The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	82119	229233	2867770	holin,tRNA,transposase	Streptococcus_phage(13.51%)	124	NA	NA
WP_002298563.1|82119_82866_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002301399.1|83538_84498_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002326711.1|84872_86051_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002317041.1|86395_86734_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_002348801.1|86868_87270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317547.1|87381_88002_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002294300.1|88092_90762_-	YfhO family protein	NA	NA	NA	NA	NA
WP_002290463.1|90999_91188_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002294298.1|91457_91820_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002301169.1|91871_93554_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002301167.1|93670_95707_+	ATP-dependent DNA helicase RecG	NA	A0A2H4JBQ0	uncultured_Caudovirales_phage	22.9	5.3e-06
WP_002289721.1|95755_96757_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002294295.1|96878_97121_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002287889.1|97388_98393_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	5.1e-18
WP_002287891.1|98393_99338_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	3.9e-20
WP_002287892.1|99337_100300_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287893.1|100326_101241_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287894.1|101266_103048_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287896.1|103395_104082_+	ribonuclease III	NA	K7YH73	Megavirus	32.3	9.1e-27
WP_002301166.1|104101_107683_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_002348798.1|107691_108501_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002301165.1|108512_109511_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_101701466.1|109697_111965_+	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_002326066.1|112148_113102_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294287.1|113119_113572_-	YueI family protein	NA	NA	NA	NA	NA
WP_002294286.1|113721_114672_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.5	1.6e-66
WP_002301163.1|114664_115624_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002301162.1|115620_116376_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	2.2e-13
WP_002301160.1|116398_117352_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287909.1|117995_118292_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
WP_002287910.1|118647_119004_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002348747.1|119013_119913_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010782507.1|120145_121105_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_010782508.1|121362_122808_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	2.2e-123
WP_002348590.1|122853_123588_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_002301190.1|123913_124324_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002294273.1|124316_125018_+	LrgB family protein	NA	NA	NA	NA	NA
WP_002348592.1|125017_126631_+	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
WP_002290506.1|126620_126842_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	33.3	1.1e-05
WP_002297929.1|126838_127600_+	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.7	1.2e-16
WP_002294268.1|127980_128490_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	31.8	7.5e-10
WP_002294267.1|128559_129099_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002294265.1|129238_129850_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002324284.1|130165_130963_+	formate/nitrite transporter	NA	NA	NA	NA	NA
WP_002294262.1|130990_131626_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002294261.1|131645_132419_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002348595.1|132826_133624_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297923.1|133601_134015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294258.1|133998_136644_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.6e-39
WP_002301736.1|136661_138770_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.8e-57
WP_002348596.1|138791_139352_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002297218.1|139490_140786_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002285758.1|141045_141240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|141229_141583_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|141684_143232_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002348864.1|143311_145300_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002294254.1|145522_146236_+	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002294252.1|146312_146759_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002290528.1|146928_147531_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002289812.1|147543_148545_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_002341570.1|148573_149152_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294249.1|149203_149686_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002289815.1|149802_150177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294246.1|150976_152329_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002297079.1|152475_153066_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_002294242.1|153193_154543_-	amino acid permease	NA	NA	NA	NA	NA
WP_002294240.1|154710_155451_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	5.5e-30
WP_002297081.1|155463_157056_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002293448.1|157623_157920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294236.1|158095_158821_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_002301156.1|158813_159656_+	chorismate mutase	NA	NA	NA	NA	NA
WP_002294232.1|159658_160180_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002289284.1|160432_160996_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	2.3e-12
WP_002289282.1|161246_161516_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002297086.1|161703_163830_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002289280.1|164339_164606_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002289279.1|164749_166741_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.9	8.4e-65
WP_002294228.1|167094_168396_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002326809.1|168771_170067_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_010782510.1|170134_171313_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	39.9	3.8e-65
WP_002289277.1|171659_173030_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002289744.1|173211_173535_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002299254.1|173859_174468_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_002348768.1|174797_175514_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_002289749.1|175526_176222_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_002289751.1|176305_176935_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.2	3.1e-34
WP_086953915.1|177449_178788_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002294220.1|178857_179460_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	30.6	3.6e-19
WP_002296548.1|179481_179970_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002294217.1|180290_181664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294214.1|181647_182115_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_002329999.1|182363_184109_-	AarF/ABC1/UbiB kinase family protein	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.1	1.3e-40
WP_002293424.1|184304_185381_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002317074.1|185533_186886_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_086272912.1|187201_188719_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.2	1.3e-62
WP_002294209.1|188848_189199_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002294207.1|189214_190336_+	alanine racemase	NA	NA	NA	NA	NA
WP_002289874.1|190346_190709_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	37.8	7.6e-09
WP_002293413.1|190884_191154_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002294206.1|191343_192291_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016171130.1|192436_193732_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.2	1.1e-09
WP_002301399.1|193998_194958_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002294203.1|195183_197889_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_002294202.1|198485_200309_+	APC family permease	NA	NA	NA	NA	NA
WP_002348885.1|200450_200636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294199.1|201110_201374_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002301121.1|201373_201640_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002301116.1|202870_203542_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002301114.1|203538_204456_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293405.1|204452_205094_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002348889.1|205097_206273_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.0e-17
WP_002350806.1|206465_207497_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002341590.1|209173_210127_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002319878.1|210217_211513_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_002326809.1|211674_212970_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289743.1|213679_216319_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.2	1.6e-84
WP_002294185.1|216486_217185_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002341590.1|217287_218241_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294183.1|218469_219615_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002300794.1|219711_220092_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_010782512.1|220396_222994_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010782513.1|222901_224512_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	8.4e-124
