The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	82119	229233	2870397	transposase,holin,tRNA	Streptococcus_phage(13.51%)	124	NA	NA
WP_002298563.1|82119_82866_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002301399.1|83538_84498_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002326711.1|84872_86051_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002317041.1|86395_86734_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_002348801.1|86868_87270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317547.1|87381_88002_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002294300.1|88092_90762_-	YfhO family protein	NA	NA	NA	NA	NA
WP_002290463.1|90999_91188_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002294298.1|91457_91820_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002301169.1|91871_93554_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002301167.1|93670_95707_+	ATP-dependent DNA helicase RecG	NA	A0A2H4JBQ0	uncultured_Caudovirales_phage	22.9	5.3e-06
WP_002289721.1|95755_96757_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002294295.1|96878_97121_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002287889.1|97388_98393_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	5.1e-18
WP_002287891.1|98393_99338_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	3.9e-20
WP_002287892.1|99337_100300_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287893.1|100326_101241_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287894.1|101266_103048_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287896.1|103395_104082_+	ribonuclease III	NA	K7YH73	Megavirus	32.3	9.1e-27
WP_002301166.1|104101_107683_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_002348798.1|107691_108501_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002301165.1|108512_109511_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_101701466.1|109697_111965_+	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_002326066.1|112148_113102_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294287.1|113119_113572_-	YueI family protein	NA	NA	NA	NA	NA
WP_002294286.1|113721_114672_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.5	1.6e-66
WP_002301163.1|114664_115624_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002301162.1|115620_116376_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	2.2e-13
WP_002301160.1|116398_117352_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287909.1|117995_118292_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
WP_002287910.1|118647_119004_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002348747.1|119013_119913_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010782507.1|120145_121105_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_010782508.1|121362_122808_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	2.2e-123
WP_002348590.1|122853_123588_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_002301190.1|123913_124324_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002294273.1|124316_125018_+	LrgB family protein	NA	NA	NA	NA	NA
WP_002348592.1|125017_126631_+	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
WP_002290506.1|126620_126842_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	33.3	1.1e-05
WP_002297929.1|126838_127600_+	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.7	1.2e-16
WP_002294268.1|127980_128490_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	31.8	7.5e-10
WP_002294267.1|128559_129099_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002294265.1|129238_129850_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002324284.1|130165_130963_+	formate/nitrite transporter	NA	NA	NA	NA	NA
WP_002294262.1|130990_131626_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002294261.1|131645_132419_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002348595.1|132826_133624_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297923.1|133601_134015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294258.1|133998_136644_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.6e-39
WP_002301736.1|136661_138770_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.8e-57
WP_002348596.1|138791_139352_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002297218.1|139490_140786_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002285758.1|141045_141240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|141229_141583_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|141684_143232_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002348864.1|143311_145300_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002294254.1|145522_146236_+	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002294252.1|146312_146759_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002290528.1|146928_147531_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002289812.1|147543_148545_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_002341570.1|148573_149152_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294249.1|149203_149686_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002289815.1|149802_150177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294246.1|150976_152329_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002297079.1|152475_153066_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_002294242.1|153193_154543_-	amino acid permease	NA	NA	NA	NA	NA
WP_002294240.1|154710_155451_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	5.5e-30
WP_002297081.1|155463_157056_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002293448.1|157623_157920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294236.1|158095_158821_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_002301156.1|158813_159656_+	chorismate mutase	NA	NA	NA	NA	NA
WP_002294232.1|159658_160180_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002289284.1|160432_160996_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	2.3e-12
WP_002289282.1|161246_161516_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002297086.1|161703_163830_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002289280.1|164339_164606_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002289279.1|164749_166741_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.9	8.4e-65
WP_002294228.1|167094_168396_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002326809.1|168771_170067_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_010782510.1|170134_171313_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	39.9	3.8e-65
WP_002289277.1|171659_173030_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002289744.1|173211_173535_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002299254.1|173859_174468_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_002348768.1|174797_175514_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_002289749.1|175526_176222_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_002289751.1|176305_176935_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.2	3.1e-34
WP_086953915.1|177449_178788_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002294220.1|178857_179460_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	30.6	3.6e-19
WP_002296548.1|179481_179970_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002294217.1|180290_181664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294214.1|181647_182115_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_002329999.1|182363_184109_-	AarF/ABC1/UbiB kinase family protein	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.1	1.3e-40
WP_002293424.1|184304_185381_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002317074.1|185533_186886_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_086272912.1|187201_188719_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.2	1.3e-62
WP_002294209.1|188848_189199_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002294207.1|189214_190336_+	alanine racemase	NA	NA	NA	NA	NA
WP_002289874.1|190346_190709_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	37.8	7.6e-09
WP_002293413.1|190884_191154_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002294206.1|191343_192291_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016171130.1|192436_193732_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.2	1.1e-09
WP_002301399.1|193998_194958_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002294203.1|195183_197889_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_002294202.1|198485_200309_+	APC family permease	NA	NA	NA	NA	NA
WP_002348885.1|200450_200636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294199.1|201110_201374_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002301121.1|201373_201640_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002301116.1|202870_203542_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002301114.1|203538_204456_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293405.1|204452_205094_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002348889.1|205097_206273_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.0e-17
WP_002350806.1|206465_207497_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002341590.1|209173_210127_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002319878.1|210217_211513_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_002326809.1|211674_212970_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289743.1|213679_216319_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.2	1.6e-84
WP_002294185.1|216486_217185_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002341590.1|217287_218241_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294183.1|218469_219615_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002300794.1|219711_220092_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_010782512.1|220396_222994_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010782513.1|222901_224512_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	8.4e-124
WP_002300788.1|226789_227269_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_086953915.1|227894_229233_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 2
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	260579	268316	2870397		Streptococcus_phage(66.67%)	6	NA	NA
WP_002297361.1|260579_262439_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_000398284.1|262995_264201_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_002286940.1|264984_266895_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_032509114.1|266998_267223_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	97.1	8.5e-27
