.9	6.5e-20
WP_101933393.1|2234477_2234723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933394.1|2234740_2235271_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	46.5	2.0e-34
WP_164085450.1|2235305_2235467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933395.1|2235463_2235937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933396.1|2235929_2236559_+	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	48.7	4.8e-51
WP_101933397.1|2236633_2237413_+	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	61.3	4.9e-77
WP_101933398.1|2237424_2237631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933399.1|2237630_2237813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933400.1|2237874_2238075_+	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	72.7	1.2e-19
WP_101933401.1|2238263_2238989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164085553.1|2239005_2239095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933402.1|2239185_2240070_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	32.7	1.3e-30
WP_101933403.1|2240062_2240476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933404.1|2240468_2241155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933405.1|2241256_2241784_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0B5CTZ3	Listeria_phage	22.7	1.0e-06
WP_101933406.1|2241880_2242741_+|terminase	terminase small subunit	terminase	Q5YA77	Bacillus_phage	48.0	2.9e-62
WP_101934250.1|2242761_2244069_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.6	1.1e-153
WP_101933407.1|2244071_2245607_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	49.7	5.0e-134
WP_101933408.1|2245599_2247102_+	hypothetical protein	NA	A0A249XXB6	Clostridium_phage	36.6	1.3e-41
WP_101933409.1|2247094_2247286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933410.1|2247407_2248607_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	54.7	7.5e-93
WP_101933411.1|2248622_2249552_+|capsid	phage major capsid protein	capsid	A0A249XXA7	Clostridium_phage	24.2	1.6e-05
WP_101933412.1|2249568_2249952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933413.1|2249951_2250332_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	36.9	7.8e-12
WP_101933414.1|2250328_2250685_+	DUF3599 family protein	NA	A0A249XXE9	Clostridium_phage	30.5	6.4e-08
WP_101933415.1|2250681_2251191_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.1	6.5e-38
WP_101933416.1|2251204_2251645_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_101934251.1|2251683_2251893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933417.1|2251894_2253220_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	40.8	5.9e-83
WP_101933418.1|2253247_2253694_+|tail	phage tail tube protein	tail	Q708L9	Streptococcus_phage	44.2	2.3e-23
WP_101933419.1|2253757_2254207_+|portal	phage portal protein	portal	S5MC65	Brevibacillus_phage	28.2	8.9e-07
WP_164085239.1|2254233_2254383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933420.1|2254401_2259015_+	transglycosylase SLT domain-containing protein	NA	A0A0N7ACN7	Bacillus_phage	37.1	5.5e-51
WP_101933421.1|2259007_2259673_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.8	1.1e-24
WP_101933422.1|2259702_2260674_+|portal	phage portal protein	portal	A0A2H4IZP4	uncultured_Caudovirales_phage	33.1	2.0e-35
WP_101933423.1|2260673_2261054_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_101933424.1|2261065_2261476_+	DUF2634 domain-containing protein	NA	X5JB38	Clostridium_phage	33.6	2.0e-13
WP_101933425.1|2261477_2262566_+|plate	baseplate J/gp47 family protein	plate	H7BWD5	unidentified_phage	45.7	5.7e-84
WP_101933426.1|2262549_2263137_+	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	46.6	1.7e-37
WP_101933427.1|2263129_2263411_+	ketopantoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_101933428.1|2263413_2265753_+	hypothetical protein	NA	W8CZP9	Erwinia_phage	41.6	2.7e-14
WP_164085452.1|2265774_2265912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101934252.1|2265999_2266431_+|holin	phage holin family protein	holin	R9TMD4	Paenibacillus_phage	35.5	6.3e-18
WP_101933429.1|2266488_2267568_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	50.9	6.3e-59
WP_101933430.1|2268608_2268878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933431.1|2268881_2269838_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_101932833.1|2270000_2271117_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.1	1.2e-20
WP_101933432.1|2271137_2272466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933433.1|2272467_2273634_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_101933434.1|2273810_2274026_+	hypothetical protein	NA	A0A2I7SCF7	Paenibacillus_phage	50.0	2.7e-06
WP_101933435.1|2274025_2274340_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	36.6	8.1e-07
WP_101934253.1|2275800_2276460_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_101933436.1|2276456_2276924_+	DUF2004 domain-containing protein	NA	NA	NA	NA	NA
WP_101933437.1|2277352_2277955_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	54.3	2.5e-49