WP_002300788.1|226789_227269_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_086953915.1|227894_229233_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 2
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	260579	268316	2867770		Streptococcus_phage(66.67%)	6	NA	NA
WP_002297361.1|260579_262439_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_000398284.1|262995_264201_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_002286940.1|264984_266895_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_032509114.1|266998_267223_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	97.1	8.5e-27
WP_002345010.1|267339_267837_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	97.6	1.3e-88
WP_002345009.1|267923_268316_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	4.6e-68
>prophage 3
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	283893	332057	2867770	tRNA,transposase	Streptococcus_phage(33.33%)	44	NA	NA
WP_002354485.1|283893_284580_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002348732.1|284731_287773_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.2	4.0e-18
WP_002348733.1|287962_288547_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_010782519.1|288543_289683_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002336644.1|290060_292103_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002336645.1|292113_292734_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002336646.1|292745_293204_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002331203.1|293222_293501_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002336647.1|293525_294893_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002331205.1|294907_296053_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	1.2e-52
WP_002331206.1|296079_296571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002345001.1|297013_298213_+	MFS transporter	NA	NA	NA	NA	NA
WP_002331208.1|298707_299466_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002331209.1|299633_300569_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002336649.1|300565_302011_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002336650.1|302038_302494_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002336651.1|302512_303487_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002336652.1|304302_304917_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002331215.1|305157_305541_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301781.1|305903_306413_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002296570.1|306512_307163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291914.1|307613_308552_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002291912.1|308564_309617_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296392.1|309882_310518_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002296391.1|310708_311500_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002326839.1|311979_312888_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002295755.1|312943_313441_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002340421.1|313477_314161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296262.1|314507_314774_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002296261.1|314800_315100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296259.1|315273_315825_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002296258.1|315970_316264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304106.1|316256_316553_+	peptidase	NA	NA	NA	NA	NA
WP_002296256.1|316627_317626_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|317717_318671_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294735.1|318769_319486_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002296623.1|319684_320980_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_025478783.1|321026_323075_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_002294732.1|324284_325526_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002294730.1|325672_326308_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294728.1|326498_327239_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002296909.1|327383_329021_-	membrane protein	NA	NA	NA	NA	NA
WP_000195429.1|329232_330405_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000997695.1|330878_332057_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	766538	775010	2867770		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|766538_767183_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|767197_767527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|767540_768479_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|768514_769339_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|769331_769679_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|769747_770620_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|770728_771850_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|771903_772506_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|772820_775010_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 5
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	831049	910160	2867770	integrase,tail,holin,transposase,portal,protease,terminase,capsid,tRNA,head	Enterococcus_phage(25.64%)	95	887944:887959	891297:891312
WP_002286621.1|831049_833848_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|833896_835423_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|835437_836085_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|836268_836598_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|836774_837503_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|837518_838532_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|838531_839809_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|839871_842574_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|842725_843043_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|843072_843393_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|843478_844939_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|845006_845228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|845258_845441_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|845440_845854_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|845976_847158_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|847688_848828_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|849126_849762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|849874_850510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|850543_851005_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002348715.1|851134_851566_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|851583_851904_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|852202_852979_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|852993_853197_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|853212_853551_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|853537_853717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|853759_854230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|854316_855015_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|855192_855534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|855526_856198_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|856203_856890_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|856892_857642_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|857653_857923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|858084_858387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|858383_858545_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|858541_858847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|858846_859203_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|859162_859408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|859404_859824_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|859820_860378_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|860374_860671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|860747_861161_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002300143.1|861618_861894_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|862347_862554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|862749_862917_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|862942_863287_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|863291_863573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|863675_863990_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|863967_865662_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|865681_866860_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|866822_867509_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|867508_868669_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|868678_869554_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|869550_869862_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|869851_870205_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|870194_870596_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|870588_870993_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|871004_871613_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|871632_871995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|871997_872180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348716.1|872196_875628_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|875678_876416_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002286497.1|876425_878717_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.0	9.6e-89
