The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	82119	229233	2870954	transposase,holin,tRNA	Streptococcus_phage(13.51%)	124	NA	NA
WP_002298563.1|82119_82866_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002301399.1|83538_84498_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002326711.1|84872_86051_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002317041.1|86395_86734_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_002348801.1|86868_87270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317547.1|87381_88002_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002294300.1|88092_90762_-	YfhO family protein	NA	NA	NA	NA	NA
WP_002290463.1|90999_91188_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002294298.1|91457_91820_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002301169.1|91871_93554_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002301167.1|93670_95707_+	ATP-dependent DNA helicase RecG	NA	A0A2H4JBQ0	uncultured_Caudovirales_phage	22.9	5.3e-06
WP_002289721.1|95755_96757_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002294295.1|96878_97121_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002287889.1|97388_98393_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	5.1e-18
WP_002287891.1|98393_99338_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	3.9e-20
WP_002287892.1|99337_100300_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287893.1|100326_101241_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287894.1|101266_103048_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287896.1|103395_104082_+	ribonuclease III	NA	K7YH73	Megavirus	32.3	9.1e-27
WP_002301166.1|104101_107683_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_002348798.1|107691_108501_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002301165.1|108512_109511_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_101701466.1|109697_111965_+	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_002326066.1|112148_113102_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294287.1|113119_113572_-	YueI family protein	NA	NA	NA	NA	NA
WP_002294286.1|113721_114672_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.5	1.6e-66
WP_002301163.1|114664_115624_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002301162.1|115620_116376_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	2.2e-13
WP_002301160.1|116398_117352_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287909.1|117995_118292_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
WP_002287910.1|118647_119004_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002348747.1|119013_119913_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010782507.1|120145_121105_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_010782508.1|121362_122808_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	2.2e-123
WP_002348590.1|122853_123588_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_002301190.1|123913_124324_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002294273.1|124316_125018_+	LrgB family protein	NA	NA	NA	NA	NA
WP_002348592.1|125017_126631_+	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
WP_002290506.1|126620_126842_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	33.3	1.1e-05
WP_002297929.1|126838_127600_+	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.7	1.2e-16
WP_002294268.1|127980_128490_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	31.8	7.5e-10
WP_002294267.1|128559_129099_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002294265.1|129238_129850_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002324284.1|130165_130963_+	formate/nitrite transporter	NA	NA	NA	NA	NA
WP_002294262.1|130990_131626_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002294261.1|131645_132419_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002348595.1|132826_133624_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297923.1|133601_134015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294258.1|133998_136644_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.6e-39
WP_002301736.1|136661_138770_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.8e-57
WP_002348596.1|138791_139352_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002297218.1|139490_140786_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002285758.1|141045_141240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|141229_141583_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|141684_143232_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002348864.1|143311_145300_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002294254.1|145522_146236_+	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002294252.1|146312_146759_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002290528.1|146928_147531_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002289812.1|147543_148545_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_002341570.1|148573_149152_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294249.1|149203_149686_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002289815.1|149802_150177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294246.1|150976_152329_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002297079.1|152475_153066_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_002294242.1|153193_154543_-	amino acid permease	NA	NA	NA	NA	NA
WP_002294240.1|154710_155451_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	5.5e-30
WP_002297081.1|155463_157056_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002293448.1|157623_157920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294236.1|158095_158821_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_002301156.1|158813_159656_+	chorismate mutase	NA	NA	NA	NA	NA
WP_002294232.1|159658_160180_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002289284.1|160432_160996_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	2.3e-12
WP_002289282.1|161246_161516_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002297086.1|161703_163830_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002289280.1|164339_164606_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002289279.1|164749_166741_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.9	8.4e-65
WP_002294228.1|167094_168396_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002326809.1|168771_170067_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_010782510.1|170134_171313_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	39.9	3.8e-65
WP_002289277.1|171659_173030_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002289744.1|173211_173535_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002299254.1|173859_174468_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_002348768.1|174797_175514_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_002289749.1|175526_176222_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_002289751.1|176305_176935_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.2	3.1e-34
WP_086953915.1|177449_178788_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002294220.1|178857_179460_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	30.6	3.6e-19
WP_002296548.1|179481_179970_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002294217.1|180290_181664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294214.1|181647_182115_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_002329999.1|182363_184109_-	AarF/ABC1/UbiB kinase family protein	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.1	1.3e-40
WP_002293424.1|184304_185381_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002317074.1|185533_186886_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_086272912.1|187201_188719_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.2	1.3e-62
WP_002294209.1|188848_189199_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002294207.1|189214_190336_+	alanine racemase	NA	NA	NA	NA	NA
WP_002289874.1|190346_190709_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	37.8	7.6e-09
WP_002293413.1|190884_191154_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002294206.1|191343_192291_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016171130.1|192436_193732_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.2	1.1e-09
WP_002301399.1|193998_194958_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002294203.1|195183_197889_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_002294202.1|198485_200309_+	APC family permease	NA	NA	NA	NA	NA
WP_002348885.1|200450_200636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294199.1|201110_201374_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002301121.1|201373_201640_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002301116.1|202870_203542_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002301114.1|203538_204456_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293405.1|204452_205094_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002348889.1|205097_206273_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.0e-17
WP_002350806.1|206465_207497_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002341590.1|209173_210127_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002319878.1|210217_211513_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_002326809.1|211674_212970_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289743.1|213679_216319_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.2	1.6e-84
WP_002294185.1|216486_217185_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002341590.1|217287_218241_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294183.1|218469_219615_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002300794.1|219711_220092_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_010782512.1|220396_222994_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010782513.1|222901_224512_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	8.4e-124
WP_002300788.1|226789_227269_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_086953915.1|227894_229233_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 2
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	260579	268316	2870954		Streptococcus_phage(66.67%)	6	NA	NA
WP_002297361.1|260579_262439_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_000398284.1|262995_264201_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_002286940.1|264984_266895_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_032509114.1|266998_267223_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	97.1	8.5e-27
WP_002345010.1|267339_267837_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	97.6	1.3e-88
WP_002345009.1|267923_268316_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	4.6e-68
>prophage 3
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	283893	332057	2870954	tRNA,transposase	Streptococcus_phage(33.33%)	44	NA	NA
WP_002354485.1|283893_284580_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002348732.1|284731_287773_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.2	4.0e-18