WP_002345010.1|267339_267837_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	97.6	1.3e-88
WP_002345009.1|267923_268316_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	4.6e-68
>prophage 3
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	283893	332057	2870397	transposase,tRNA	Streptococcus_phage(33.33%)	44	NA	NA
WP_002354485.1|283893_284580_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002348732.1|284731_287773_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.2	4.0e-18
WP_002348733.1|287962_288547_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_010782519.1|288543_289683_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002336644.1|290060_292103_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002336645.1|292113_292734_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002336646.1|292745_293204_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002331203.1|293222_293501_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002336647.1|293525_294893_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002331205.1|294907_296053_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	1.2e-52
WP_002331206.1|296079_296571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002345001.1|297013_298213_+	MFS transporter	NA	NA	NA	NA	NA
WP_002331208.1|298707_299466_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002331209.1|299633_300569_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002336649.1|300565_302011_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002336650.1|302038_302494_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002336651.1|302512_303487_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002336652.1|304302_304917_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002331215.1|305157_305541_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301781.1|305903_306413_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002296570.1|306512_307163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291914.1|307613_308552_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002291912.1|308564_309617_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296392.1|309882_310518_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002296391.1|310708_311500_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002326839.1|311979_312888_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002295755.1|312943_313441_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002340421.1|313477_314161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296262.1|314507_314774_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002296261.1|314800_315100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296259.1|315273_315825_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002296258.1|315970_316264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304106.1|316256_316553_+	peptidase	NA	NA	NA	NA	NA
WP_002296256.1|316627_317626_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|317717_318671_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294735.1|318769_319486_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002296623.1|319684_320980_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_025478783.1|321026_323075_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_002294732.1|324284_325526_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002294730.1|325672_326308_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294728.1|326498_327239_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002296909.1|327383_329021_-	membrane protein	NA	NA	NA	NA	NA
WP_000195429.1|329232_330405_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000997695.1|330878_332057_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	767870	776342	2870397		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|767870_768515_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|768529_768859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|768872_769811_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|769846_770671_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|770663_771011_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|771079_771952_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|772060_773182_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|773235_773838_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|774152_776342_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 5
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	832381	911492	2870397	protease,integrase,head,transposase,portal,tail,tRNA,terminase,capsid,holin	Enterococcus_phage(25.64%)	95	889276:889291	892629:892644
WP_002286621.1|832381_835180_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|835228_836755_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|836769_837417_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|837600_837930_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|838106_838835_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|838850_839864_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|839863_841141_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|841203_843906_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|844057_844375_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|844404_844725_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|844810_846271_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|846338_846560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|846590_846773_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|846772_847186_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|847308_848490_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|849020_850160_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|850458_851094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|851206_851842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|851875_852337_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002348715.1|852466_852898_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|852915_853236_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|853534_854311_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|854325_854529_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|854544_854883_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|854869_855049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|855091_855562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|855648_856347_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|856524_856866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|856858_857530_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|857535_858222_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|858224_858974_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|858985_859255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|859416_859719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|859715_859877_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|859873_860179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|860178_860535_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|860494_860740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|860736_861156_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|861152_861710_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|861706_862003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|862079_862493_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002300143.1|862950_863226_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|863679_863886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|864081_864249_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|864274_864619_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|864623_864905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|865007_865322_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|865299_866994_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|867013_868192_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|868154_868841_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|868840_870001_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|870010_870886_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|870882_871194_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|871183_871537_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|871526_871928_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|871920_872325_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|872336_872945_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|872964_873327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|873329_873512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348716.1|873528_876960_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|877010_877748_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002286497.1|877757_880049_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.0	9.6e-89
WP_002286495.1|880072_882199_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286491.1|882361_882808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|882809_882947_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|882984_883278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|883274_883499_+|holin	holin	holin	NA	NA	NA	NA
WP_002349643.1|883495_884521_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_087046766.1|885460_886622_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002324322.1|887509_888688_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002286474.1|888878_889286_+	hypothetical protein	NA	NA	NA	NA	NA
889276:889291	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|889299_889701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|889702_890074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|890109_890412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076005172.1|890660_890861_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_070571278.1|891165_892398_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|892654_893224_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