WP_002286495.1|878740_880867_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286491.1|881029_881476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|881477_881615_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|881652_881946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|881942_882167_+|holin	holin	holin	NA	NA	NA	NA
WP_002349643.1|882163_883189_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_087046766.1|884128_885290_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002324322.1|886177_887356_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002286474.1|887546_887954_+	hypothetical protein	NA	NA	NA	NA	NA
887944:887959	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|887967_888369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|888370_888742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|888777_889080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076005172.1|889328_889529_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_070571278.1|889833_891066_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|891322_891892_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
891297:891312	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002297963.1|892069_892510_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|892667_893432_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|893463_894387_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|894462_895602_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|895594_896395_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|896394_897222_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|897199_897934_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|898033_898900_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|898913_899486_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|899507_900536_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|900633_901485_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002348826.1|901518_903552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348825.1|903595_904876_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002285758.1|905112_905307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|905296_905650_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|905751_907299_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_101701468.1|907337_908621_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	1.2e-08
WP_010782578.1|908885_910160_-|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	8.6e-55
>prophage 6
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	1081988	1138110	2867770	protease,tRNA,transposase	Lysinibacillus_phage(25.0%)	54	NA	NA
WP_002297218.1|1081988_1083284_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002321398.1|1083519_1085619_+	TFIIB-type zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002290060.1|1085814_1086678_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_002322512.1|1086782_1087256_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002297218.1|1087322_1088618_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294386.1|1088873_1089761_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	1.2e-31
WP_002294387.1|1089779_1090151_+	protein RibT	NA	NA	NA	NA	NA
WP_002305297.1|1090120_1090918_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.0	6.4e-08
WP_002296975.1|1090901_1091471_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	1.5e-14
WP_002294391.1|1091476_1092193_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002296977.1|1092522_1093134_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002290168.1|1093511_1095035_+	YfcC family protein	NA	NA	NA	NA	NA
WP_002294399.1|1095271_1096612_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_002294400.1|1096764_1097502_+	thioesterase	NA	NA	NA	NA	NA
WP_002294401.1|1097666_1097888_-	ferredoxin	NA	NA	NA	NA	NA
WP_002305295.1|1097918_1098950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303122.1|1098936_1100340_+	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	6.5e-64
WP_002294404.1|1100405_1101041_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002303123.1|1101089_1101770_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002294406.1|1101904_1103134_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002296982.1|1103315_1104626_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002290178.1|1104868_1105144_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	69.7	1.8e-26
WP_101701469.1|1105279_1106575_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002297185.1|1106891_1108187_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002294410.1|1108422_1109469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289879.1|1109470_1110730_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002289878.1|1110735_1111317_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_002294412.1|1111398_1112274_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.3	5.9e-63
WP_002290045.1|1112421_1112754_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002294414.1|1112865_1114074_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.7	1.5e-45
WP_002290187.1|1114227_1114683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1114876_1116172_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290188.1|1116566_1116842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288388.1|1116854_1118933_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002288390.1|1119092_1120979_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.6e-52
WP_002294416.1|1120990_1121938_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	7.1e-123
WP_002288392.1|1121957_1122485_+	dihydrofolate reductase	NA	A0A1D6X864	Bacillus_phage	37.1	6.7e-22
WP_002288393.1|1122547_1123201_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002288394.1|1123332_1124175_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.2	6.5e-19
WP_002288395.1|1124332_1125229_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288396.1|1125231_1125945_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002288397.1|1125964_1126483_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288398.1|1126479_1126707_+	YozE family protein	NA	NA	NA	NA	NA
WP_002294418.1|1126858_1127410_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002288403.1|1127492_1128035_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002288405.1|1128271_1128670_-	glyoxalase	NA	NA	NA	NA	NA
WP_002296988.1|1128929_1129790_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002296990.1|1129782_1130550_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.5	2.7e-27
WP_002303743.1|1130605_1131463_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002288411.1|1131584_1133663_+	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	38.5	1.2e-101
WP_002320953.1|1133631_1135008_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002288415.1|1135205_1136111_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	9.4e-32
WP_002288419.1|1136147_1136696_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_002288421.1|1136709_1138110_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.8	1.7e-43
>prophage 7
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	1202921	1211982	2867770		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1202921_1204217_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1204396_1204774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1205029_1205758_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1205757_1206012_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1206013_1206685_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1206685_1208908_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1208892_1210332_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|1210363_1211407_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1211403_1211982_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 8
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	1495383	1544400	2867770	protease,transposase	Streptococcus_phage(23.08%)	57	NA	NA
WP_010729485.1|1495383_1496919_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	1.4e-123
WP_002295142.1|1497142_1497514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1497769_1498012_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1498043_1498946_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1498958_1499147_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1499160_1499724_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1499761_1500655_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002296674.1|1500732_1501671_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1501704_1502055_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1502087_1502990_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1502982_1503840_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002348903.1|1504173_1504983_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1505022_1505520_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1506164_1506488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1506651_1506906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1506975_1507221_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002348902.1|1507317_1507662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1507722_1508286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293303.1|1508853_1509054_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002302440.1|1509676_1510978_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296656.1|1511306_1512020_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1512012_1513098_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1513114_1513558_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1513591_1513945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1514056_1514458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1514494_1515004_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1515025_1515883_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1515900_1516734_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1516747_1517545_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1517577_1517862_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1517858_1518860_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002296640.1|1518861_1519764_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
