The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	83593	230707	2869275	tRNA,holin,transposase	Streptococcus_phage(13.51%)	124	NA	NA
WP_002298563.1|83593_84340_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002301399.1|85012_85972_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002326711.1|86346_87525_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002317041.1|87869_88208_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_002348801.1|88342_88744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317547.1|88855_89476_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002294300.1|89566_92236_-	YfhO family protein	NA	NA	NA	NA	NA
WP_002290463.1|92473_92662_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002294298.1|92931_93294_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002301169.1|93345_95028_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002301167.1|95144_97181_+	ATP-dependent DNA helicase RecG	NA	A0A2H4JBQ0	uncultured_Caudovirales_phage	22.9	5.3e-06
WP_002289721.1|97229_98231_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002294295.1|98352_98595_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002287889.1|98862_99867_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	5.1e-18
WP_002287891.1|99867_100812_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	3.9e-20
WP_002287892.1|100811_101774_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287893.1|101800_102715_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287894.1|102740_104522_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287896.1|104869_105556_+	ribonuclease III	NA	K7YH73	Megavirus	32.3	9.1e-27
WP_002301166.1|105575_109157_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_002348798.1|109165_109975_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002301165.1|109986_110985_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_101701466.1|111171_113439_+	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_002326066.1|113622_114576_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294287.1|114593_115046_-	YueI family protein	NA	NA	NA	NA	NA
WP_002294286.1|115195_116146_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.5	1.6e-66
WP_002301163.1|116138_117098_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002301162.1|117094_117850_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	2.2e-13
WP_002301160.1|117872_118826_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287909.1|119469_119766_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
WP_002287910.1|120121_120478_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002348747.1|120487_121387_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010782507.1|121619_122579_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_010782508.1|122836_124282_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	2.2e-123
WP_002348590.1|124327_125062_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_002301190.1|125387_125798_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002294273.1|125790_126492_+	LrgB family protein	NA	NA	NA	NA	NA
WP_002348592.1|126491_128105_+	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
WP_002290506.1|128094_128316_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	33.3	1.1e-05
WP_002297929.1|128312_129074_+	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.7	1.2e-16
WP_002294268.1|129454_129964_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	31.8	7.5e-10
WP_002294267.1|130033_130573_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002294265.1|130712_131324_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002324284.1|131639_132437_+	formate/nitrite transporter	NA	NA	NA	NA	NA
WP_002294262.1|132464_133100_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002294261.1|133119_133893_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002348595.1|134300_135098_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297923.1|135075_135489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294258.1|135472_138118_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.6e-39
WP_002301736.1|138135_140244_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.8e-57
WP_002348596.1|140265_140826_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002297218.1|140964_142260_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002285758.1|142519_142714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|142703_143057_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|143158_144706_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002348864.1|144785_146774_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002294254.1|146996_147710_+	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002294252.1|147786_148233_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002290528.1|148402_149005_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002289812.1|149017_150019_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_002341570.1|150047_150626_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294249.1|150677_151160_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002289815.1|151276_151651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294246.1|152450_153803_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002297079.1|153949_154540_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_002294242.1|154667_156017_-	amino acid permease	NA	NA	NA	NA	NA
WP_002294240.1|156184_156925_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	5.5e-30
WP_002297081.1|156937_158530_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002293448.1|159097_159394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294236.1|159569_160295_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_002301156.1|160287_161130_+	chorismate mutase	NA	NA	NA	NA	NA
WP_002294232.1|161132_161654_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002289284.1|161906_162470_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	2.3e-12
WP_002289282.1|162720_162990_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002297086.1|163177_165304_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002289280.1|165813_166080_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002289279.1|166223_168215_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.9	8.4e-65
WP_002294228.1|168568_169870_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002326809.1|170245_171541_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_010782510.1|171608_172787_-|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	39.9	3.8e-65
WP_002289277.1|173133_174504_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002289744.1|174685_175009_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002299254.1|175333_175942_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_002348768.1|176271_176988_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_002289749.1|177000_177696_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_002289751.1|177779_178409_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.2	3.1e-34
WP_086953915.1|178923_180262_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002294220.1|180331_180934_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	30.6	3.6e-19
WP_002296548.1|180955_181444_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002294217.1|181764_183138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294214.1|183121_183589_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_002329999.1|183837_185583_-	AarF/ABC1/UbiB kinase family protein	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.1	1.3e-40