WP_101933438.1|2278139_2278379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933439.1|2278770_2279805_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_101934254.1|2280482_2281523_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_101933440.1|2282724_2284080_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_101933442.1|2284861_2286343_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.7	8.0e-20
WP_101933443.1|2286459_2288340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101934255.1|2288344_2290399_-	RND family transporter	NA	NA	NA	NA	NA
WP_077702518.1|2290911_2291487_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101933221.1|2291889_2293119_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_101933444.1|2293800_2295222_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_101934256.1|2295820_2296357_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
2295410:2295434	attR	ACGCTGTCGTTTTTCTTATACTATA	NA	NA	NA	NA
>prophage 6
NZ_CP018622	Virgibacillus dokdonensis strain 21D chromosome, complete genome	4263520	2970530	3025802	4263520	integrase,tRNA,coat,tail,transposase	Streptococcus_phage(16.67%)	55	3010833:3010883	3026993:3027043
WP_077706860.1|2970530_2971529_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_101933696.1|2971855_2972899_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_077703097.1|2972921_2973971_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_101933697.1|2974315_2975518_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_101932795.1|2975793_2977023_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_073010764.1|2977545_2978130_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101933698.1|2978215_2979187_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_073010767.1|2979934_2980330_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_077703101.1|2980853_2981537_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_077703102.1|2982095_2983286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077703103.1|2983444_2985253_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	26.3	2.0e-65
WP_077703104.1|2985417_2985603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077703105.1|2986323_2987214_-	DsbA family protein	NA	NA	NA	NA	NA
WP_073010782.1|2987231_2987615_-	globin	NA	NA	NA	NA	NA
WP_077703106.1|2987734_2988301_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_077703107.1|2988469_2989078_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_077703108.1|2989281_2990088_+	NAD kinase	NA	NA	NA	NA	NA
WP_077703109.1|2990104_2990998_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_101933699.1|2990963_2991710_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A2L0UZN4	Agrobacterium_phage	28.8	6.9e-12
WP_077703111.1|2991880_2993266_+	magnesium transporter	NA	NA	NA	NA	NA
WP_077703112.1|2993783_2994245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077703113.1|2994348_2994807_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_077703114.1|2995280_2995517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077703115.1|2995628_2995832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077703116.1|2995916_2996177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101934278.1|2996222_2996915_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_077703118.1|2997399_2997825_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077703119.1|2997821_2998340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077703120.1|2998473_2999199_-	esterase family protein	NA	NA	NA	NA	NA
WP_077703121.1|2999328_3001146_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	6.8e-13
WP_077703122.1|3001135_3002872_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	3.4e-46
WP_077703123.1|3003176_3004235_+	malate permease	NA	NA	NA	NA	NA
WP_077703124.1|3004260_3005274_+	lactate dehydrogenase	NA	M1I0I9	Paramecium_bursaria_Chlorella_virus	35.0	1.1e-39
WP_077703125.1|3005553_3006609_+	malate permease	NA	NA	NA	NA	NA
WP_101933700.1|3006695_3007721_+	lactate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	31.7	2.6e-22
WP_077703127.1|3007939_3008662_-	response regulator	NA	NA	NA	NA	NA
WP_101933701.1|3008639_3010238_-	sensor histidine kinase	NA	NA	NA	NA	NA
3010833:3010883	attL	ATTGATTCTATGATTCCGTAGCTCAGCTGGGAGAGCGCCACCTTGACAGGG	NA	NA	NA	NA
WP_101933702.1|3011053_3012049_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	30.5	1.6e-11
WP_101933703.1|3012169_3012877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933704.1|3012972_3014022_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	28.3	5.8e-17
WP_101933705.1|3014480_3015041_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	52.4	4.6e-45
WP_101933706.1|3015388_3015706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164085498.1|3016508_3016715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933707.1|3017186_3017414_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	39.4	6.9e-08