WP_002296639.1|1519927_1520776_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1521421_1521628_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1521829_1522831_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1522835_1524749_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1524916_1525423_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1525582_1526023_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1526048_1527206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1527208_1527565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1527862_1528837_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1529032_1529872_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1530056_1530944_+	rotamase	NA	NA	NA	NA	NA
WP_002311093.1|1531527_1532223_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1532206_1532605_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|1533013_1534264_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002289425.1|1534405_1535401_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1535418_1535973_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|1535960_1536452_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289420.1|1538330_1539131_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002305631.1|1539323_1539569_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1539707_1540193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1540648_1541062_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002322258.1|1541198_1541459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321532.1|1541576_1541867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1542112_1543291_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1543446_1544400_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	1680093	1919635	2867770	plate,integrase,tail,holin,transposase,portal,protease,terminase,capsid,tRNA,head	Streptococcus_phage(18.29%)	234	1757126:1757144	1774221:1774239
WP_002288520.1|1680093_1681017_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002294143.1|1684194_1684416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294142.1|1684523_1684871_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002294141.1|1684897_1687204_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|1687216_1687528_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|1687524_1687818_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002301262.1|1687839_1689015_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|1689038_1689512_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002294138.1|1689655_1694008_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	41.4	3.9e-22
WP_002294137.1|1694219_1695929_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1695996_1697265_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1697425_1698226_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1698222_1699035_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002287107.1|1699443_1700694_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002293875.1|1701012_1701570_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1701572_1702295_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1702430_1703312_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1703410_1704193_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1704551_1705031_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1705247_1706339_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002326699.1|1706331_1706460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|1706463_1707009_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002288432.1|1707461_1709153_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1709571_1710519_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1710633_1711653_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1711743_1712973_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1713433_1714135_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326809.1|1714306_1715602_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002301319.1|1716265_1717282_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1717278_1717743_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002348676.1|1717749_1718292_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1718275_1719100_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1719188_1720169_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1720192_1721677_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1721688_1722678_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1722925_1723093_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1723154_1724966_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1724962_1725328_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1725490_1725886_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1725903_1726866_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1726865_1727078_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1727098_1727797_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1727816_1728359_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1728490_1729495_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1729491_1730481_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1730477_1731284_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_010782564.1|1731449_1732406_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1732482_1733001_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1733088_1733238_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1733465_1733912_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|1734106_1736002_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1736326_1737301_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_086953915.1|1738106_1739446_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_084201531.1|1739516_1740542_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_002286683.1|1740538_1740763_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|1740759_1741053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298029.1|1741090_1741228_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002350774.1|1741227_1741635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|1741662_1742187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350775.1|1742186_1742636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|1742639_1743257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|1743256_1744165_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_069314735.1|1744177_1746937_-	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.6	6.8e-49
WP_069314753.1|1746933_1747638_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069314734.1|1747649_1749953_-|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	48.3	2.1e-83
WP_069314733.1|1750147_1750612_-	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	40.3	1.7e-16
WP_069314732.1|1750611_1751238_-|tail	phage tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	4.4e-28
WP_069314731.1|1751244_1751610_-	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	41.1	7.7e-17
WP_010725764.1|1751599_1751938_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	47.7	6.6e-23
WP_069314730.1|1751927_1752254_-|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	1.7e-23
WP_002301326.1|1752234_1752513_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	3.5e-22
WP_084201525.1|1752514_1753879_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.4	2.9e-125
WP_084201523.1|1753891_1754467_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	68.4	1.1e-65
WP_099745849.1|1754432_1755662_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	65.5	2.7e-146
WP_069314727.1|1755683_1757411_-|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	7.6e-264
1757126:1757144	attL	CTTTTTCATTTTCTTTAAC	NA	NA	NA	NA
WP_002301332.1|1757407_1757860_-	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	68.5	8.0e-48
WP_002317992.1|1757971_1758352_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	67.2	9.1e-45
WP_069314726.1|1758348_1758735_-	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	37.3	8.7e-11
WP_069314725.1|1758715_1759102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154212406.1|1759406_1759550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010725701.1|1759874_1760342_-	ArpU family phage transcriptional regulator	NA	D7RWH7	Brochothrix_phage	29.1	2.4e-07
WP_050397116.1|1760416_1760857_-	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	37.7	9.0e-20
WP_069314724.1|1760886_1761180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002309099.1|1761176_1761380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314723.1|1761386_1761617_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_069314722.1|1761783_1762074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314721.1|1762084_1762660_-	DUF1642 domain-containing protein	NA	A0A0E3T929	Enterococcus_phage	32.1	2.1e-16
WP_002326231.1|1763693_1763984_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	43.4	1.1e-13
WP_101733640.1|1763983_1764289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101733641.1|1764285_1764447_-	antitoxin	NA	NA	NA	NA	NA
WP_002353076.1|1764443_1764746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101733642.1|1764907_1765177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101733643.1|1765188_1766040_-	replication protein	NA	A0A1S5SFJ6	Streptococcus_phage	67.1	2.1e-49
WP_069314714.1|1766046_1766733_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	70.0	2.2e-89