WP_002293424.1|185778_186855_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002317074.1|187007_188360_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_086272912.1|188675_190193_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.2	1.3e-62
WP_002294209.1|190322_190673_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002294207.1|190688_191810_+	alanine racemase	NA	NA	NA	NA	NA
WP_002289874.1|191820_192183_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	37.8	7.6e-09
WP_002293413.1|192358_192628_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002294206.1|192817_193765_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016171130.1|193910_195206_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.2	1.1e-09
WP_002301399.1|195472_196432_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002294203.1|196657_199363_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_002294202.1|199959_201783_+	APC family permease	NA	NA	NA	NA	NA
WP_002348885.1|201924_202110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294199.1|202584_202848_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002301121.1|202847_203114_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002301116.1|204344_205016_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002301114.1|205012_205930_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293405.1|205926_206568_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002348889.1|206571_207747_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.0e-17
WP_002350806.1|207939_208971_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002341590.1|210647_211601_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002319878.1|211691_212987_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_002326809.1|213148_214444_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289743.1|215153_217793_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.2	1.6e-84
WP_002294185.1|217960_218659_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002341590.1|218761_219715_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294183.1|219943_221089_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002300794.1|221185_221566_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_010782512.1|221870_224468_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010782513.1|224375_225986_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	8.4e-124
WP_002300788.1|228263_228743_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_086953915.1|229368_230707_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 2
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	262053	269790	2869275		Streptococcus_phage(66.67%)	6	NA	NA
WP_002297361.1|262053_263913_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_000398284.1|264469_265675_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_002286940.1|266458_268369_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_032509114.1|268472_268697_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	97.1	8.5e-27
WP_002345010.1|268813_269311_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	97.6	1.3e-88
WP_002345009.1|269397_269790_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	4.6e-68
>prophage 3
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	285367	333531	2869275	tRNA,transposase	Streptococcus_phage(33.33%)	44	NA	NA
WP_002354485.1|285367_286054_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002348732.1|286205_289247_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.2	4.0e-18
WP_101732398.1|289436_290021_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_010782519.1|290017_291157_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002336644.1|291534_293577_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002336645.1|293587_294208_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002336646.1|294219_294678_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002331203.1|294696_294975_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002336647.1|294999_296367_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002331205.1|296381_297527_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	1.2e-52
WP_002331206.1|297553_298045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002345001.1|298487_299687_+	MFS transporter	NA	NA	NA	NA	NA
WP_002331208.1|300181_300940_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002331209.1|301107_302043_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002336649.1|302039_303485_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002336650.1|303512_303968_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002336651.1|303986_304961_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002336652.1|305776_306391_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002331215.1|306631_307015_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002301781.1|307377_307887_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002296570.1|307986_308637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291914.1|309087_310026_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002291912.1|310038_311091_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296392.1|311356_311992_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002296391.1|312182_312974_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002326839.1|313453_314362_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002295755.1|314417_314915_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002340421.1|314951_315635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296262.1|315981_316248_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002296261.1|316274_316574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296259.1|316747_317299_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002296258.1|317444_317738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304106.1|317730_318027_+	peptidase	NA	NA	NA	NA	NA
WP_002296256.1|318101_319100_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|319191_320145_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294735.1|320243_320960_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002296623.1|321158_322454_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_025478783.1|322500_324549_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_002294732.1|325758_327000_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002294730.1|327146_327782_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294728.1|327972_328713_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002296909.1|328857_330495_-	membrane protein	NA	NA	NA	NA	NA
WP_000195429.1|330706_331879_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000997695.1|332352_333531_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	768012	776484	2869275		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|768012_768657_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|768671_769001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|769014_769953_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|769988_770813_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|770805_771153_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|771221_772094_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|772202_773324_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|773377_773980_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|774294_776484_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 5