892629:892644	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002297963.1|893401_893842_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|893999_894764_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|894795_895719_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|895794_896934_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|896926_897727_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|897726_898554_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|898531_899266_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|899365_900232_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|900245_900818_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|900839_901868_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|901965_902817_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002348826.1|902850_904884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348825.1|904927_906208_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002285758.1|906444_906639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|906628_906982_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|907083_908631_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_101701468.1|908669_909953_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	1.2e-08
WP_010782578.1|910217_911492_-|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	8.6e-55
>prophage 6
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	1083320	1139442	2870397	protease,transposase,tRNA	Lysinibacillus_phage(25.0%)	54	NA	NA
WP_002297218.1|1083320_1084616_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002321398.1|1084851_1086951_+	TFIIB-type zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002290060.1|1087146_1088010_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_002322512.1|1088114_1088588_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002297218.1|1088654_1089950_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294386.1|1090205_1091093_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	1.2e-31
WP_002294387.1|1091111_1091483_+	protein RibT	NA	NA	NA	NA	NA
WP_002305297.1|1091452_1092250_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.0	6.4e-08
WP_002296975.1|1092233_1092803_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	1.5e-14
WP_002294391.1|1092808_1093525_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002296977.1|1093854_1094466_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002290168.1|1094843_1096367_+	YfcC family protein	NA	NA	NA	NA	NA
WP_002294399.1|1096603_1097944_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_002294400.1|1098096_1098834_+	thioesterase	NA	NA	NA	NA	NA
WP_002294401.1|1098998_1099220_-	ferredoxin	NA	NA	NA	NA	NA
WP_002305295.1|1099250_1100282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303122.1|1100268_1101672_+	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	6.5e-64
WP_002294404.1|1101737_1102373_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002303123.1|1102421_1103102_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002294406.1|1103236_1104466_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002296982.1|1104647_1105958_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002290178.1|1106200_1106476_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	69.7	1.8e-26
WP_101701469.1|1106611_1107907_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002297185.1|1108223_1109519_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002294410.1|1109754_1110801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289879.1|1110802_1112062_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002289878.1|1112067_1112649_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_002294412.1|1112730_1113606_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.3	5.9e-63
WP_002290045.1|1113753_1114086_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002294414.1|1114197_1115406_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.7	1.5e-45
WP_002290187.1|1115559_1116015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1116208_1117504_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290188.1|1117898_1118174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288388.1|1118186_1120265_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002288390.1|1120424_1122311_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.6e-52
WP_002294416.1|1122322_1123270_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	7.1e-123
WP_002288392.1|1123289_1123817_+	dihydrofolate reductase	NA	A0A1D6X864	Bacillus_phage	37.1	6.7e-22
WP_002288393.1|1123879_1124533_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002288394.1|1124664_1125507_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.2	6.5e-19
WP_002288395.1|1125664_1126561_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288396.1|1126563_1127277_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002288397.1|1127296_1127815_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288398.1|1127811_1128039_+	YozE family protein	NA	NA	NA	NA	NA
WP_002294418.1|1128190_1128742_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002288403.1|1128824_1129367_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002288405.1|1129603_1130002_-	glyoxalase	NA	NA	NA	NA	NA
WP_002296988.1|1130261_1131122_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002296990.1|1131114_1131882_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.5	2.7e-27
WP_002303743.1|1131937_1132795_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002288411.1|1132916_1134995_+	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	38.5	1.2e-101
WP_002320953.1|1134963_1136340_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002288415.1|1136537_1137443_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	9.4e-32
WP_002288419.1|1137479_1138028_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_002288421.1|1138041_1139442_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.8	1.7e-43
>prophage 7
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	1204253	1213314	2870397		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1204253_1205549_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1205728_1206106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1206361_1207090_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1207089_1207344_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1207345_1208017_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1208017_1210240_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1210224_1211664_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|1211695_1212739_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1212735_1213314_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 8
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	1496715	1545733	2870397	protease,transposase	Streptococcus_phage(23.08%)	58	NA	NA
WP_010729485.1|1496715_1498251_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	1.4e-123
WP_002295142.1|1498474_1498846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1499101_1499344_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1499375_1500278_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1500290_1500479_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1500492_1501056_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1501093_1501987_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002296674.1|1502064_1503003_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1503036_1503387_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1503419_1504322_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1504314_1505172_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002348903.1|1505505_1506315_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1506354_1506852_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1507496_1507820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1507983_1508238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1508307_1508553_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002348902.1|1508649_1508994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1509054_1509618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293303.1|1510185_1510386_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002302440.1|1511008_1512310_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296656.1|1512638_1513352_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1513344_1514430_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1514446_1514890_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1514923_1515277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1515388_1515790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1515826_1516336_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1516357_1517215_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1517232_1518066_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1518079_1518877_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1518909_1519194_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1519190_1520192_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002296640.1|1520193_1521096_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
WP_002296639.1|1521259_1522108_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1522753_1522960_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1523161_1524163_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1524167_1526081_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1526248_1526755_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1526914_1527355_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1527380_1528538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1528540_1528897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1529194_1530169_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1530364_1531204_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1531388_1532276_+	rotamase	NA	NA	NA	NA	NA
WP_002311093.1|1532859_1533555_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1533538_1533937_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|1534345_1535596_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002289425.1|1535737_1536733_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1536750_1537305_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|1537292_1537784_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348791.1|1537776_1539645_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1539663_1540464_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002305631.1|1540656_1540902_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1541040_1541526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1541981_1542395_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002322258.1|1542531_1542792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321532.1|1542909_1543200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1543445_1544624_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1544779_1545733_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	1681427	1779328	2870397	protease,head,transposase,integrase,portal,tail,tRNA,terminase,capsid,plate,holin	Enterococcus_phage(17.39%)	113	1758460:1758478	1775571:1775589