WP_002286557.1|1766738_1767410_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|1767402_1767744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|1767921_1768620_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|1768706_1769177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314713.1|1769219_1769399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342110.1|1769411_1769678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353431.1|1769688_1769883_-	hypothetical protein	NA	M1IFE9	Streptococcus_phage	53.1	1.1e-11
WP_033655448.1|1770187_1770607_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	62.3	3.0e-41
WP_069314712.1|1770623_1771046_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	50.7	3.6e-34
WP_002317583.1|1771074_1771275_+	hypothetical protein	NA	A0A097BY73	Enterococcus_phage	87.9	2.5e-25
WP_069314711.1|1771360_1771801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314710.1|1771938_1773144_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	37.4	7.3e-64
WP_002296332.1|1773427_1773994_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348678.1|1774249_1775581_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
1774221:1774239	attR	GTTAAAGAAAATGAAAAAG	NA	NA	NA	NA
WP_002296335.1|1775546_1775897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296337.1|1776408_1776753_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1777018_1777978_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|1778167_1778764_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1778887_1780687_+	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1780964_1781177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1782040_1783000_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|1783212_1784121_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|1784169_1784556_+	YxeA family protein	NA	NA	NA	NA	NA
WP_000122610.1|1784859_1786152_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002288574.1|1786370_1787717_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1787828_1789178_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|1789294_1790548_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|1790618_1791104_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288579.1|1791126_1791885_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1791900_1793079_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1793308_1795429_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002296838.1|1795651_1796377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1796366_1796876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1796945_1798394_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1798393_1799110_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1799090_1799441_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1799584_1800358_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1801114_1801417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1801855_1803034_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1803370_1803610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1803971_1804232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1804416_1804914_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1805043_1805754_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1805766_1807431_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1807635_1808298_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1808307_1809123_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1809384_1809828_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1809961_1810300_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302962.1|1810287_1810665_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322902.1|1810888_1812082_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1812247_1812670_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002303955.1|1813258_1813714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1813875_1815048_-	class C sortase	NA	NA	NA	NA	NA
WP_002303963.1|1818178_1820506_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002296840.1|1820780_1821968_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288970.1|1822825_1823119_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002286913.1|1823376_1823724_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1823859_1824621_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1824610_1825132_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1825301_1826093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1826217_1826469_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1826480_1826756_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1827008_1827563_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1827641_1828163_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1828166_1828745_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1828856_1830275_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1830295_1830634_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1830593_1831097_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1831227_1831932_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002303966.1|1831928_1833665_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|1833767_1836239_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002326707.1|1836511_1837786_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002289807.1|1838072_1838963_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002300070.1|1839159_1839642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1839849_1840215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326708.1|1840305_1840623_-	SdpI family protein	NA	NA	NA	NA	NA
WP_010782561.1|1841364_1842324_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002301623.1|1842446_1843421_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002297404.1|1843830_1845081_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1845366_1845624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1845855_1846269_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002324322.1|1846407_1847586_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002326711.1|1847858_1849037_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002295743.1|1849197_1850107_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_099098442.1|1850408_1851571_-|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_099745852.1|1851675_1853014_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	3.4e-78
WP_002301695.1|1853054_1853747_-	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	43.4	4.0e-30
WP_002294835.1|1854183_1854753_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002304701.1|1854826_1855150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294839.1|1855303_1856116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|1856469_1857318_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002304699.1|1857462_1858404_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002299539.1|1862198_1864370_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002312937.1|1864389_1866576_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	5.3e-121
WP_002289040.1|1866575_1866785_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002294855.1|1866797_1867238_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002304690.1|1867311_1867851_-	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002288779.1|1868465_1869932_-	amino acid permease	NA	NA	NA	NA	NA
WP_002304688.1|1870242_1872324_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.6	2.4e-115
WP_002288776.1|1872847_1873207_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002326717.1|1873236_1873578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304684.1|1873574_1874249_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288767.1|1875301_1876600_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002304682.1|1876639_1877830_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002348809.1|1877850_1878378_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002304681.1|1878424_1881214_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002288762.1|1881360_1881561_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002323868.1|1882012_1882333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1882610_1883906_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288760.1|1884357_1885476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304680.1|1885946_1887254_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002340453.1|1887372_1888572_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002289547.1|1888598_1889867_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.2e-42
WP_002348853.1|1891083_1891587_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002294889.1|1891709_1892474_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289551.1|1892581_1892857_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002312285.1|1893294_1894245_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002312284.1|1894423_1894624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782560.1|1895428_1896388_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002312282.1|1897253_1897784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312281.1|1897780_1898398_-	VanZ family protein	NA	NA	NA	NA	NA
WP_002312280.1|1898979_1899201_-	transferase	NA	NA	NA	NA	NA
WP_002348669.1|1899378_1900911_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002312276.1|1901046_1902132_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002312275.1|1902146_1902866_-	glycosyl transferase	NA	A0A2K9L639	Tupanvirus	25.0	2.6e-08
WP_002312274.1|1902862_1904173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348666.1|1904199_1904790_-	poly-gamma-glutamate biosynthesis protein	NA	NA	NA	NA	NA
WP_002312270.1|1905107_1906169_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.5	1.5e-12