WP_002348733.1|287962_288547_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_010782519.1|288543_289683_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002336644.1|290060_292103_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002336645.1|292113_292734_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002336646.1|292745_293204_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002331203.1|293222_293501_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002336647.1|293525_294893_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002331205.1|294907_296053_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	1.2e-52
WP_002331206.1|296079_296571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002345001.1|297013_298213_+	MFS transporter	NA	NA	NA	NA	NA
WP_002331208.1|298707_299466_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002331209.1|299633_300569_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002336649.1|300565_302011_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002336650.1|302038_302494_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002336651.1|302512_303487_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002336652.1|304302_304917_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002331215.1|305157_305541_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301781.1|305903_306413_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002296570.1|306512_307163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291914.1|307613_308552_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002291912.1|308564_309617_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296392.1|309882_310518_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002296391.1|310708_311500_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002326839.1|311979_312888_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002295755.1|312943_313441_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002340421.1|313477_314161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296262.1|314507_314774_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002296261.1|314800_315100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296259.1|315273_315825_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002296258.1|315970_316264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304106.1|316256_316553_+	peptidase	NA	NA	NA	NA	NA
WP_002296256.1|316627_317626_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|317717_318671_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294735.1|318769_319486_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002296623.1|319684_320980_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_025478783.1|321026_323075_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_002294732.1|324284_325526_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002294730.1|325672_326308_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294728.1|326498_327239_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002296909.1|327383_329021_-	membrane protein	NA	NA	NA	NA	NA
WP_000195429.1|329232_330405_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000997695.1|330878_332057_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	766537	775009	2870954		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|766537_767182_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|767196_767526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|767539_768478_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|768513_769338_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|769330_769678_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|769746_770619_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|770727_771849_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|771902_772505_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|772819_775009_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 5
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	831048	910159	2870954	integrase,terminase,portal,capsid,head,holin,tRNA,protease,tail,transposase	Enterococcus_phage(25.64%)	95	887943:887958	891296:891311
WP_002286621.1|831048_833847_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|833895_835422_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|835436_836084_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|836267_836597_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|836773_837502_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|837517_838531_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|838530_839808_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|839870_842573_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|842724_843042_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|843071_843392_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|843477_844938_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|845005_845227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|845257_845440_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|845439_845853_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|845975_847157_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|847687_848827_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|849125_849761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|849873_850509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|850542_851004_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002348715.1|851133_851565_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|851582_851903_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|852201_852978_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|852992_853196_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|853211_853550_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|853536_853716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|853758_854229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|854315_855014_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|855191_855533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|855525_856197_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|856202_856889_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|856891_857641_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|857652_857922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|858083_858386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|858382_858544_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|858540_858846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|858845_859202_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|859161_859407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|859403_859823_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|859819_860377_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|860373_860670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|860746_861160_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002300143.1|861617_861893_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|862346_862553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|862748_862916_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|862941_863286_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|863290_863572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|863674_863989_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|863966_865661_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|865680_866859_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|866821_867508_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|867507_868668_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|868677_869553_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|869549_869861_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|869850_870204_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|870193_870595_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|870587_870992_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|871003_871612_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|871631_871994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|871996_872179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348716.1|872195_875627_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|875677_876415_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002286497.1|876424_878716_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.0	9.6e-89
WP_002286495.1|878739_880866_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286491.1|881028_881475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|881476_881614_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|881651_881945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|881941_882166_+|holin	holin	holin	NA	NA	NA	NA
WP_002349643.1|882162_883188_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_087046766.1|884127_885289_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002324322.1|886176_887355_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002286474.1|887545_887953_+	hypothetical protein	NA	NA	NA	NA	NA
887943:887958	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|887966_888368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|888369_888741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|888776_889079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076005172.1|889327_889528_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_070571278.1|889832_891065_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|891321_891891_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
891296:891311	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002297963.1|892068_892509_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|892666_893431_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|893462_894386_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|894461_895601_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|895593_896394_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|896393_897221_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|897198_897933_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|898032_898899_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|898912_899485_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|899506_900535_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|900632_901484_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002348826.1|901517_903551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348825.1|903594_904875_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002285758.1|905111_905306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|905295_905649_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|905750_907298_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_101701468.1|907336_908620_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	1.2e-08
WP_010782578.1|908884_910159_-|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	8.6e-55
>prophage 6
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	1081987	1138109	2870954	tRNA,protease,transposase	Lysinibacillus_phage(25.0%)	54	NA	NA
WP_002297218.1|1081987_1083283_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002321398.1|1083518_1085618_+	TFIIB-type zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002290060.1|1085813_1086677_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_002322512.1|1086781_1087255_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002297218.1|1087321_1088617_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294386.1|1088872_1089760_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	1.2e-31