WP_002288520.1|1681427_1682351_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002294143.1|1685528_1685750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294142.1|1685857_1686205_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002294141.1|1686231_1688538_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|1688550_1688862_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|1688858_1689152_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002301262.1|1689173_1690349_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|1690372_1690846_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002294138.1|1690989_1695342_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	41.4	3.9e-22
WP_002294137.1|1695553_1697263_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1697330_1698599_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1698759_1699560_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1699556_1700369_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002287107.1|1700777_1702028_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002293875.1|1702346_1702904_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1702906_1703629_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1703764_1704646_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1704744_1705527_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1705885_1706365_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1706581_1707673_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002326699.1|1707665_1707794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|1707797_1708343_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002288432.1|1708795_1710487_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1710905_1711853_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1711967_1712987_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1713077_1714307_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1714767_1715469_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326809.1|1715640_1716936_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002301319.1|1717599_1718616_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1718612_1719077_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002348676.1|1719083_1719626_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1719609_1720434_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1720522_1721503_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1721526_1723011_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1723022_1724012_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1724259_1724427_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1724488_1726300_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1726296_1726662_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1726824_1727220_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1727237_1728200_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1728199_1728412_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1728432_1729131_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1729150_1729693_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1729824_1730829_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1730825_1731815_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1731811_1732618_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_010782564.1|1732783_1733740_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1733816_1734335_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1734422_1734572_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1734799_1735246_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|1735440_1737336_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1737660_1738635_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_086953915.1|1739440_1740780_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_084201531.1|1740850_1741876_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_002286683.1|1741872_1742097_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|1742093_1742387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298029.1|1742424_1742562_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002350774.1|1742561_1742969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|1742996_1743521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350775.1|1743520_1743970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|1743973_1744591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|1744590_1745499_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_069314735.1|1745511_1748271_-	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.6	6.8e-49
WP_069314753.1|1748267_1748972_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069314734.1|1748983_1751287_-|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	48.3	2.1e-83
WP_069314733.1|1751481_1751946_-	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	40.3	1.7e-16
WP_069314732.1|1751945_1752572_-|tail	phage tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	4.4e-28
WP_069314731.1|1752578_1752944_-	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	41.1	7.7e-17
WP_010725764.1|1752933_1753272_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	47.7	6.6e-23
WP_069314730.1|1753261_1753588_-|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	1.7e-23
WP_002301326.1|1753568_1753847_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	3.5e-22
WP_084201525.1|1753848_1755213_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.4	2.9e-125
WP_084201523.1|1755225_1755801_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	68.4	1.1e-65
WP_099745849.1|1755766_1756996_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	65.5	2.7e-146
WP_069314727.1|1757017_1758745_-|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	7.6e-264
1758460:1758478	attL	CTTTTTCATTTTCTTTAAC	NA	NA	NA	NA
WP_002301332.1|1758741_1759194_-	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	68.5	8.0e-48
WP_002317992.1|1759305_1759686_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	67.2	9.1e-45
WP_069314726.1|1759682_1760069_-	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	37.3	8.7e-11
WP_069314725.1|1760049_1760436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154212406.1|1760740_1760884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010725701.1|1761208_1761676_-	ArpU family phage transcriptional regulator	NA	D7RWH7	Brochothrix_phage	29.1	2.4e-07
WP_050397116.1|1761750_1762191_-	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	37.7	9.0e-20
WP_069314724.1|1762220_1762514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002309099.1|1762510_1762714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314723.1|1762720_1762951_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_069314722.1|1763117_1763408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314721.1|1763418_1763994_-	DUF1642 domain-containing protein	NA	A0A0E3T929	Enterococcus_phage	32.1	2.1e-16
WP_048946628.1|1764304_1764523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314720.1|1764519_1765044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314719.1|1765043_1765334_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	42.4	2.4e-13
WP_084205653.1|1765333_1765639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314717.1|1765635_1765797_-	antitoxin	NA	NA	NA	NA	NA
WP_010721325.1|1765793_1766096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314716.1|1766257_1766527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314715.1|1766538_1767390_-	replication protein	NA	A0A1S5SFJ6	Streptococcus_phage	67.1	2.1e-49
WP_069314714.1|1767396_1768083_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	70.0	2.2e-89
WP_002286557.1|1768088_1768760_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|1768752_1769094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|1769271_1769970_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|1770056_1770527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314713.1|1770569_1770749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342110.1|1770761_1771028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353431.1|1771038_1771233_-	hypothetical protein	NA	M1IFE9	Streptococcus_phage	53.1	1.1e-11
WP_033655448.1|1771537_1771957_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	62.3	3.0e-41
WP_069314712.1|1771973_1772396_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	50.7	3.6e-34
WP_002317583.1|1772424_1772625_+	hypothetical protein	NA	A0A097BY73	Enterococcus_phage	87.9	2.5e-25
WP_069314711.1|1772710_1773151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314710.1|1773288_1774494_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	37.4	7.3e-64
WP_002296332.1|1774777_1775344_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348678.1|1775599_1776931_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
1775571:1775589	attR	GTTAAAGAAAATGAAAAAG	NA	NA	NA	NA
WP_002296335.1|1776896_1777247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296337.1|1777758_1778103_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1778368_1779328_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
>prophage 10
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	1783390	1920066	2870397	transposase,tRNA	Streptococcus_phage(29.41%)	119	NA	NA
WP_002311774.1|1783390_1784350_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|1784562_1785471_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|1785519_1785906_+	YxeA family protein	NA	NA	NA	NA	NA