WP_002312264.1|1906736_1907804_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002291721.1|1907823_1908303_-	EpsH	NA	NA	NA	NA	NA
WP_002325817.1|1908319_1908781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312259.1|1908794_1910045_-	nucleotide sugar dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	50.4	8.9e-105
WP_101733644.1|1910422_1911874_-	sugar transferase	NA	NA	NA	NA	NA
WP_002312256.1|1912194_1912959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348664.1|1912986_1913685_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	37.1	6.0e-26
WP_002348663.1|1913696_1914476_-	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_002296209.1|1914491_1915436_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002348662.1|1915481_1916261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348661.1|1916640_1918716_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002305598.1|1918717_1919635_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	2094626	2120648	2867770	plate,holin,transposase,tRNA,tail	Bacillus_phage(33.33%)	29	NA	NA
WP_000222572.1|2094626_2095580_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289406.1|2095613_2096843_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|2096844_2097762_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|2097765_2098503_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|2098593_2099121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|2099300_2099894_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|2099997_2100483_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|2100635_2100833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|2100927_2102688_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|2102684_2104415_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|2104807_2105020_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|2105021_2106701_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|2106954_2107155_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002347086.1|2108230_2108629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305550.1|2108621_2109074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002318238.1|2109060_2109567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324322.1|2109671_2110850_+|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2111078_2112418_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002312527.1|2112487_2113513_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	3.6e-64
WP_002286683.1|2113509_2113734_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|2113730_2114024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298029.1|2114061_2114199_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002350774.1|2114198_2114606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|2114633_2115158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350775.1|2115157_2115607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|2115610_2116228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|2116227_2117136_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002347081.1|2117148_2119911_-	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002303299.1|2119907_2120648_-|tail	tail protein	tail	NA	NA	NA	NA
>prophage 11
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	2130826	2152211	2867770	terminase,tRNA	Enterococcus_phage(31.58%)	29	NA	NA
WP_002304486.1|2130826_2132245_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	51.5	2.5e-124
WP_002304484.1|2132222_2132651_-	hypothetical protein	NA	A0A1P8BMH5	Lactococcus_phage	63.1	2.6e-40
WP_002311618.1|2132668_2132893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304480.1|2133443_2133830_-	hypothetical protein	NA	O34053	Streptococcus_phage	55.2	1.9e-29
WP_002322045.1|2133842_2134256_-	autolysin	NA	C9E2P5	Enterococcus_phage	80.3	2.5e-56
WP_002286693.1|2134332_2134629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304475.1|2134625_2134829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304474.1|2134835_2135066_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_002304473.1|2135062_2135374_-	hypothetical protein	NA	A0A0D3MVS9	Staphylococcus_phage	58.0	5.3e-27
WP_002304472.1|2135512_2136328_-	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.4	1.8e-82
WP_002350868.1|2136324_2136651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292988.1|2136647_2136809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304469.1|2136823_2137183_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	47.5	6.8e-18
WP_002304468.1|2137179_2138031_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	3.0e-27
WP_002303278.1|2138045_2138846_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002303277.1|2138888_2139779_-	hypothetical protein	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303275.1|2139780_2140722_-	endonuclease	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303273.1|2140954_2141290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304466.1|2141541_2141781_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	1.8e-27
WP_002299038.1|2142089_2142245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304464.1|2142316_2142547_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002303266.1|2142714_2142981_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002303265.1|2143180_2143885_+	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303264.1|2143971_2145261_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303263.1|2145326_2146679_+	recombinase family protein	NA	D2IZV7	Enterococcus_phage	55.3	1.7e-133
WP_002304462.1|2146573_2147245_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002287951.1|2147299_2147953_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|2147942_2149256_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|2149565_2152211_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
>prophage 12
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	2327414	2351243	2867770	protease,transposase,bacteriocin	Bacillus_phage(37.5%)	22	NA	NA
WP_002288860.1|2327414_2328077_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002303458.1|2328152_2329445_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303461.1|2329614_2330244_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|2330346_2331156_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002305460.1|2331210_2332080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288852.1|2332080_2333397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294131.1|2333393_2335229_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	5.2e-37
WP_002288850.1|2335233_2335938_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002294132.1|2336127_2336988_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	4.6e-12
WP_002322652.1|2336974_2337544_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002294609.1|2338492_2338879_-	DUF4064 domain-containing protein	NA	NA	NA	NA	NA
WP_002294608.1|2338875_2339397_-	RDD family protein	NA	NA	NA	NA	NA
WP_002294607.1|2339398_2340433_-	signal peptide peptidase SppA	NA	A0A1C9LW82	Vibrio_phage	29.2	6.6e-13
WP_002348772.1|2340465_2341881_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_002303464.1|2341849_2344003_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	7.0e-41
WP_002303465.1|2344260_2344497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294603.1|2344515_2344731_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002348773.1|2345433_2346123_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002348774.1|2346246_2347566_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_002296840.1|2349139_2350327_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002294600.1|2350681_2350828_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_101701471.1|2350931_2351243_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 13
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	2486441	2610991	2867770	protease,holin,tRNA,transposase	Bacillus_phage(20.69%)	91	NA	NA
WP_002297218.1|2486441_2487737_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294493.1|2487891_2488575_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_002285996.1|2488576_2489413_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002302556.1|2489423_2491178_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.1e-39
WP_002285994.1|2491453_2491795_-	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	34.9	1.3e-10
WP_002294492.1|2491862_2494034_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002285989.1|2494244_2495102_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002285988.1|2495172_2496030_-	ROK family protein	NA	NA	NA	NA	NA
WP_002285985.1|2496014_2498717_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_002294491.1|2498729_2500019_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_002302559.1|2500168_2501215_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285980.1|2501216_2503370_+	alpha-1,2-mannosidase	NA	NA	NA	NA	NA
WP_002304851.1|2503842_2505294_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002285976.1|2505290_2507015_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010782528.1|2507007_2507622_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002285974.1|2507966_2509424_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002285972.1|2509464_2510385_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002285971.1|2510396_2511344_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002285969.1|2511822_2512542_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002304848.1|2512590_2514237_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002285964.1|2514415_2515006_+	transporter	NA	NA	NA	NA	NA