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	832523	911634	2869275	tRNA,protease,capsid,holin,head,terminase,portal,integrase,transposase,tail	Enterococcus_phage(25.64%)	95	889418:889433	892771:892786
WP_002286621.1|832523_835322_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|835370_836897_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|836911_837559_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|837742_838072_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|838248_838977_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|838992_840006_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|840005_841283_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|841345_844048_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|844199_844517_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|844546_844867_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|844952_846413_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|846480_846702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|846732_846915_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|846914_847328_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|847450_848632_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|849162_850302_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|850600_851236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|851348_851984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|852017_852479_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002348715.1|852608_853040_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|853057_853378_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|853676_854453_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|854467_854671_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|854686_855025_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|855011_855191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|855233_855704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|855790_856489_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|856666_857008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|857000_857672_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|857677_858364_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|858366_859116_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|859127_859397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|859558_859861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|859857_860019_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|860015_860321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|860320_860677_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|860636_860882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|860878_861298_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|861294_861852_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|861848_862145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|862221_862635_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002300143.1|863092_863368_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|863821_864028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|864223_864391_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|864416_864761_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|864765_865047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|865149_865464_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|865441_867136_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|867155_868334_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|868296_868983_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|868982_870143_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|870152_871028_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|871024_871336_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|871325_871679_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|871668_872070_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|872062_872467_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|872478_873087_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|873106_873469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|873471_873654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348716.1|873670_877102_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|877152_877890_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002286497.1|877899_880191_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.0	9.6e-89
WP_002286495.1|880214_882341_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286491.1|882503_882950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|882951_883089_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|883126_883420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|883416_883641_+|holin	holin	holin	NA	NA	NA	NA
WP_002349643.1|883637_884663_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_087046766.1|885602_886764_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002324322.1|887651_888830_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002286474.1|889020_889428_+	hypothetical protein	NA	NA	NA	NA	NA
889418:889433	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|889441_889843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|889844_890216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|890251_890554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076005172.1|890802_891003_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_070571278.1|891307_892540_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|892796_893366_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
892771:892786	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002297963.1|893543_893984_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|894141_894906_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|894937_895861_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|895936_897076_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|897068_897869_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|897868_898696_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|898673_899408_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|899507_900374_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|900387_900960_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|900981_902010_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|902107_902959_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002348826.1|902992_905026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348825.1|905069_906350_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002285758.1|906586_906781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|906770_907124_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|907225_908773_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_101701468.1|908811_910095_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	1.2e-08
WP_010782578.1|910359_911634_-|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	8.6e-55
>prophage 6
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	1083462	1139584	2869275	protease,tRNA,transposase	Lysinibacillus_phage(25.0%)	54	NA	NA