WP_000122610.1|1786209_1787502_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002288574.1|1787720_1789067_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1789178_1790528_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|1790644_1791898_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|1791968_1792454_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288579.1|1792476_1793235_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1793250_1794429_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1794658_1796779_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002296838.1|1797001_1797727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1797716_1798226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1798295_1799744_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1799743_1800460_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1800440_1800791_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1800934_1801708_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1802464_1802767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1803205_1804384_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1804720_1804960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1805321_1805582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1805766_1806264_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1806393_1807104_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1807116_1808781_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1808985_1809648_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1809657_1810473_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1810734_1811178_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1811311_1811650_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302962.1|1811637_1812015_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322902.1|1812238_1813432_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1813597_1814020_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002303955.1|1814608_1815064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1815225_1816398_-	class C sortase	NA	NA	NA	NA	NA
WP_002303963.1|1819528_1821856_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002296840.1|1822130_1823318_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288970.1|1824175_1824469_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002286913.1|1824726_1825074_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1825209_1825971_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1825960_1826482_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1826651_1827443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1827567_1827819_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1827830_1828106_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1828358_1828913_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1828991_1829513_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1829516_1830095_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1830206_1831625_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1831645_1831984_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1831943_1832447_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1832577_1833282_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002303966.1|1833278_1835015_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|1835117_1837589_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002326707.1|1837861_1839136_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002289807.1|1839422_1840313_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002300070.1|1840509_1840992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1841199_1841565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326708.1|1841655_1841973_-	SdpI family protein	NA	NA	NA	NA	NA
WP_010782561.1|1842714_1843674_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002301623.1|1843796_1844771_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002297404.1|1845180_1846431_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1846716_1846974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1847205_1847619_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002324322.1|1847757_1848936_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002326711.1|1849208_1850387_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002295743.1|1850547_1851457_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_099098442.1|1851758_1852921_-|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_099745852.1|1853025_1854364_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	3.4e-78
WP_002301695.1|1854404_1855097_-	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	43.4	4.0e-30
WP_002294835.1|1855533_1856103_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002304701.1|1856176_1856500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294839.1|1856653_1857466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|1857819_1858668_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002304699.1|1858812_1859754_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002299539.1|1863548_1865720_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002312937.1|1865739_1867926_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	5.3e-121
WP_002289040.1|1867925_1868135_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002294855.1|1868147_1868588_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002304690.1|1868661_1869201_-	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002288779.1|1869815_1871282_-	amino acid permease	NA	NA	NA	NA	NA
WP_002304688.1|1871592_1873674_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.6	2.4e-115
WP_002288776.1|1874197_1874557_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002326717.1|1874586_1874928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304684.1|1874924_1875599_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288767.1|1876651_1877950_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002304682.1|1877989_1879180_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002348809.1|1879200_1879728_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002304681.1|1879774_1882564_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002288762.1|1882710_1882911_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002323868.1|1883362_1883683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1883960_1885256_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288760.1|1885707_1886826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304680.1|1887296_1888604_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002340453.1|1888722_1889922_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002289547.1|1889948_1891217_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.2e-42
WP_002348853.1|1892433_1892937_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002294889.1|1893059_1893824_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289551.1|1893931_1894207_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002312285.1|1894644_1895595_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002312284.1|1895773_1895974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782560.1|1896778_1897738_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002312282.1|1898603_1899134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312281.1|1899130_1899748_-	VanZ family protein	NA	NA	NA	NA	NA
WP_002312280.1|1900329_1900551_-	transferase	NA	NA	NA	NA	NA
WP_002348669.1|1900728_1902261_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002312276.1|1902396_1903482_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002312275.1|1903496_1904216_-	glycosyl transferase	NA	A0A2K9L639	Tupanvirus	25.0	2.6e-08
WP_002312274.1|1904212_1905523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348666.1|1905549_1906140_-	poly-gamma-glutamate biosynthesis protein	NA	NA	NA	NA	NA
WP_002312270.1|1906457_1907519_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.5	1.5e-12
WP_002312264.1|1908086_1909154_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002291721.1|1909173_1909653_-	EpsH	NA	NA	NA	NA	NA
WP_002325817.1|1909669_1910131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312259.1|1910144_1911395_-	nucleotide sugar dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	50.4	8.9e-105
WP_002312258.1|1911772_1913224_-	sugar transferase	NA	NA	NA	NA	NA
WP_002312256.1|1913544_1914309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348664.1|1914336_1915035_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	37.1	6.0e-26
WP_002348663.1|1915046_1915826_-	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_002296209.1|1915841_1916786_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002348662.1|1916831_1917611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348661.1|1917990_1920066_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	2095976	2121998	2870397	transposase,tail,tRNA,plate,holin	Bacillus_phage(33.33%)	29	NA	NA
WP_000222572.1|2095976_2096930_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289406.1|2096963_2098193_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|2098194_2099112_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|2099115_2099853_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|2099943_2100471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|2100650_2101244_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|2101347_2101833_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|2101985_2102183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|2102277_2104038_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|2104034_2105765_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|2106157_2106370_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|2106371_2108051_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|2108304_2108505_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002347086.1|2109580_2109979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305550.1|2109971_2110424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002318238.1|2110410_2110917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324322.1|2111021_2112200_+|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2112428_2113768_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002312527.1|2113837_2114863_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	3.6e-64
WP_002286683.1|2114859_2115084_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|2115080_2115374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298029.1|2115411_2115549_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002350774.1|2115548_2115956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|2115983_2116508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350775.1|2116507_2116957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|2116960_2117578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|2117577_2118486_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002347081.1|2118498_2121261_-	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002303299.1|2121257_2121998_-|tail	tail protein	tail	NA	NA	NA	NA
>prophage 12
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	2125359	2174406	2870397	head,transposase,portal,tail,tRNA,terminase	Enterococcus_phage(26.09%)	55	NA	NA