WP_002285962.1|2515097_2516603_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002285961.1|2516686_2518039_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002285960.1|2518038_2518557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285954.1|2518572_2518899_-	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002285949.1|2518911_2520891_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002285948.1|2520911_2521226_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002285944.1|2521393_2521687_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002321621.1|2521764_2522877_-	FUSC family protein	NA	NA	NA	NA	NA
WP_002297280.1|2523029_2523254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285932.1|2523263_2523443_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2523636_2523807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285926.1|2524230_2525259_-	collagen binding domain-containing protein	NA	NA	NA	NA	NA
WP_002285924.1|2525396_2528468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303189.1|2530374_2531136_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285920.1|2531235_2532957_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.7e-37
WP_002285918.1|2532971_2534756_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.7e-46
WP_002285917.1|2535136_2536690_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2537037_2539452_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2539878_2541897_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2542266_2542923_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2542922_2543879_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2543878_2544445_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_000997695.1|2545063_2546242_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_076005178.1|2546265_2546457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|2546649_2547837_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_025479400.1|2547933_2548236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303477.1|2549010_2550030_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002301818.1|2550040_2550247_-|holin	holin	holin	NA	NA	NA	NA
WP_002301399.1|2550379_2551339_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002304713.1|2551541_2552474_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
WP_002341521.1|2552545_2552902_+	hypothetical protein	NA	U4KJ82	Streptococcus_phage	42.2	9.2e-15
WP_000997695.1|2552999_2554178_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2555048_2556388_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002301355.1|2556513_2558286_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.2e-54
WP_002285883.1|2558288_2560001_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002285876.1|2560115_2560784_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295567.1|2560850_2561639_-	esterase family protein	NA	NA	NA	NA	NA
WP_002295566.1|2561721_2563194_-	MFS transporter	NA	NA	NA	NA	NA
WP_002289731.1|2563323_2564517_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002297218.1|2564871_2566167_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296055.1|2574348_2575845_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	8.7e-91
WP_002290055.1|2575955_2576960_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002296053.1|2576960_2577848_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002287418.1|2578064_2580176_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002287415.1|2580265_2580811_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287414.1|2580810_2582256_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287412.1|2582375_2582846_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287409.1|2582891_2583317_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287407.1|2583383_2583653_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_101701472.1|2583663_2585259_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287403.1|2585273_2588795_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002287401.1|2588811_2589372_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002287399.1|2589724_2590699_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002287397.1|2590868_2592269_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_002287391.1|2592346_2593069_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287389.1|2593147_2593654_-	membrane protein	NA	NA	NA	NA	NA
WP_002322796.1|2593776_2595576_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_002297218.1|2595737_2597033_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002322795.1|2597165_2598704_-	hypothetical protein	NA	B5LJD6	Mycobacterium_phage	50.5	2.3e-17
WP_000122610.1|2599083_2600376_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002297218.1|2600520_2601816_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287385.1|2601987_2602497_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002296044.1|2602500_2603355_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002287382.1|2603509_2604148_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_002287380.1|2604148_2604799_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002287379.1|2604811_2605711_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_002287377.1|2605875_2607945_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	30.3	3.5e-21
WP_002287376.1|2607941_2608682_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_002287374.1|2608694_2610053_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002287372.1|2610052_2610991_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.7	5.2e-09
>prophage 14
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	2693521	2706639	2867770		Streptococcus_phage(83.33%)	16	NA	NA
WP_002297366.1|2693521_2693836_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2693848_2694223_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|2694223_2694568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343904.1|2694650_2695796_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	62.8	6.0e-132
WP_002297361.1|2696510_2698370_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_002297360.1|2698463_2698703_+	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	80.3	2.1e-23
WP_002297358.1|2698780_2699455_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|2699687_2700122_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2700122_2700830_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2700819_2701110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2701368_2702553_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2702549_2702687_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_101701473.1|2703432_2705346_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	1.3e-35
WP_033658092.1|2705449_2705674_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2705686_2706190_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2706249_2706639_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
>prophage 15
NZ_CP023789	Enterococcus faecium strain Efaecium_ER04462.3A chromosome, complete genome	2867770	2733817	2758858	2867770	transposase,integrase	Bacillus_phage(50.0%)	26	2752220:2752235	2762465:2762480
WP_002297332.1|2733817_2734012_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077828743.1|2734203_2734359_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002297326.1|2736215_2737832_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_002317220.1|2737949_2738168_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2738362_2738824_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002304820.1|2739016_2739256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297324.1|2739279_2740803_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002322279.1|2740820_2740943_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002304819.1|2740972_2741956_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|2741979_2742129_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|2742149_2742527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|2742558_2742738_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|2742752_2743022_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002297310.1|2743544_2745287_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-30
WP_002297309.1|2745270_2747025_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002297308.1|2747134_2747704_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002296840.1|2748538_2749726_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002297304.1|2750621_2751290_-	cobalt transporter	NA	NA	NA	NA	NA
WP_071858995.1|2751420_2752005_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2752220:2752235	attL	ACCTTTTCTAAAATAA	NA	NA	NA	NA
WP_002297302.1|2752335_2752569_-	iron-dependent repressor	NA	NA	NA	NA	NA
WP_002297295.1|2752583_2753534_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297294.1|2753530_2754373_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002297293.1|2754694_2755882_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002297292.1|2755973_2756714_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002320809.1|2757401_2757560_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297291.1|2757631_2758858_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2762465:2762480	attR	TTATTTTAGAAAAGGT	NA	NA	NA	NA
>prophage 1
NZ_CP023790	Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence	199068	12910	20581	199068	transposase	Temperate_phage(16.67%)	12	NA	NA
WP_002321302.1|12910_13384_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	62.0	5.6e-44
WP_002321303.1|13749_14010_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
WP_002296239.1|14454_14661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305766.1|14660_14912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305764.1|14927_15344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348912.1|15325_15598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305759.1|15764_16166_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	43.1	1.4e-24