WP_002297218.1|1083462_1084758_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002321398.1|1084993_1087093_+	TFIIB-type zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002290060.1|1087288_1088152_+	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_002322512.1|1088256_1088730_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002297218.1|1088796_1090092_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294386.1|1090347_1091235_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	1.2e-31
WP_002294387.1|1091253_1091625_+	protein RibT	NA	NA	NA	NA	NA
WP_002305297.1|1091594_1092392_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.0	6.4e-08
WP_002296975.1|1092375_1092945_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	1.5e-14
WP_002294391.1|1092950_1093667_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002296977.1|1093996_1094608_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_002290168.1|1094985_1096509_+	YfcC family protein	NA	NA	NA	NA	NA
WP_002294399.1|1096745_1098086_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_002294400.1|1098238_1098976_+	thioesterase	NA	NA	NA	NA	NA
WP_002294401.1|1099140_1099362_-	ferredoxin	NA	NA	NA	NA	NA
WP_002305295.1|1099392_1100424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303122.1|1100410_1101814_+	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	6.5e-64
WP_002294404.1|1101879_1102515_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002303123.1|1102563_1103244_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002294406.1|1103378_1104608_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002296982.1|1104789_1106100_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002290178.1|1106342_1106618_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	69.7	1.8e-26
WP_101701469.1|1106753_1108049_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002297185.1|1108365_1109661_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002294410.1|1109896_1110943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289879.1|1110944_1112204_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002289878.1|1112209_1112791_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_002294412.1|1112872_1113748_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.3	5.9e-63
WP_002290045.1|1113895_1114228_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002294414.1|1114339_1115548_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.7	1.5e-45
WP_002290187.1|1115701_1116157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1116350_1117646_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290188.1|1118040_1118316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288388.1|1118328_1120407_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002288390.1|1120566_1122453_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.6e-52
WP_002294416.1|1122464_1123412_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	7.1e-123
WP_002288392.1|1123431_1123959_+	dihydrofolate reductase	NA	A0A1D6X864	Bacillus_phage	37.1	6.7e-22
WP_002288393.1|1124021_1124675_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002288394.1|1124806_1125649_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.2	6.5e-19
WP_002288395.1|1125806_1126703_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288396.1|1126705_1127419_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002288397.1|1127438_1127957_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288398.1|1127953_1128181_+	YozE family protein	NA	NA	NA	NA	NA
WP_002294418.1|1128332_1128884_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002288403.1|1128966_1129509_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002288405.1|1129745_1130144_-	glyoxalase	NA	NA	NA	NA	NA
WP_002296988.1|1130403_1131264_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002296990.1|1131256_1132024_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.5	2.7e-27
WP_002303743.1|1132079_1132937_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002288411.1|1133058_1135137_+	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	38.5	1.2e-101
WP_002320953.1|1135105_1136482_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002288415.1|1136679_1137585_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	9.4e-32
WP_002288419.1|1137621_1138170_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_002288421.1|1138183_1139584_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.8	1.7e-43
>prophage 7
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	1204395	1213456	2869275		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1204395_1205691_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1205870_1206248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1206503_1207232_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1207231_1207486_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1207487_1208159_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1208159_1210382_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1210366_1211806_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|1211837_1212881_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1212877_1213456_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 8
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	1496857	1545875	2869275	protease,transposase	Streptococcus_phage(23.08%)	58	NA	NA
WP_010729485.1|1496857_1498393_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	1.4e-123
WP_002295142.1|1498616_1498988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1499243_1499486_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1499517_1500420_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1500432_1500621_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1500634_1501198_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1501235_1502129_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002296674.1|1502206_1503145_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1503178_1503529_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1503561_1504464_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1504456_1505314_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002348903.1|1505647_1506457_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1506496_1506994_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1507638_1507962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1508125_1508380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1508449_1508695_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002348902.1|1508791_1509136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1509196_1509760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293303.1|1510327_1510528_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002302440.1|1511150_1512452_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296656.1|1512780_1513494_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1513486_1514572_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1514588_1515032_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1515065_1515419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1515530_1515932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1515968_1516478_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1516499_1517357_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1517374_1518208_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1518221_1519019_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1519051_1519336_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1519332_1520334_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002296640.1|1520335_1521238_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.3e-53