WP_002294387.1|1089778_1090150_+	protein RibT	NA	NA	NA	NA	NA
WP_002305297.1|1090119_1090917_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.0	6.4e-08
WP_002296975.1|1090900_1091470_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	1.5e-14
WP_002294391.1|1091475_1092192_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002296977.1|1092521_1093133_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002290168.1|1093510_1095034_+	YfcC family protein	NA	NA	NA	NA	NA
WP_002294399.1|1095270_1096611_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_002294400.1|1096763_1097501_+	thioesterase	NA	NA	NA	NA	NA
WP_002294401.1|1097665_1097887_-	ferredoxin	NA	NA	NA	NA	NA
WP_002305295.1|1097917_1098949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303122.1|1098935_1100339_+	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	6.5e-64
WP_002294404.1|1100404_1101040_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002303123.1|1101088_1101769_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002294406.1|1101903_1103133_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002296982.1|1103314_1104625_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002290178.1|1104867_1105143_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	69.7	1.8e-26
WP_101701469.1|1105278_1106574_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002297185.1|1106890_1108186_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002294410.1|1108421_1109468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289879.1|1109469_1110729_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002289878.1|1110734_1111316_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_002294412.1|1111397_1112273_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.3	5.9e-63
WP_002290045.1|1112420_1112753_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002294414.1|1112864_1114073_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.7	1.5e-45
WP_002290187.1|1114226_1114682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1114875_1116171_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290188.1|1116565_1116841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288388.1|1116853_1118932_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002288390.1|1119091_1120978_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.6e-52
WP_002294416.1|1120989_1121937_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	7.1e-123
WP_002288392.1|1121956_1122484_+	dihydrofolate reductase	NA	A0A1D6X864	Bacillus_phage	37.1	6.7e-22
WP_002288393.1|1122546_1123200_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002288394.1|1123331_1124174_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.2	6.5e-19
WP_002288395.1|1124331_1125228_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288396.1|1125230_1125944_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002288397.1|1125963_1126482_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288398.1|1126478_1126706_+	YozE family protein	NA	NA	NA	NA	NA
WP_002294418.1|1126857_1127409_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002288403.1|1127491_1128034_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002288405.1|1128270_1128669_-	glyoxalase	NA	NA	NA	NA	NA
WP_002296988.1|1128928_1129789_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002296990.1|1129781_1130549_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.5	2.7e-27
WP_002303743.1|1130604_1131462_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002288411.1|1131583_1133662_+	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	38.5	1.2e-101
WP_002320953.1|1133630_1135007_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002288415.1|1135204_1136110_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	9.4e-32
WP_002288419.1|1136146_1136695_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_002288421.1|1136708_1138109_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.8	1.7e-43
>prophage 7
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	1202920	1211981	2870954		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1202920_1204216_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1204395_1204773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1205028_1205757_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1205756_1206011_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1206012_1206684_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1206684_1208907_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1208891_1210331_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|1210362_1211406_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1211402_1211981_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 8
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	1495382	1544400	2870954	protease,transposase	Streptococcus_phage(23.08%)	58	NA	NA
WP_010729485.1|1495382_1496918_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	1.4e-123
WP_002295142.1|1497141_1497513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1497768_1498011_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1498042_1498945_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1498957_1499146_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1499159_1499723_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1499760_1500654_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002296674.1|1500731_1501670_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1501703_1502054_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1502086_1502989_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1502981_1503839_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002348903.1|1504172_1504982_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1505021_1505519_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1506163_1506487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1506650_1506905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1506974_1507220_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002348902.1|1507316_1507661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1507721_1508285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293303.1|1508852_1509053_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002302440.1|1509675_1510977_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296656.1|1511305_1512019_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1512011_1513097_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1513113_1513557_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1513590_1513944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1514055_1514457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1514493_1515003_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1515024_1515882_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1515899_1516733_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1516746_1517544_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1517576_1517861_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1517857_1518859_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002296640.1|1518860_1519763_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
WP_002296639.1|1519926_1520775_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1521420_1521627_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1521828_1522830_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1522834_1524748_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1524915_1525422_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1525581_1526022_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1526047_1527205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1527207_1527564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1527861_1528836_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1529031_1529871_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1530055_1530943_+	rotamase	NA	NA	NA	NA	NA
WP_002311093.1|1531526_1532222_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1532205_1532604_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|1533012_1534263_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002289425.1|1534404_1535400_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1535417_1535972_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|1535959_1536451_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348791.1|1536443_1538312_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1538330_1539131_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002305631.1|1539323_1539569_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1539707_1540193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1540648_1541062_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002322258.1|1541198_1541459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321532.1|1541576_1541867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1542112_1543291_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1543446_1544400_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	1680092	1777993	2870954	head,terminase,plate,capsid,portal,integrase,holin,tRNA,protease,tail,transposase	Enterococcus_phage(17.39%)	113	1757125:1757143	1774236:1774254
WP_002288520.1|1680092_1681016_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002294143.1|1684193_1684415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294142.1|1684522_1684870_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002294141.1|1684896_1687203_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|1687215_1687527_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|1687523_1687817_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002301262.1|1687838_1689014_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|1689037_1689511_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002294138.1|1689654_1694007_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	41.4	3.9e-22