WP_002305757.1|16177_17323_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D9J0Y9	Brochothrix_phage	74.6	7.7e-164
WP_002287514.1|17560_17824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321032.1|17817_18168_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002318230.1|18191_18806_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.9	2.6e-17
WP_002348911.1|19255_20581_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.6	1.2e-99
>prophage 2
NZ_CP023790	Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence	199068	36063	145161	199068	holin,integrase,protease,transposase,bacteriocin	Streptococcus_phage(21.88%)	96	82730:82755	129511:129536
WP_002300034.1|36063_38121_-|protease	serine protease	protease	NA	NA	NA	NA
WP_002300033.1|38265_38457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300032.1|38644_39100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305782.1|39096_39339_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002302862.1|39356_39659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302860.1|39727_41782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302859.1|41781_44394_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_002302858.1|44390_46769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302857.1|46829_47372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302856.1|47449_47782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302855.1|47782_48376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302854.1|48397_50422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302853.1|50421_51621_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	38.1	2.5e-32
WP_002302852.1|51636_52281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302851.1|52291_53098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582323.1|53508_54444_+	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_002305788.1|54487_54757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302849.1|55032_55308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302844.1|55349_55772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582318.1|55791_57384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302842.1|57404_57740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302840.1|57885_58080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|58215_59466_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305801.1|59875_62248_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002353594.1|62308_63778_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|63788_65798_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002303484.1|66143_66740_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002303483.1|66752_67652_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|67654_67786_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|67807_68140_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002303482.1|68184_68418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|68576_68699_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|68888_69113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|69555_69762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|69761_70013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|70193_70466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|70910_71090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|71148_71505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|72473_73427_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|73547_73811_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000997695.1|74182_75361_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002332708.1|75892_76801_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002300835.1|78745_79201_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|79214_80543_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|80576_80861_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|80862_81378_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|81393_82056_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|82062_82635_+	SIS domain-containing protein	NA	NA	NA	NA	NA
82730:82755	attL	CGTAAGCGCCCCATAGAACAGTACCT	NA	NA	NA	NA
WP_002303202.1|82806_84354_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	2.8e-44
WP_002287659.1|84455_84809_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|84798_84993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300843.1|85174_86695_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|86937_87123_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|87106_87289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|88242_88842_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|88905_89505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305879.1|90520_91393_-	ROK family protein	NA	NA	NA	NA	NA
WP_002303302.1|91656_93603_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|93787_95227_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|95228_96191_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|96360_97787_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|98029_98485_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|99070_99301_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|99530_100349_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|100509_101199_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|101212_102715_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|102727_103204_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|103701_104864_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|105981_106500_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|108575_109661_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|109768_110722_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002348774.1|111803_113123_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_002324322.1|114385_115564_+|transposase	IS256-like element ISEfm2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	24.9	2.6e-29
WP_002301128.1|116143_117139_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|117154_118324_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|118339_119074_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087043335.1|119844_121007_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_002301811.1|121575_122868_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|123141_123402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|123652_124831_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_073120200.1|125182_125479_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	6.7e-19
WP_002287876.1|126427_126823_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287875.1|126832_127681_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287874.1|127695_128523_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002285758.1|129593_129788_+	hypothetical protein	NA	NA	NA	NA	NA
129511:129536	attR	CGTAAGCGCCCCATAGAACAGTACCT	NA	NA	NA	NA
WP_002287659.1|129777_130131_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|130232_131780_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002300493.1|131985_133155_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_099745857.1|133494_134181_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
WP_000195429.1|134804_135977_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002348774.1|136227_137547_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_000997695.1|138638_139817_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_158294579.1|140837_142385_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	1.1e-06
WP_002304894.1|142442_142709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303113.1|143384_143936_-	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_002319817.1|144480_145161_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
>prophage 1
NZ_CP023791	Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.2, complete sequence	40911	1656	9025	40911	transposase	Streptococcus_phage(100.0%)	9	NA	NA
WP_011117477.1|1656_2343_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	6.5e-126
WP_001814874.1|2482_2566_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038792.1|2690_3428_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	7.0e-134
WP_000085862.1|3432_3564_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	100.0	7.9e-17
WP_000567888.1|4721_4967_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228166.1|5069_5939_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000662263.1|5919_6654_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_000627290.1|7595_8138_+	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001096887.1|8230_9025_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
>prophage 2
NZ_CP023791	Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.2, complete sequence	40911	27783	40250	40911	transposase	Streptococcus_phage(37.5%)	13	NA	NA
WP_000195429.1|27783_28956_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002354485.1|30821_31508_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_016171138.1|31555_32815_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.2	1.1e-54
WP_010782630.1|32964_33579_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	4.9e-16
WP_002288787.1|33892_34315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|34324_34528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|34738_35323_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_016171137.1|35491_36817_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.8	4.1e-100
WP_000568378.1|36809_37160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001021554.1|37156_37336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000026576.1|37471_37762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|38059_39232_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000101106.1|39461_40250_+	ParA family protein	NA	H7BUL8	unidentified_phage	35.7	4.7e-27