WP_002296639.1|1521401_1522250_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1522895_1523102_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1523303_1524305_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1524309_1526223_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1526390_1526897_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1527056_1527497_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1527522_1528680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1528682_1529039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1529336_1530311_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1530506_1531346_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1531530_1532418_+	rotamase	NA	NA	NA	NA	NA
WP_002311093.1|1533001_1533697_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1533680_1534079_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|1534487_1535738_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002289425.1|1535879_1536875_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1536892_1537447_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|1537434_1537926_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348791.1|1537918_1539787_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1539805_1540606_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002305631.1|1540798_1541044_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1541182_1541668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1542123_1542537_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002322258.1|1542673_1542934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321532.1|1543051_1543342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1543587_1544766_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1544921_1545875_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	1681568	1779469	2869275	plate,tRNA,protease,terminase,capsid,portal,head,tail,holin,integrase,transposase	Enterococcus_phage(17.39%)	113	1758601:1758619	1775712:1775730
WP_002288520.1|1681568_1682492_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002294143.1|1685669_1685891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294142.1|1685998_1686346_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002294141.1|1686372_1688679_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288509.1|1688691_1689003_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288501.1|1688999_1689293_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002301262.1|1689314_1690490_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288499.1|1690513_1690987_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002294138.1|1691130_1695483_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	41.4	3.9e-22
WP_002294137.1|1695694_1697404_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1697471_1698740_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1698900_1699701_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1699697_1700510_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002287107.1|1700918_1702169_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002293875.1|1702487_1703045_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1703047_1703770_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1703905_1704787_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1704885_1705668_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1706026_1706506_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1706722_1707814_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002326699.1|1707806_1707935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|1707938_1708484_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002288432.1|1708936_1710628_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1711046_1711994_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1712108_1713128_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1713218_1714448_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1714908_1715610_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326809.1|1715781_1717077_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002301319.1|1717740_1718757_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1718753_1719218_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002348676.1|1719224_1719767_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1719750_1720575_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1720663_1721644_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1721667_1723152_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1723163_1724153_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1724400_1724568_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1724629_1726441_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1726437_1726803_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1726965_1727361_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1727378_1728341_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1728340_1728553_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1728573_1729272_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1729291_1729834_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1729965_1730970_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1730966_1731956_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1731952_1732759_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_010782564.1|1732924_1733881_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1733957_1734476_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1734563_1734713_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1734940_1735387_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|1735581_1737477_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1737801_1738776_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_086953915.1|1739581_1740921_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_084201531.1|1740991_1742017_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_002286683.1|1742013_1742238_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|1742234_1742528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298029.1|1742565_1742703_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002350774.1|1742702_1743110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|1743137_1743662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350775.1|1743661_1744111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|1744114_1744732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|1744731_1745640_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_069314735.1|1745652_1748412_-	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.6	6.8e-49
WP_069314753.1|1748408_1749113_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069314734.1|1749124_1751428_-|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	48.3	2.1e-83
WP_069314733.1|1751622_1752087_-	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	40.3	1.7e-16
WP_069314732.1|1752086_1752713_-|tail	phage tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	4.4e-28
WP_069314731.1|1752719_1753085_-	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	41.1	7.7e-17
WP_010725764.1|1753074_1753413_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	47.7	6.6e-23