WP_002294137.1|1694218_1695928_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1695995_1697264_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1697424_1698225_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1698221_1699034_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002287107.1|1699442_1700693_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002293875.1|1701011_1701569_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1701571_1702294_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1702429_1703311_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1703409_1704192_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1704550_1705030_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1705246_1706338_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002326699.1|1706330_1706459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|1706462_1707008_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002288432.1|1707460_1709152_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1709570_1710518_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1710632_1711652_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1711742_1712972_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1713432_1714134_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326809.1|1714305_1715601_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002301319.1|1716264_1717281_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1717277_1717742_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002348676.1|1717748_1718291_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1718274_1719099_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1719187_1720168_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1720191_1721676_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1721687_1722677_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1722924_1723092_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1723153_1724965_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1724961_1725327_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1725489_1725885_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1725902_1726865_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1726864_1727077_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1727097_1727796_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1727815_1728358_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1728489_1729494_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1729490_1730480_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1730476_1731283_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_010782564.1|1731448_1732405_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1732481_1733000_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1733087_1733237_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1733464_1733911_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|1734105_1736001_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1736325_1737300_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_086953915.1|1738105_1739445_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_084201531.1|1739515_1740541_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_002286683.1|1740537_1740762_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|1740758_1741052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298029.1|1741089_1741227_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002350774.1|1741226_1741634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|1741661_1742186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350775.1|1742185_1742635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|1742638_1743256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|1743255_1744164_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_069314735.1|1744176_1746936_-	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.6	6.8e-49
WP_069314753.1|1746932_1747637_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069314734.1|1747648_1749952_-|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	48.3	2.1e-83
WP_069314733.1|1750146_1750611_-	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	40.3	1.7e-16
WP_069314732.1|1750610_1751237_-|tail	phage tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	4.4e-28
WP_069314731.1|1751243_1751609_-	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	41.1	7.7e-17
WP_010725764.1|1751598_1751937_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	47.7	6.6e-23
WP_069314730.1|1751926_1752253_-|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	1.7e-23
WP_002301326.1|1752233_1752512_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	3.5e-22
WP_084201525.1|1752513_1753878_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.4	2.9e-125
WP_084201523.1|1753890_1754466_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	68.4	1.1e-65
WP_099745849.1|1754431_1755661_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	65.5	2.7e-146
WP_069314727.1|1755682_1757410_-|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	7.6e-264
1757125:1757143	attL	CTTTTTCATTTTCTTTAAC	NA	NA	NA	NA
WP_002301332.1|1757406_1757859_-	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	68.5	8.0e-48
WP_002317992.1|1757970_1758351_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	67.2	9.1e-45
WP_069314726.1|1758347_1758734_-	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	37.3	8.7e-11
WP_069314725.1|1758714_1759101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154212406.1|1759405_1759549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010725701.1|1759873_1760341_-	ArpU family phage transcriptional regulator	NA	D7RWH7	Brochothrix_phage	29.1	2.4e-07
WP_050397116.1|1760415_1760856_-	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	37.7	9.0e-20
WP_069314724.1|1760885_1761179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002309099.1|1761175_1761379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314723.1|1761385_1761616_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_069314722.1|1761782_1762073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314721.1|1762083_1762659_-	DUF1642 domain-containing protein	NA	A0A0E3T929	Enterococcus_phage	32.1	2.1e-16
WP_048946628.1|1762969_1763188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314720.1|1763184_1763709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314719.1|1763708_1763999_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	42.4	2.4e-13
WP_084205653.1|1763998_1764304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314717.1|1764300_1764462_-	antitoxin	NA	NA	NA	NA	NA
WP_010721325.1|1764458_1764761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314716.1|1764922_1765192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314715.1|1765203_1766055_-	replication protein	NA	A0A1S5SFJ6	Streptococcus_phage	67.1	2.1e-49
WP_069314714.1|1766061_1766748_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	70.0	2.2e-89
WP_002286557.1|1766753_1767425_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|1767417_1767759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|1767936_1768635_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|1768721_1769192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314713.1|1769234_1769414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342110.1|1769426_1769693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353431.1|1769703_1769898_-	hypothetical protein	NA	M1IFE9	Streptococcus_phage	53.1	1.1e-11
WP_033655448.1|1770202_1770622_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	62.3	3.0e-41
WP_069314712.1|1770638_1771061_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	50.7	3.6e-34
WP_002317583.1|1771089_1771290_+	hypothetical protein	NA	A0A097BY73	Enterococcus_phage	87.9	2.5e-25
WP_069314711.1|1771375_1771816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314710.1|1771953_1773159_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	37.4	7.3e-64
WP_002296332.1|1773442_1774009_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348678.1|1774264_1775596_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
1774236:1774254	attR	GTTAAAGAAAATGAAAAAG	NA	NA	NA	NA
WP_002296335.1|1775561_1775912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296337.1|1776423_1776768_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1777033_1777993_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
>prophage 10
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	1782055	1918731	2870954	tRNA,transposase	Streptococcus_phage(29.41%)	119	NA	NA
WP_002311774.1|1782055_1783015_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|1783227_1784136_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|1784184_1784571_+	YxeA family protein	NA	NA	NA	NA	NA
WP_000122610.1|1784874_1786167_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002288574.1|1786385_1787732_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1787843_1789193_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|1789309_1790563_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|1790633_1791119_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288579.1|1791141_1791900_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1791915_1793094_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1793323_1795444_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002296838.1|1795666_1796392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1796381_1796891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1796960_1798409_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1798408_1799125_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1799105_1799456_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1799599_1800373_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1801129_1801432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1801870_1803049_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1803385_1803625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1803986_1804247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1804431_1804929_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1805058_1805769_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1805781_1807446_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1807650_1808313_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1808322_1809138_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1809399_1809843_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1809976_1810315_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302962.1|1810302_1810680_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322902.1|1810903_1812097_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1812262_1812685_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002303955.1|1813273_1813729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1813890_1815063_-	class C sortase	NA	NA	NA	NA	NA
WP_002303963.1|1818193_1820521_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002296840.1|1820795_1821983_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288970.1|1822840_1823134_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002286913.1|1823391_1823739_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1823874_1824636_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1824625_1825147_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1825316_1826108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1826232_1826484_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1826495_1826771_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1827023_1827578_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1827656_1828178_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1828181_1828760_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1828871_1830290_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1830310_1830649_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1830608_1831112_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1831242_1831947_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002303966.1|1831943_1833680_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|1833782_1836254_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002326707.1|1836526_1837801_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002289807.1|1838087_1838978_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002300070.1|1839174_1839657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1839864_1840230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326708.1|1840320_1840638_-	SdpI family protein	NA	NA	NA	NA	NA