WP_002303295.1|2125359_2125968_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002298045.1|2125968_2126346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298046.1|2126347_2126743_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002298048.1|2126735_2127107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|2127106_2127448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311614.1|2127459_2127675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312521.1|2127697_2128588_-	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002350777.1|2128602_2129304_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002304492.1|2129352_2129670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033582200.1|2129671_2130550_-|head	phage head morphogenesis protein	head	NA	NA	NA	NA
WP_002343932.1|2130629_2132165_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_002304486.1|2132176_2133595_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	51.5	2.5e-124
WP_002304484.1|2133572_2134001_-	hypothetical protein	NA	A0A1P8BMH5	Lactococcus_phage	63.1	2.6e-40
WP_002311618.1|2134018_2134243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304480.1|2134793_2135180_-	hypothetical protein	NA	O34053	Streptococcus_phage	55.2	1.9e-29
WP_002322045.1|2135192_2135606_-	autolysin	NA	C9E2P5	Enterococcus_phage	80.3	2.5e-56
WP_002286693.1|2135682_2135979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304475.1|2135975_2136179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304474.1|2136185_2136416_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_002304473.1|2136412_2136724_-	hypothetical protein	NA	A0A0D3MVS9	Staphylococcus_phage	58.0	5.3e-27
WP_002304472.1|2136862_2137678_-	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.4	1.8e-82
WP_002350868.1|2137674_2138001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292988.1|2137997_2138159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304469.1|2138173_2138533_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	47.5	6.8e-18
WP_002304468.1|2138529_2139381_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	3.0e-27
WP_002303278.1|2139395_2140196_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002303277.1|2140238_2141129_-	hypothetical protein	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303275.1|2141130_2142072_-	endonuclease	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303273.1|2142304_2142640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304466.1|2142891_2143131_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	1.8e-27
WP_002299038.1|2143439_2143595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304464.1|2143666_2143897_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002303266.1|2144064_2144331_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002303265.1|2144530_2145235_+	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303264.1|2145321_2146611_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303263.1|2146676_2148029_+	recombinase family protein	NA	D2IZV7	Enterococcus_phage	55.3	1.7e-133
WP_002304462.1|2147923_2148595_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002287951.1|2148649_2149303_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|2149292_2150606_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|2150915_2153561_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002287954.1|2153953_2154601_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287955.1|2155173_2156385_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287956.1|2156400_2157543_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287957.1|2157707_2159429_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287958.1|2159627_2160188_-	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287959.1|2160213_2161053_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287960.1|2161086_2161920_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287961.1|2162151_2163120_+	asparaginase	NA	NA	NA	NA	NA
WP_002287962.1|2163274_2164012_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287963.1|2164027_2164861_-	phosphotransferase	NA	NA	NA	NA	NA
WP_002294080.1|2165062_2166391_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002348865.1|2167480_2168110_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002287966.1|2168223_2168598_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_086956687.1|2168806_2169968_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_086953915.1|2173067_2174406_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 13
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	2328851	2352680	2870397	protease,transposase,bacteriocin	Bacillus_phage(37.5%)	22	NA	NA
WP_002288860.1|2328851_2329514_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002303458.1|2329589_2330882_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303461.1|2331051_2331681_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|2331783_2332593_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002305460.1|2332647_2333517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288852.1|2333517_2334834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294131.1|2334830_2336666_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	5.2e-37
WP_002288850.1|2336670_2337375_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002294132.1|2337564_2338425_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	4.6e-12
WP_002322652.1|2338411_2338981_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002294609.1|2339929_2340316_-	DUF4064 domain-containing protein	NA	NA	NA	NA	NA
WP_002294608.1|2340312_2340834_-	RDD family protein	NA	NA	NA	NA	NA
WP_002294607.1|2340835_2341870_-	signal peptide peptidase SppA	NA	A0A1C9LW82	Vibrio_phage	29.2	6.6e-13
WP_002348772.1|2341902_2343318_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_002303464.1|2343286_2345440_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	7.0e-41
WP_002303465.1|2345697_2345934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294603.1|2345952_2346168_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002348773.1|2346870_2347560_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002348774.1|2347683_2349003_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_002296840.1|2350576_2351764_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002294600.1|2352118_2352265_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_101701471.1|2352368_2352680_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 14
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	2487878	2612428	2870397	protease,transposase,holin,tRNA	Bacillus_phage(20.69%)	91	NA	NA
WP_002297218.1|2487878_2489174_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294493.1|2489328_2490012_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_002285996.1|2490013_2490850_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002302556.1|2490860_2492615_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.1e-39
WP_002285994.1|2492890_2493232_-	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	34.9	1.3e-10
WP_002294492.1|2493299_2495471_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002285989.1|2495681_2496539_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002285988.1|2496609_2497467_-	ROK family protein	NA	NA	NA	NA	NA
WP_002285985.1|2497451_2500154_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_002294491.1|2500166_2501456_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_002302559.1|2501605_2502652_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285980.1|2502653_2504807_+	alpha-1,2-mannosidase	NA	NA	NA	NA	NA
WP_002304851.1|2505279_2506731_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002285976.1|2506727_2508452_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010782528.1|2508444_2509059_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002285974.1|2509403_2510861_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002285972.1|2510901_2511822_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002285971.1|2511833_2512781_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002285969.1|2513259_2513979_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002304848.1|2514027_2515674_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002285964.1|2515852_2516443_+	transporter	NA	NA	NA	NA	NA
WP_002285962.1|2516534_2518040_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002285961.1|2518123_2519476_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002285960.1|2519475_2519994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285954.1|2520009_2520336_-	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002285949.1|2520348_2522328_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002285948.1|2522348_2522663_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002285944.1|2522830_2523124_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002321621.1|2523201_2524314_-	FUSC family protein	NA	NA	NA	NA	NA
WP_002297280.1|2524466_2524691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285932.1|2524700_2524880_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2525073_2525244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016252731.1|2525667_2526687_-	collagen binding domain-containing protein	NA	NA	NA	NA	NA
WP_002285924.1|2526833_2529905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303189.1|2531811_2532573_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285920.1|2532672_2534394_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.7e-37
WP_002285918.1|2534408_2536193_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.7e-46
WP_002285917.1|2536573_2538127_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2538474_2540889_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2541315_2543334_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2543703_2544360_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2544359_2545316_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2545315_2545882_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_000997695.1|2546500_2547679_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_076005178.1|2547702_2547894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|2548086_2549274_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_025479400.1|2549370_2549673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303477.1|2550447_2551467_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002301818.1|2551477_2551684_-|holin	holin	holin	NA	NA	NA	NA