WP_069314730.1|1753402_1753729_-|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	1.7e-23
WP_002301326.1|1753709_1753988_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	3.5e-22
WP_084201525.1|1753989_1755354_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.4	2.9e-125
WP_084201523.1|1755366_1755942_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	68.4	1.1e-65
WP_099745849.1|1755907_1757137_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	65.5	2.7e-146
WP_069314727.1|1757158_1758886_-|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	7.6e-264
1758601:1758619	attL	CTTTTTCATTTTCTTTAAC	NA	NA	NA	NA
WP_002301332.1|1758882_1759335_-	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	68.5	8.0e-48
WP_002317992.1|1759446_1759827_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	67.2	9.1e-45
WP_069314726.1|1759823_1760210_-	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	37.3	8.7e-11
WP_069314725.1|1760190_1760577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154212406.1|1760881_1761025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010725701.1|1761349_1761817_-	ArpU family phage transcriptional regulator	NA	D7RWH7	Brochothrix_phage	29.1	2.4e-07
WP_050397116.1|1761891_1762332_-	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	37.7	9.0e-20
WP_069314724.1|1762361_1762655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002309099.1|1762651_1762855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314723.1|1762861_1763092_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_069314722.1|1763258_1763549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314721.1|1763559_1764135_-	DUF1642 domain-containing protein	NA	A0A0E3T929	Enterococcus_phage	32.1	2.1e-16
WP_048946628.1|1764445_1764664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314720.1|1764660_1765185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314719.1|1765184_1765475_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	42.4	2.4e-13
WP_084205653.1|1765474_1765780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314717.1|1765776_1765938_-	antitoxin	NA	NA	NA	NA	NA
WP_010721325.1|1765934_1766237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314716.1|1766398_1766668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314715.1|1766679_1767531_-	replication protein	NA	A0A1S5SFJ6	Streptococcus_phage	67.1	2.1e-49
WP_069314714.1|1767537_1768224_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	70.0	2.2e-89
WP_002286557.1|1768229_1768901_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|1768893_1769235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|1769412_1770111_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|1770197_1770668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314713.1|1770710_1770890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342110.1|1770902_1771169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002353431.1|1771179_1771374_-	hypothetical protein	NA	M1IFE9	Streptococcus_phage	53.1	1.1e-11
WP_033655448.1|1771678_1772098_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	62.3	3.0e-41
WP_069314712.1|1772114_1772537_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	50.7	3.6e-34
WP_002317583.1|1772565_1772766_+	hypothetical protein	NA	A0A097BY73	Enterococcus_phage	87.9	2.5e-25
WP_069314711.1|1772851_1773292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314710.1|1773429_1774635_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	37.4	7.3e-64
WP_002296332.1|1774918_1775485_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348678.1|1775740_1777072_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
1775712:1775730	attR	GTTAAAGAAAATGAAAAAG	NA	NA	NA	NA
WP_002296335.1|1777037_1777388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296337.1|1777899_1778244_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1778509_1779469_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
>prophage 10
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	1783531	1907740	2869275	tRNA,transposase	Streptococcus_phage(28.12%)	107	NA	NA
WP_002311774.1|1783531_1784491_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|1784703_1785612_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|1785660_1786047_+	YxeA family protein	NA	NA	NA	NA	NA
WP_000122610.1|1786350_1787643_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002288574.1|1787861_1789208_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1789319_1790669_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|1790785_1792039_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|1792109_1792595_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288579.1|1792617_1793376_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1793391_1794570_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1794799_1796920_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002296838.1|1797142_1797868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1797857_1798367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1798436_1799885_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1799884_1800601_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1800581_1800932_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1801075_1801849_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1802605_1802908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1803346_1804525_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1804861_1805101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1805462_1805723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1805907_1806405_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1806534_1807245_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1807257_1808922_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1809126_1809789_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1809798_1810614_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1810875_1811319_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1811452_1811791_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302962.1|1811778_1812156_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322902.1|1812379_1813573_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1813738_1814161_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002296840.1|1814649_1815837_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002303955.1|1816223_1816679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1816840_1818013_-	class C sortase	NA	NA	NA	NA	NA
WP_002303963.1|1821143_1823471_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002296840.1|1823745_1824933_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288970.1|1825790_1826084_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002286913.1|1826341_1826689_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1826824_1827586_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1827575_1828097_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1828266_1829058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1829182_1829434_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1829445_1829721_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1829973_1830528_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1830606_1831128_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1831131_1831710_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1831821_1833240_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1833260_1833599_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1833558_1834062_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1834192_1834897_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002303966.1|1834893_1836630_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|1836732_1839204_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002326707.1|1839476_1840751_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002289807.1|1841037_1841928_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002300070.1|1842124_1842607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1842814_1843180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326708.1|1843270_1843588_-	SdpI family protein	NA	NA	NA	NA	NA