WP_010782561.1|1841379_1842339_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002301623.1|1842461_1843436_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002297404.1|1843845_1845096_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1845381_1845639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1845870_1846284_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002324322.1|1846422_1847601_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002326711.1|1847873_1849052_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002295743.1|1849212_1850122_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_099098442.1|1850423_1851586_-|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_099745852.1|1851690_1853029_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	3.4e-78
WP_002301695.1|1853069_1853762_-	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	43.4	4.0e-30
WP_002294835.1|1854198_1854768_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002304701.1|1854841_1855165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294839.1|1855318_1856131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|1856484_1857333_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002304699.1|1857477_1858419_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002299539.1|1862213_1864385_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002312937.1|1864404_1866591_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	5.3e-121
WP_002289040.1|1866590_1866800_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002294855.1|1866812_1867253_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002304690.1|1867326_1867866_-	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002288779.1|1868480_1869947_-	amino acid permease	NA	NA	NA	NA	NA
WP_002304688.1|1870257_1872339_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.6	2.4e-115
WP_002288776.1|1872862_1873222_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002326717.1|1873251_1873593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304684.1|1873589_1874264_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288767.1|1875316_1876615_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002304682.1|1876654_1877845_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002348809.1|1877865_1878393_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002304681.1|1878439_1881229_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002288762.1|1881375_1881576_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002323868.1|1882027_1882348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1882625_1883921_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288760.1|1884372_1885491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304680.1|1885961_1887269_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002340453.1|1887387_1888587_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002289547.1|1888613_1889882_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.2e-42
WP_002348853.1|1891098_1891602_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002294889.1|1891724_1892489_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289551.1|1892596_1892872_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002312285.1|1893309_1894260_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002312284.1|1894438_1894639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782560.1|1895443_1896403_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002312282.1|1897268_1897799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312281.1|1897795_1898413_-	VanZ family protein	NA	NA	NA	NA	NA
WP_002312280.1|1898994_1899216_-	transferase	NA	NA	NA	NA	NA
WP_002348669.1|1899393_1900926_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002312276.1|1901061_1902147_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002312275.1|1902161_1902881_-	glycosyl transferase	NA	A0A2K9L639	Tupanvirus	25.0	2.6e-08
WP_002312274.1|1902877_1904188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348666.1|1904214_1904805_-	poly-gamma-glutamate biosynthesis protein	NA	NA	NA	NA	NA
WP_002312270.1|1905122_1906184_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.5	1.5e-12
WP_002312264.1|1906751_1907819_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002291721.1|1907838_1908318_-	EpsH	NA	NA	NA	NA	NA
WP_002325817.1|1908334_1908796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312259.1|1908809_1910060_-	nucleotide sugar dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	50.4	8.9e-105
WP_002312258.1|1910437_1911889_-	sugar transferase	NA	NA	NA	NA	NA
WP_002312256.1|1912209_1912974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348664.1|1913001_1913700_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	37.1	6.0e-26
WP_002348663.1|1913711_1914491_-	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_002296209.1|1914506_1915451_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002348662.1|1915496_1916276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348661.1|1916655_1918731_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	2094641	2120663	2870954	plate,holin,tRNA,tail,transposase	Bacillus_phage(33.33%)	29	NA	NA
WP_000222572.1|2094641_2095595_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289406.1|2095628_2096858_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|2096859_2097777_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|2097780_2098518_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|2098608_2099136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|2099315_2099909_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|2100012_2100498_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|2100650_2100848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|2100942_2102703_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|2102699_2104430_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|2104822_2105035_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|2105036_2106716_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|2106969_2107170_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002347086.1|2108245_2108644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305550.1|2108636_2109089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002318238.1|2109075_2109582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324322.1|2109686_2110865_+|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2111093_2112433_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002312527.1|2112502_2113528_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	3.6e-64
WP_002286683.1|2113524_2113749_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|2113745_2114039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298029.1|2114076_2114214_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002350774.1|2114213_2114621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|2114648_2115173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350775.1|2115172_2115622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|2115625_2116243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|2116242_2117151_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002347081.1|2117163_2119926_-	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002303299.1|2119922_2120663_-|tail	tail protein	tail	NA	NA	NA	NA
>prophage 12
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	2124024	2173071	2870954	head,terminase,portal,tRNA,tail,transposase	Enterococcus_phage(26.09%)	55	NA	NA
WP_002303295.1|2124024_2124633_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002298045.1|2124633_2125011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298046.1|2125012_2125408_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002298048.1|2125400_2125772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|2125771_2126113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311614.1|2126124_2126340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312521.1|2126362_2127253_-	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002350777.1|2127267_2127969_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002304492.1|2128017_2128335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033582200.1|2128336_2129215_-|head	phage head morphogenesis protein	head	NA	NA	NA	NA
WP_002343932.1|2129294_2130830_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_002304486.1|2130841_2132260_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	51.5	2.5e-124
WP_002304484.1|2132237_2132666_-	hypothetical protein	NA	A0A1P8BMH5	Lactococcus_phage	63.1	2.6e-40
WP_002311618.1|2132683_2132908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304480.1|2133458_2133845_-	hypothetical protein	NA	O34053	Streptococcus_phage	55.2	1.9e-29
WP_002322045.1|2133857_2134271_-	autolysin	NA	C9E2P5	Enterococcus_phage	80.3	2.5e-56
WP_002286693.1|2134347_2134644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304475.1|2134640_2134844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304474.1|2134850_2135081_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_002304473.1|2135077_2135389_-	hypothetical protein	NA	A0A0D3MVS9	Staphylococcus_phage	58.0	5.3e-27
WP_002304472.1|2135527_2136343_-	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.4	1.8e-82
WP_002350868.1|2136339_2136666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292988.1|2136662_2136824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304469.1|2136838_2137198_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	47.5	6.8e-18
WP_002304468.1|2137194_2138046_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	3.0e-27
WP_002303278.1|2138060_2138861_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002303277.1|2138903_2139794_-	hypothetical protein	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303275.1|2139795_2140737_-	endonuclease	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303273.1|2140969_2141305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304466.1|2141556_2141796_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	1.8e-27
WP_002299038.1|2142104_2142260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304464.1|2142331_2142562_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002303266.1|2142729_2142996_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002303265.1|2143195_2143900_+	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303264.1|2143986_2145276_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303263.1|2145341_2146694_+	recombinase family protein	NA	D2IZV7	Enterococcus_phage	55.3	1.7e-133
WP_002304462.1|2146588_2147260_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002287951.1|2147314_2147968_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|2147957_2149271_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|2149580_2152226_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002287954.1|2152618_2153266_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287955.1|2153838_2155050_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287956.1|2155065_2156208_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287957.1|2156372_2158094_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287958.1|2158292_2158853_-	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287959.1|2158878_2159718_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287960.1|2159751_2160585_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287961.1|2160816_2161785_+	asparaginase	NA	NA	NA	NA	NA