WP_101933708.1|3017558_3017888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933709.1|3017881_3018178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933710.1|3018180_3018408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077703137.1|3019431_3019665_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101933711.1|3019654_3020605_+	hypothetical protein	NA	A0A0A8WF99	Clostridium_phage	27.9	4.6e-21
WP_077703139.1|3020681_3021044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164085500.1|3021506_3021704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077703142.1|3021749_3022217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933714.1|3022209_3022887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933715.1|3023076_3023388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933716.1|3023387_3025802_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	37.4	1.0e-56
3026993:3027043	attR	ATTGATTCTATGATTCCGTAGCTCAGCTGGGAGAGCGCCACCTTGACAGGG	NA	NA	NA	NA
>prophage 7
NZ_CP018622	Virgibacillus dokdonensis strain 21D chromosome, complete genome	4263520	3667405	3675489	4263520		uncultured_Caudovirales_phage(16.67%)	8	NA	NA
WP_101934294.1|3667405_3669088_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.4	3.4e-43
WP_021291310.1|3669419_3669620_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	2.6e-19
WP_101933913.1|3669935_3671606_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_077703705.1|3671605_3672220_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.8	5.1e-13
WP_077703707.1|3672223_3672745_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101933914.1|3672827_3673835_-	cell wall lytic activity	NA	A0A1V0DZX6	Clostridioides_phage	37.1	2.5e-17
WP_077703712.1|3674020_3674977_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	66.6	5.3e-126
WP_077703715.1|3675000_3675489_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	45.4	3.4e-36
>prophage 8
NZ_CP018622	Virgibacillus dokdonensis strain 21D chromosome, complete genome	4263520	3733369	3805011	4263520	terminase,holin,tRNA,portal,protease,coat,tail,head,transposase	uncultured_Caudovirales_phage(27.78%)	80	NA	NA
WP_101933935.1|3733369_3734767_+|transposase	IS5/IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	36.7	8.9e-21
WP_101933936.1|3734936_3736943_-	transketolase	NA	NA	NA	NA	NA
WP_101933937.1|3737043_3737277_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_077703863.1|3738386_3739010_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	1.6e-17
WP_101933938.1|3739075_3739894_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101933939.1|3740168_3741509_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_101934296.1|3742781_3743531_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	34.4	9.6e-30
WP_101934297.1|3744163_3744370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101933940.1|3744379_3744742_+	ABC transporter	NA	NA	NA	NA	NA
WP_101933941.1|3745004_3745589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933942.1|3745575_3746148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933943.1|3746107_3747373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933944.1|3747548_3748817_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2P1JU23	Anoxybacillus_phage	53.8	1.3e-55
WP_101933945.1|3748887_3749685_-	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	42.0	1.5e-36
WP_101933946.1|3749760_3750024_-|holin	phage holin	holin	A0A1Q1PW49	Staphylococcus_phage	50.6	2.7e-19
WP_101933947.1|3750093_3750375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933948.1|3750410_3750635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164085527.1|3750615_3750792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933949.1|3750792_3753588_-	hypothetical protein	NA	A0A142F1N2	Bacillus_phage	50.6	1.1e-99
WP_101933950.1|3753599_3755036_-|tail	phage tail family protein	tail	A0A2H4JH21	uncultured_Caudovirales_phage	28.8	2.2e-51
WP_164085528.1|3755028_3758907_-|tail	phage tail tape measure protein	tail	H9A124	Staphylococcus_phage	50.6	1.2e-110
WP_164085529.1|3758943_3759090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077704950.1|3759128_3759491_-	hypothetical protein	NA	A0A2H4JH57	uncultured_Caudovirales_phage	38.1	5.1e-13
WP_101933952.1|3759536_3760100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933953.1|3760099_3760720_-|tail	phage tail protein	tail	A0A2H4JCT8	uncultured_Caudovirales_phage	55.5	1.4e-55
WP_101933954.1|3760751_3761135_-	DUF3168 domain-containing protein	NA	A8ATA3	Listeria_phage	40.3	1.1e-16
WP_101933955.1|3761134_3761527_-	hypothetical protein	NA	A0A2H4JA97	uncultured_Caudovirales_phage	52.7	1.8e-32
WP_101933956.1|3761523_3761901_-|head,tail	phage head-tail adapter protein	head,tail	A8ATA1	Listeria_phage	47.4	1.4e-24
WP_101934298.1|3761878_3762145_-	hypothetical protein	NA	A0A059T7R0	Listeria_phage	56.5	2.1e-19
WP_101934299.1|3763339_3764080_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	63.5	2.9e-71
WP_101932320.1|3764106_3765249_-|portal	phage portal protein	portal	A0A2H4JBZ5	uncultured_Caudovirales_phage	54.8	1.5e-119
WP_101933957.1|3765253_3766924_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	64.7	7.7e-213
WP_077704973.1|3766920_3767223_-|terminase	terminase	terminase	A0A0U4B062	Bacillus_phage	68.6	2.1e-28