WP_002301399.1|2551816_2552776_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002304713.1|2552978_2553911_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
WP_002341521.1|2553982_2554339_+	hypothetical protein	NA	U4KJ82	Streptococcus_phage	42.2	9.2e-15
WP_000997695.1|2554436_2555615_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2556485_2557825_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002301355.1|2557950_2559723_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.2e-54
WP_002285883.1|2559725_2561438_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002285876.1|2561552_2562221_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295567.1|2562287_2563076_-	esterase family protein	NA	NA	NA	NA	NA
WP_002295566.1|2563158_2564631_-	MFS transporter	NA	NA	NA	NA	NA
WP_002289731.1|2564760_2565954_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002297218.1|2566308_2567604_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296055.1|2575785_2577282_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	8.7e-91
WP_002290055.1|2577392_2578397_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002296053.1|2578397_2579285_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002287418.1|2579501_2581613_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002287415.1|2581702_2582248_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287414.1|2582247_2583693_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287412.1|2583812_2584283_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287409.1|2584328_2584754_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287407.1|2584820_2585090_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_101701472.1|2585100_2586696_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287403.1|2586710_2590232_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002287401.1|2590248_2590809_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002287399.1|2591161_2592136_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002287397.1|2592305_2593706_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_002287391.1|2593783_2594506_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287389.1|2594584_2595091_-	membrane protein	NA	NA	NA	NA	NA
WP_002322796.1|2595213_2597013_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_002297218.1|2597174_2598470_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002322795.1|2598602_2600141_-	hypothetical protein	NA	B5LJD6	Mycobacterium_phage	50.5	2.3e-17
WP_000122610.1|2600520_2601813_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002297218.1|2601957_2603253_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287385.1|2603424_2603934_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002296044.1|2603937_2604792_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002287382.1|2604946_2605585_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_002287380.1|2605585_2606236_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002287379.1|2606248_2607148_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_002287377.1|2607312_2609382_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	30.3	3.5e-21
WP_002287376.1|2609378_2610119_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_002287374.1|2610131_2611490_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002287372.1|2611489_2612428_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.7	5.2e-09
>prophage 15
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	2696290	2709408	2870397		Streptococcus_phage(83.33%)	16	NA	NA
WP_002297366.1|2696290_2696605_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2696617_2696992_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|2696992_2697337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343904.1|2697419_2698565_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	62.8	6.0e-132
WP_002297361.1|2699279_2701139_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_002297360.1|2701232_2701472_+	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	80.3	2.1e-23
WP_002297358.1|2701549_2702224_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|2702456_2702891_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2702891_2703599_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2703588_2703879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2704137_2705322_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2705318_2705456_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_101701473.1|2706201_2708115_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	1.3e-35
WP_033658092.1|2708218_2708443_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2708455_2708959_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2709018_2709408_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
>prophage 16
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	2736586	2769859	2870397	integrase,transposase	Bacillus_phage(37.5%)	36	2753515:2753530	2763760:2763775
WP_002297332.1|2736586_2736781_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077828743.1|2736972_2737128_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002297326.1|2738984_2740601_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_002317220.1|2740718_2740937_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2741131_2741593_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002304820.1|2741785_2742025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297324.1|2742048_2743572_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002322279.1|2743589_2743712_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002304819.1|2743741_2744725_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|2744748_2744898_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|2744918_2745296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|2745327_2745507_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|2745521_2745791_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002297310.1|2746313_2748056_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-30
WP_002297309.1|2748039_2749794_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002297308.1|2749903_2750473_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002311663.1|2750490_2751915_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.9e-20
WP_002297304.1|2751916_2752585_-	cobalt transporter	NA	NA	NA	NA	NA
WP_071858995.1|2752715_2753300_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2753515:2753530	attL	ACCTTTTCTAAAATAA	NA	NA	NA	NA
WP_002297302.1|2753630_2753864_-	iron-dependent repressor	NA	NA	NA	NA	NA
WP_002297295.1|2753878_2754829_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297294.1|2754825_2755668_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002297293.1|2755989_2757177_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002297292.1|2757268_2758009_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002320809.1|2758696_2758855_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297291.1|2758926_2760153_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002348684.1|2760482_2761103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002364278.1|2761183_2761594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298782.1|2763143_2763920_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
2763760:2763775	attR	TTATTTTAGAAAAGGT	NA	NA	NA	NA
WP_002322873.1|2764017_2764665_-	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.4	4.5e-12
WP_002298780.1|2764664_2765495_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002298779.1|2765494_2766244_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298777.1|2766257_2766722_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002312606.1|2766771_2767233_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298774.1|2767214_2768189_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_076005180.1|2768395_2769859_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	2.2e-123
>prophage 17
NZ_CP023804	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate chromosome, complete genome	2870397	2781253	2845601	2870397	protease,integrase,transposase	Streptococcus_phage(15.38%)	51	2791004:2791018	2796645:2796659
WP_010782540.1|2781253_2782528_+|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	6.6e-55
WP_002348881.1|2782587_2782935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322858.1|2782927_2783230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348880.1|2783445_2784837_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_002348879.1|2784821_2785433_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_002322855.1|2785444_2785633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016252733.1|2785646_2788292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348876.1|2788278_2788497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|2789525_2790698_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
2791004:2791018	attL	ATTATTCAAAAAAAC	NA	NA	NA	NA
WP_002321715.1|2791028_2791355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348874.1|2791362_2791566_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002322813.1|2791640_2792291_+	helix-turn-helix transcriptional regulator	NA	Q20DG0	Lactobacillus_phage	33.3	3.2e-05
WP_002318021.1|2792345_2793512_+|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	34.0	3.3e-45
WP_002287505.1|2793600_2793993_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002295975.1|2794008_2794452_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002297290.1|2794970_2795438_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_002288118.1|2795557_2797096_-	gluconokinase	NA	NA	NA	NA	NA
2796645:2796659	attR	GTTTTTTTGAATAAT	NA	NA	NA	NA
WP_002288144.1|2797175_2797862_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_002288119.1|2798062_2798590_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288121.1|2798673_2799351_-	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	23.2	1.6e-07
WP_002288122.1|2799347_2800478_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	51.6	1.6e-73
WP_002288124.1|2800477_2802661_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002288127.1|2802657_2803683_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002288129.1|2803727_2804555_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002288131.1|2804551_2805619_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002288133.1|2805644_2806481_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288134.1|2806477_2807347_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002288135.1|2807416_2808700_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002288137.1|2808713_2810399_-	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002288139.1|2810673_2811699_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_010782538.1|2812293_2815947_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.0	2.2e-63