WP_002287962.1|2161939_2162677_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287963.1|2162692_2163526_-	phosphotransferase	NA	NA	NA	NA	NA
WP_002294080.1|2163727_2165056_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002348865.1|2166145_2166775_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002287966.1|2166888_2167263_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_086956687.1|2167471_2168633_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_086953915.1|2171732_2173071_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 13
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	2322062	2352263	2870954	protease,bacteriocin,transposase	Bacillus_phage(30.0%)	28	NA	NA
WP_002324322.1|2322062_2323241_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002287305.1|2323507_2323870_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002294124.1|2324092_2324845_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294125.1|2324984_2325908_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287308.1|2325922_2326195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290607.1|2326664_2328290_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	4.9e-156
WP_002288862.1|2328340_2328625_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	40.2	2.0e-12
WP_002288860.1|2328849_2329512_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002303458.1|2329587_2330880_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303461.1|2331049_2331679_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|2331781_2332591_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002305460.1|2332645_2333515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288852.1|2333515_2334832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294131.1|2334828_2336664_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	5.2e-37
WP_002288850.1|2336668_2337373_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002294132.1|2337562_2338423_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	4.6e-12
WP_002322652.1|2338409_2338979_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002294609.1|2339927_2340314_-	DUF4064 domain-containing protein	NA	NA	NA	NA	NA
WP_002294608.1|2340310_2340832_-	RDD family protein	NA	NA	NA	NA	NA
WP_002294607.1|2340833_2341868_-	signal peptide peptidase SppA	NA	A0A1C9LW82	Vibrio_phage	29.2	6.6e-13
WP_002348772.1|2341900_2343316_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_002303464.1|2343284_2345438_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	7.0e-41
WP_002303465.1|2345695_2345932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294603.1|2345950_2346166_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002348773.1|2346868_2347558_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002348774.1|2347681_2349001_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_002296840.1|2350574_2351762_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002294600.1|2352116_2352263_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
>prophage 14
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	2487876	2612426	2870954	tRNA,protease,holin,transposase	Bacillus_phage(20.69%)	91	NA	NA
WP_002297218.1|2487876_2489172_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294493.1|2489326_2490010_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_002285996.1|2490011_2490848_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002302556.1|2490858_2492613_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.1e-39
WP_002285994.1|2492888_2493230_-	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	34.9	1.3e-10
WP_002294492.1|2493297_2495469_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002285989.1|2495679_2496537_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002285988.1|2496607_2497465_-	ROK family protein	NA	NA	NA	NA	NA
WP_002285985.1|2497449_2500152_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_002294491.1|2500164_2501454_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_002302559.1|2501603_2502650_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285980.1|2502651_2504805_+	alpha-1,2-mannosidase	NA	NA	NA	NA	NA
WP_002304851.1|2505277_2506729_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002285976.1|2506725_2508450_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010782528.1|2508442_2509057_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002285974.1|2509401_2510859_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002285972.1|2510899_2511820_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002285971.1|2511831_2512779_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002285969.1|2513257_2513977_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002304848.1|2514025_2515672_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002285964.1|2515850_2516441_+	transporter	NA	NA	NA	NA	NA
WP_002285962.1|2516532_2518038_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002285961.1|2518121_2519474_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002285960.1|2519473_2519992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285954.1|2520007_2520334_-	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002285949.1|2520346_2522326_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002285948.1|2522346_2522661_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002285944.1|2522828_2523122_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002321621.1|2523199_2524312_-	FUSC family protein	NA	NA	NA	NA	NA
WP_002297280.1|2524464_2524689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285932.1|2524698_2524878_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2525071_2525242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016252731.1|2525665_2526685_-	collagen binding domain-containing protein	NA	NA	NA	NA	NA
WP_002285924.1|2526831_2529903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303189.1|2531809_2532571_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285920.1|2532670_2534392_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.7e-37
WP_002285918.1|2534406_2536191_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.7e-46
WP_002285917.1|2536571_2538125_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2538472_2540887_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2541313_2543332_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2543701_2544358_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2544357_2545314_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2545313_2545880_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_000997695.1|2546498_2547677_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_076005178.1|2547700_2547892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|2548084_2549272_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_025479400.1|2549368_2549671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303477.1|2550445_2551465_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002301818.1|2551475_2551682_-|holin	holin	holin	NA	NA	NA	NA
WP_002301399.1|2551814_2552774_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002304713.1|2552976_2553909_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
WP_002341521.1|2553980_2554337_+	hypothetical protein	NA	U4KJ82	Streptococcus_phage	42.2	9.2e-15
WP_000997695.1|2554434_2555613_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2556483_2557823_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002301355.1|2557948_2559721_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.2e-54
WP_002285883.1|2559723_2561436_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002285876.1|2561550_2562219_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295567.1|2562285_2563074_-	esterase family protein	NA	NA	NA	NA	NA
WP_002295566.1|2563156_2564629_-	MFS transporter	NA	NA	NA	NA	NA
WP_002289731.1|2564758_2565952_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002297218.1|2566306_2567602_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296055.1|2575783_2577280_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	8.7e-91
WP_002290055.1|2577390_2578395_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002296053.1|2578395_2579283_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002287418.1|2579499_2581611_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002287415.1|2581700_2582246_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287414.1|2582245_2583691_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287412.1|2583810_2584281_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287409.1|2584326_2584752_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287407.1|2584818_2585088_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_101701472.1|2585098_2586694_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287403.1|2586708_2590230_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002287401.1|2590246_2590807_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002287399.1|2591159_2592134_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002287397.1|2592303_2593704_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_002287391.1|2593781_2594504_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287389.1|2594582_2595089_-	membrane protein	NA	NA	NA	NA	NA
WP_002322796.1|2595211_2597011_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_002297218.1|2597172_2598468_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002322795.1|2598600_2600139_-	hypothetical protein	NA	B5LJD6	Mycobacterium_phage	50.5	2.3e-17
WP_000122610.1|2600518_2601811_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002297218.1|2601955_2603251_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287385.1|2603422_2603932_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002296044.1|2603935_2604790_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002287382.1|2604944_2605583_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_002287380.1|2605583_2606234_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002287379.1|2606246_2607146_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_002287377.1|2607310_2609380_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	30.3	3.5e-21
WP_002287376.1|2609376_2610117_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_002287374.1|2610129_2611488_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002287372.1|2611487_2612426_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.7	5.2e-09
>prophage 15
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	2694956	2708074	2870954		Streptococcus_phage(83.33%)	16	NA	NA
WP_002297366.1|2694956_2695271_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2695283_2695658_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|2695658_2696003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343904.1|2696085_2697231_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	62.8	6.0e-132
WP_002297361.1|2697945_2699805_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_002297360.1|2699898_2700138_+	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	80.3	2.1e-23