WP_164085530.1|3767332_3767485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933958.1|3767489_3767840_-	HNH endonuclease	NA	A0A0U4JWW4	Bacillus_phage	56.6	3.9e-26
WP_101933960.1|3768106_3768703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933961.1|3768823_3769273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073010707.1|3769429_3769633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933962.1|3769689_3770349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933963.1|3770625_3771021_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WG73	Bacillus_phage	56.5	1.1e-37
WP_164085531.1|3771035_3771212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933964.1|3771547_3773404_-	DNA primase	NA	A0A2H4J1M0	uncultured_Caudovirales_phage	27.5	6.4e-59
WP_101933965.1|3773443_3773746_-	hypothetical protein	NA	L7TJ47	Halovirus	47.5	1.8e-16
WP_101933966.1|3773742_3774087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933967.1|3774112_3775837_-	DNA polymerase B	NA	A0A2H4J041	uncultured_Caudovirales_phage	32.3	4.2e-65
WP_101933968.1|3775854_3776298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164085532.1|3776297_3776438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933969.1|3776441_3777359_-	AAA family ATPase	NA	A0A141DZQ7	Streptococcus_phage	46.0	2.3e-49
WP_101933970.1|3777524_3777854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933971.1|3777854_3778754_-	endonuclease	NA	D2IYT8	Enterococcus_phage	23.3	1.1e-08
WP_101934300.1|3778750_3779950_-	DEAD/DEAH box helicase	NA	A0A2L1IWF6	Streptomyces_phage	23.8	3.5e-18
WP_101933972.1|3779939_3780236_-	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	39.1	2.1e-09
WP_101933973.1|3780232_3780649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933974.1|3780737_3781040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164085533.1|3781521_3781686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933976.1|3781692_3781989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933977.1|3782088_3782349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933978.1|3782411_3782720_+	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	50.0	2.1e-15
WP_101933979.1|3782700_3782934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164085534.1|3783342_3783504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933980.1|3783565_3783823_-	helix-turn-helix transcriptional regulator	NA	Q8SBM9	Clostridium_phage	64.8	1.3e-15
WP_101933981.1|3784011_3784659_+	LexA family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	46.1	7.2e-42
WP_101933982.1|3784725_3786156_+	recombinase family protein	NA	A0A2H4J3Q1	uncultured_Caudovirales_phage	28.4	3.0e-48
WP_101933983.1|3786152_3786548_-|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_077706897.1|3786587_3786839_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_077703878.1|3786843_3787071_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_077703881.1|3787264_3787504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077703884.1|3789363_3790701_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_073004905.1|3791055_3791484_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	35.6	3.2e-06
WP_101933984.1|3791685_3792924_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_101933985.1|3792928_3794161_-	GTPase HflX	NA	NA	NA	NA	NA
WP_077703895.1|3794493_3795420_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	40.7	1.4e-46
WP_073004912.1|3795631_3795856_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_101933986.1|3795899_3796832_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_077706898.1|3796856_3797303_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_101933987.1|3797362_3799273_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.0	9.8e-71
WP_101933988.1|3799363_3801955_-	DNA mismatch repair protein MutS	NA	E5RUN9	Heterocapsa_circularisquama_DNA_virus	23.7	1.1e-37
WP_077703907.1|3802193_3802757_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_077703909.1|3803002_3803431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101933989.1|3803433_3805011_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP018622	Virgibacillus dokdonensis strain 21D chromosome, complete genome	4263520	4251162	4261950	4263520	tail,holin	Paenibacillus_phage(57.14%)	8	NA	NA
WP_101934158.1|4251162_4252254_-	hypothetical protein	NA	D6QWN1	uncultured_phage	54.5	3.4e-44
WP_101934310.1|4252309_4252741_-|holin	phage holin family protein	holin	R9TMD4	Paenibacillus_phage	36.9	2.6e-19
WP_101934159.1|4253014_4253701_-	hypothetical protein	NA	D2XR29	Bacillus_phage	34.6	6.3e-28
WP_101934160.1|4253811_4254738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101934311.1|4254839_4255946_-	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	42.7	5.1e-88
WP_101934161.1|4255947_4257222_-	hypothetical protein	NA	A0A0C5ABC3	Paenibacillus_phage	67.0	1.3e-66
WP_101934162.1|4257225_4258077_-|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	46.2	1.2e-65
WP_164085543.1|4258083_4261950_-|tail	phage tail tape measure protein	tail	H9A124	Staphylococcus_phage	50.6	8.8e-111