WP_002320801.1|2816025_2819652_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.7	1.5e-48
WP_002289394.1|2820370_2821339_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002289390.1|2821356_2822262_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289388.1|2822258_2823065_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	1.3e-08
WP_002297218.1|2823172_2824468_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002297289.1|2824743_2825712_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_002289384.1|2826028_2826553_-	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_002289382.1|2826839_2828822_+	collagen-binding MSCRAMM adhesin Scm	NA	NA	NA	NA	NA
WP_002289380.1|2828976_2829963_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002304808.1|2829985_2830552_-	Gx transporter family protein	NA	NA	NA	NA	NA
WP_002294810.1|2830565_2830982_-	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_002289023.1|2831438_2833373_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002289025.1|2833674_2834610_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_002294811.1|2834699_2835803_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002304806.1|2835815_2836769_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002289031.1|2837703_2839050_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_021415055.1|2839183_2840425_-	U32 family peptidase	NA	Q6DW11	Phage_TP	32.9	1.2e-42
WP_002289033.1|2840442_2841366_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_002326809.1|2841661_2842957_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289035.1|2843108_2845601_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	38.3	9.0e-125
>prophage 1
NZ_CP023805	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence	201207	12910	20581	201207	transposase	Temperate_phage(16.67%)	12	NA	NA
WP_002321302.1|12910_13384_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	62.0	5.6e-44
WP_002321303.1|13749_14010_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
WP_002296239.1|14454_14661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305766.1|14660_14912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305764.1|14927_15344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348912.1|15325_15598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305759.1|15764_16166_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	43.1	1.4e-24
WP_002305757.1|16177_17323_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D9J0Y9	Brochothrix_phage	74.6	7.7e-164
WP_002287514.1|17560_17824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321032.1|17817_18168_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002318230.1|18191_18806_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.9	2.6e-17
WP_002348911.1|19255_20581_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.6	1.2e-99
>prophage 2
NZ_CP023805	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence	201207	36063	146492	201207	holin,protease,integrase,bacteriocin,transposase	Streptococcus_phage(21.21%)	97	82729:82754	130842:130867
WP_002300034.1|36063_38121_-|protease	serine protease	protease	NA	NA	NA	NA
WP_002300033.1|38265_38457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300032.1|38644_39100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305782.1|39096_39339_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002302862.1|39356_39659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302860.1|39727_41782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302859.1|41781_44394_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_002302858.1|44390_46769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302857.1|46829_47372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302856.1|47449_47782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302855.1|47782_48376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302854.1|48397_50422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302853.1|50421_51621_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	38.1	2.5e-32
WP_002302852.1|51636_52281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302851.1|52291_53098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582323.1|53508_54444_+	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_002305788.1|54487_54757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302849.1|55032_55308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302844.1|55349_55772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582318.1|55791_57384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302842.1|57404_57740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302840.1|57885_58080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|58215_59466_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305801.1|59875_62248_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_087121894.1|62322_63777_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|63787_65797_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002303484.1|66142_66739_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002303483.1|66751_67651_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|67653_67785_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|67806_68139_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002303482.1|68183_68417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|68575_68698_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|68887_69112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|69554_69761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|69760_70012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|70192_70465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|70909_71089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|71147_71504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|72472_73426_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|73546_73810_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000997695.1|74181_75360_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002332708.1|75891_76800_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002300835.1|78744_79200_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|79213_80542_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|80575_80860_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|80861_81377_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|81392_82055_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|82061_82634_+	SIS domain-containing protein	NA	NA	NA	NA	NA
82729:82754	attL	CGTAAGCGCCCCATAGAACAGTACCT	NA	NA	NA	NA
WP_002303202.1|82805_84353_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	2.8e-44
WP_002287659.1|84454_84808_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|84797_84992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300843.1|85173_86694_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|86936_87122_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|87105_87288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|88241_88841_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|88904_89504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305879.1|90519_91392_-	ROK family protein	NA	NA	NA	NA	NA
WP_000195429.1|91634_92807_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002303302.1|92987_94934_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|95118_96558_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|96559_97522_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|97691_99118_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|99360_99816_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|100401_100632_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|100861_101680_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|101840_102530_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|102543_104046_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|104058_104535_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|105032_106195_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|107312_107831_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|109906_110992_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|111099_112053_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002348774.1|113134_114454_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_002324322.1|115716_116895_+|transposase	IS256-like element ISEfm2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	24.9	2.6e-29
WP_002301128.1|117474_118470_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|118485_119655_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|119670_120405_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087043335.1|121175_122338_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_002301811.1|122906_124199_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|124472_124733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|124983_126162_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_073120200.1|126513_126810_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	6.7e-19
WP_002287876.1|127758_128154_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287875.1|128163_129012_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287874.1|129026_129854_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002285758.1|130924_131119_+	hypothetical protein	NA	NA	NA	NA	NA
130842:130867	attR	CGTAAGCGCCCCATAGAACAGTACCT	NA	NA	NA	NA
WP_002287659.1|131108_131462_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|131563_133111_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002300493.1|133316_134486_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_099745857.1|134825_135512_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
WP_000195429.1|136135_137308_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002348774.1|137558_138878_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_000997695.1|139969_141148_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_158294579.1|142168_143716_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	1.1e-06
WP_002304894.1|143773_144040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303113.1|144715_145267_-	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_002319817.1|145811_146492_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