WP_002297358.1|2700215_2700890_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|2701122_2701557_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2701557_2702265_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2702254_2702545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2702803_2703988_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2703984_2704122_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_101701473.1|2704867_2706781_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	1.3e-35
WP_033658092.1|2706884_2707109_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2707121_2707625_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2707684_2708074_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
>prophage 16
NZ_CP023808	Enterococcus faecium strain Efaecium_ER04526.3A chromosome, complete genome	2870954	2735252	2825025	2870954	integrase,transposase	Streptococcus_phage(19.05%)	84	2722349:2722363	2806151:2806166
2722349:2722363	attL	TTTAGCTTCAAATAG	NA	NA	NA	NA
WP_002297332.1|2735252_2735447_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
2722349:2722363	attL	TTTAGCTTCAAATAG	NA	NA	NA	NA
WP_077828743.1|2735638_2735794_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002297326.1|2737650_2739267_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_002317220.1|2739384_2739603_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2739797_2740259_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002304820.1|2740451_2740691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|2741322_2741727_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|2741743_2742892_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
2742446:2742460	attR	CTATTTGAAGCTAAA	NA	NA	NA	NA
WP_002322279.1|2744146_2744269_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
2742446:2742460	attR	CTATTTGAAGCTAAA	NA	NA	NA	NA
WP_002304819.1|2744298_2745282_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|2745305_2745455_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|2745475_2745853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|2745884_2746064_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|2746078_2746348_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002297310.1|2746870_2748613_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-30
WP_002297309.1|2748596_2750351_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002297308.1|2750460_2751030_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002311663.1|2751047_2752472_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.9e-20
WP_002297304.1|2752473_2753142_-	cobalt transporter	NA	NA	NA	NA	NA
WP_071858995.1|2753272_2753857_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297302.1|2754187_2754421_-	iron-dependent repressor	NA	NA	NA	NA	NA
WP_002297295.1|2754435_2755386_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297294.1|2755382_2756225_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002297293.1|2756546_2757734_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002297292.1|2757825_2758566_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002320809.1|2759253_2759412_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297291.1|2759483_2760710_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002348684.1|2761039_2761660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002364278.1|2761740_2762151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298782.1|2763700_2764477_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322873.1|2764574_2765222_-	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.4	4.5e-12
WP_002298780.1|2765221_2766052_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002298779.1|2766051_2766801_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298777.1|2766814_2767279_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002312606.1|2767328_2767790_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298774.1|2767771_2768746_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_076005180.1|2768952_2770416_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	2.2e-123
WP_002322870.1|2771856_2773404_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002348831.1|2773652_2774432_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322868.1|2774506_2774965_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002322867.1|2774976_2776236_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_002322866.1|2776351_2776666_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002350767.1|2776811_2778308_-	RNA-directed DNA polymerase	NA	Q2P9X6	Enterobacteria_phage	34.3	8.5e-70
WP_002348834.1|2778485_2778965_-	DUF3841 domain-containing protein	NA	NA	NA	NA	NA
WP_002348835.1|2779340_2779586_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002322862.1|2779690_2780464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322861.1|2780692_2780941_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002322860.1|2781039_2781354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782540.1|2781810_2783085_+|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	6.6e-55
WP_002348881.1|2783144_2783492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322858.1|2783484_2783787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348880.1|2784002_2785394_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_002348879.1|2785378_2785990_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_002322855.1|2786001_2786190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016252733.1|2786203_2788849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348876.1|2788835_2789054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|2790082_2791255_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002321715.1|2791585_2791912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348874.1|2791919_2792123_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002322813.1|2792197_2792848_+	helix-turn-helix transcriptional regulator	NA	Q20DG0	Lactobacillus_phage	33.3	3.2e-05
WP_002318021.1|2792902_2794069_+|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	34.0	3.3e-45
WP_002287505.1|2794157_2794550_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002295975.1|2794565_2795009_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002297290.1|2795527_2795995_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_002288118.1|2796114_2797653_-	gluconokinase	NA	NA	NA	NA	NA
WP_002288144.1|2797732_2798419_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_002288119.1|2798619_2799147_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288121.1|2799230_2799908_-	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	23.2	1.6e-07
WP_002288122.1|2799904_2801035_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	51.6	1.6e-73
WP_002288124.1|2801034_2803218_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002288127.1|2803214_2804240_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002288129.1|2804284_2805112_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002288131.1|2805108_2806176_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002288133.1|2806201_2807038_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288134.1|2807034_2807904_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002288135.1|2807973_2809257_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002288137.1|2809270_2810956_-	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002288139.1|2811230_2812256_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_010782538.1|2812850_2816504_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.0	2.2e-63
WP_002320801.1|2816582_2820209_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.7	1.5e-48
WP_002289394.1|2820927_2821896_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002289390.1|2821913_2822819_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289388.1|2822815_2823622_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	1.3e-08
WP_002297218.1|2823729_2825025_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 1
NZ_CP023809	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence	202553	12910	20581	202553	transposase	Temperate_phage(16.67%)	12	NA	NA
WP_002321302.1|12910_13384_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	62.0	5.6e-44
WP_002321303.1|13749_14010_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
WP_002296239.1|14454_14661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305766.1|14660_14912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305764.1|14927_15344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348912.1|15325_15598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305759.1|15764_16166_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	43.1	1.4e-24
WP_002305757.1|16177_17323_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D9J0Y9	Brochothrix_phage	74.6	7.7e-164
WP_002287514.1|17560_17824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321032.1|17817_18168_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002318230.1|18191_18806_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.9	2.6e-17
WP_002348911.1|19255_20581_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.6	1.2e-99
>prophage 2
NZ_CP023809	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence	202553	36063	147838	202553	integrase,protease,transposase,holin,bacteriocin	Streptococcus_phage(20.59%)	97	74075:74134	126040:127377
WP_002300034.1|36063_38121_-|protease	serine protease	protease	NA	NA	NA	NA
WP_002300033.1|38265_38457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300032.1|38644_39100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305782.1|39096_39339_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002302862.1|39356_39659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302860.1|39727_41782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302859.1|41781_44394_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_002302858.1|44390_46769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302857.1|46829_47372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302856.1|47449_47782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302855.1|47782_48376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302854.1|48397_50422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302853.1|50421_51621_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	38.1	2.5e-32
WP_002302852.1|51636_52281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302851.1|52291_53098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582323.1|53508_54444_+	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_002305788.1|54487_54757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302849.1|55032_55308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302844.1|55349_55772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582318.1|55791_57384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302842.1|57404_57740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302840.1|57885_58080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|58215_59466_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305801.1|59875_62248_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002303486.1|63787_65797_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002303484.1|66142_66739_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002303483.1|66751_67651_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|67653_67785_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|67806_68139_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002303482.1|68183_68417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|68575_68698_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|68887_69112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|69554_69761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|69760_70012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|70192_70465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|70909_71089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|71147_71504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|72472_73426_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|73546_73810_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
74075:74134	attL	GAGAGTATAAAATATTTTGTGTAAATGAAAAAATCCATACAAAAAAGGAAGGCGCTTCTG	NA	NA	NA	NA
WP_000997695.1|74181_75360_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002332708.1|75891_76800_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002300835.1|78744_79200_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|79213_80542_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|80575_80860_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|80861_81377_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|81392_82055_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|82061_82634_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002303202.1|82805_84353_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	2.8e-44
WP_002287659.1|84454_84808_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|84797_84992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300843.1|85173_86694_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|86936_87122_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|87105_87288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|88241_88841_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|88904_89504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305879.1|90519_91392_-	ROK family protein	NA	NA	NA	NA	NA
WP_000195429.1|91634_92807_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002303302.1|92987_94934_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|95118_96558_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|96559_97522_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|97691_99118_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|99360_99816_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|100401_100632_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|100861_101680_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|101840_102530_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|102543_104046_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|104058_104535_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|105032_106195_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|107312_107831_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|109906_110992_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|111099_112053_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002348774.1|113134_114454_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_002324322.1|115716_116895_+|transposase	IS256-like element ISEfm2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	24.9	2.6e-29
WP_002301128.1|117474_118470_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|118485_119655_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|119670_120405_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087043335.1|121175_122338_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_002301811.1|122906_124199_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|124472_124733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|124813_125992_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002346943.1|126329_127508_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
126040:127377	attR	CAGAAGCGCCTTCCTTTTTTGTATGGATTTTTTCATTTACACAAAATATTTTATACTCTCAATCTGAAGTACTTATATTAAAATAATTCTAAACTATTTACCTCAAAAAGTGCAATAAATTATTTCTGAACAATAAAATGATAGTCAAAACAAAAAAATATTGTTAATCGTTCAGAGCCATCCGAGAGTGTAAAATATTTTGTGTAAATGAAAAAATCCATACAAAAAAGGAAGGCGCTTCTGTAGAATAAAGTTAACGACAACCAATTCACAGAAAAGAGGACTTCCCTATGAATGATTTTACTACAGAAATTGTGCAAACTCTAGTCACTAAAGGCGGTTTAAATGAATTATTCCGTTCGCACTTAGAAAAAGCGATAAACACACTCCTACGGACTGAATTAACGGCTTTTTTAGATTACGAAAAATATGATCGCACTGGTTTTAATTCAGGTAATTCGAGAAACGGTTCTTACTTTCGATCAATCAAAACCGAATATGGTGAATTAACATTGGAAATACCTAGAGATCGTAATGGTGAGTTTAAACAACAAACTTTACCAGCCTACAAAAGAACAAACGATACATTGGAAACCACTATTATCCATTTATTCGAAAAAGGTGTTACGATGTCTGAAATTGCTGATTTGATCGAAAAAATGTACGGTCATCACTATACTCCACAAACCATGTCCAACATGACTAAAGTTCTGACTGAAGAAGTAAATGCCTTTAAATCCAGAGCCTTAAATGATAAGTATGTCGCTATTTTTATGGACGCTACTTACATTCCACTAAAACGTCAAACCGTATCCAAAGAAGCGATTTATATTGCCATTGGTATACGAGAAGACGGCACTAAAGAAGTACTGAGTTATGCGATTGCTCCAACTGAATCAACATACGTTTGGAATGAGCTGCTACAGGATATTAACTCCAGAGGAGTTCAAGAAGTCTTGCTTTTTATTACGGACGGCTTAAAAGGCATGAAAGATACTATCCATCAAATTTATCCTAAAGCAAAATATCAGCATTGTTGTATCCATGTATCTCGTAACATCGCTCATAAAGTACGTGTCAAAGACCGAAAAGAAATCTGTGATGACTTTAAGGCTGTTTATCAAGCTAACTCAAAAGAAGAAGCGAATACCTTCTTATCCGGCATGATTGAGAAATGGAAGAAAAACTATCCTAAAGTGACGCAGTCACTCATAGAAAACCAAGACTTATTAACTTTTTATGATTTTCCACCTAGCATTCGTAGAACCATTTACTCAACCAATCTAATCGAGTCTTTCAATAAGCAAATTAAAAGATACAGCCGTAGAAAAGAGCAGT	NA	NA	NA	NA
WP_073120200.1|127859_128156_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	6.7e-19
WP_002287876.1|129104_129500_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287875.1|129509_130358_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287874.1|130372_131200_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002285758.1|132270_132465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|132454_132808_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|132909_134457_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002300493.1|134662_135832_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_099745857.1|136171_136858_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
WP_000195429.1|137481_138654_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002348774.1|138904_140224_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_000997695.1|141315_142494_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_158294579.1|143514_145062_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	1.1e-06
WP_002304894.1|145119_145386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303113.1|146061_146613_-	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_002319817.1|147157_147838_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
>prophage 1
NZ_CP023812	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence	81514	12823	63446	81514	holin,protease,bacteriocin,transposase	Streptococcus_phage(30.0%)	45	NA	NA
WP_002300034.1|12823_14881_-|protease	serine protease	protease	NA	NA	NA	NA
WP_002300033.1|15025_15217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300032.1|15403_15859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305782.1|15855_16098_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002302858.1|21144_23523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302857.1|23583_24126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302856.1|24203_24536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302855.1|24536_25130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302854.1|25151_27176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302853.1|27175_28375_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	38.1	2.5e-32
WP_002302852.1|28390_29035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302851.1|29045_29852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582323.1|30262_31198_+	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_002305788.1|31241_31511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302849.1|31786_32062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302844.1|32103_32526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582318.1|32545_34138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302842.1|34158_34494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302840.1|34639_34834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|34969_36220_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305801.1|36629_39002_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002353594.1|39062_40532_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|40542_42552_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002303484.1|42897_43494_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002303483.1|43506_44406_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|44408_44540_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|44561_44894_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002303482.1|44938_45172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|45330_45453_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|45642_45867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|46309_46516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|46515_46767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|46947_47220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|47664_47844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|47902_48259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|49227_50181_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|50301_50565_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000997695.1|50936_52115_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002332708.1|52646_53555_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002300838.1|57329_57614_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|57615_58131_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300842.1|58814_59387_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002287659.1|61206_61560_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|61549_61744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300843.1|61925_63446_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
>prophage 2
NZ_CP023812	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence	81514	68386	80853	81514	transposase	Streptococcus_phage(37.5%)	13	NA	NA
WP_000195429.1|68386_69559_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002354485.1|71424_72111_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_016171138.1|72158_73418_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.2	1.1e-54
WP_010782630.1|73567_74182_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	4.9e-16
WP_002288787.1|74495_74918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|74927_75131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|75341_75926_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_016171137.1|76094_77420_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.8	4.1e-100
WP_000568378.1|77412_77763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001021554.1|77759_77939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000026576.1|78074_78365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|78662_79835_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000101106.1|80064_80853_+	ParA family protein	NA	H7BUL8	unidentified_phage	35.7	4.7e-27