WP_010782561.1|1844329_1845289_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002301623.1|1845411_1846386_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002297404.1|1846795_1848046_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1848331_1848589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1848820_1849234_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002324322.1|1849372_1850551_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002326711.1|1850823_1852002_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002295743.1|1852162_1853072_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_099098442.1|1853373_1854536_-|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_099745852.1|1854640_1855979_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	3.4e-78
WP_002301695.1|1856019_1856712_-	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	43.4	4.0e-30
WP_002294835.1|1857148_1857718_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002304701.1|1857791_1858115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294839.1|1858268_1859081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|1859434_1860283_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002304699.1|1860427_1861369_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002299539.1|1865163_1867335_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002312937.1|1867354_1869541_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	5.3e-121
WP_002289040.1|1869540_1869750_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002294855.1|1869762_1870203_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002304690.1|1870276_1870816_-	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002288779.1|1871430_1872897_-	amino acid permease	NA	NA	NA	NA	NA
WP_002304688.1|1873207_1875289_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.6	2.4e-115
WP_002288776.1|1875812_1876172_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002326717.1|1876201_1876543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304684.1|1876539_1877214_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288767.1|1878266_1879565_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002304682.1|1879604_1880795_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002348809.1|1880815_1881343_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002304681.1|1881389_1884179_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002288762.1|1884325_1884526_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002323868.1|1884977_1885298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1885575_1886871_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288760.1|1887322_1888441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304680.1|1888911_1890219_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002340453.1|1890337_1891537_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002289547.1|1891563_1892832_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.2e-42
WP_002348853.1|1894048_1894552_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002294889.1|1894674_1895439_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289551.1|1895546_1895822_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002312285.1|1896259_1897210_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002312284.1|1897388_1897589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782560.1|1898393_1899353_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002312282.1|1900218_1900749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312281.1|1900745_1901363_-	VanZ family protein	NA	NA	NA	NA	NA
WP_002312280.1|1901944_1902166_-	transferase	NA	NA	NA	NA	NA
WP_002348669.1|1902343_1903876_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002312276.1|1904011_1905097_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002312275.1|1905111_1905831_-	glycosyl transferase	NA	A0A2K9L639	Tupanvirus	25.0	2.6e-08
WP_000997695.1|1906561_1907740_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	2098937	2124959	2869275	plate,tRNA,tail,holin,transposase	Bacillus_phage(33.33%)	29	NA	NA
WP_000222572.1|2098937_2099891_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289406.1|2099924_2101154_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|2101155_2102073_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|2102076_2102814_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|2102904_2103432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|2103611_2104205_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|2104308_2104794_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|2104946_2105144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|2105238_2106999_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|2106995_2108726_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|2109118_2109331_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|2109332_2111012_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|2111265_2111466_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002347086.1|2112541_2112940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305550.1|2112932_2113385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002318238.1|2113371_2113878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324322.1|2113982_2115161_+|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2115389_2116729_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002312527.1|2116798_2117824_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	3.6e-64
WP_002286683.1|2117820_2118045_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|2118041_2118335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298029.1|2118372_2118510_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002350774.1|2118509_2118917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|2118944_2119469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350775.1|2119468_2119918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|2119921_2120539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|2120538_2121447_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002347081.1|2121459_2124222_-	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002303299.1|2124218_2124959_-|tail	tail protein	tail	NA	NA	NA	NA
>prophage 12
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	2135137	2156522	2869275	tRNA,terminase	Enterococcus_phage(31.58%)	29	NA	NA
WP_002304486.1|2135137_2136556_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	51.5	2.5e-124
WP_002304484.1|2136533_2136962_-	hypothetical protein	NA	A0A1P8BMH5	Lactococcus_phage	63.1	2.6e-40
WP_002311618.1|2136979_2137204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304480.1|2137754_2138141_-	hypothetical protein	NA	O34053	Streptococcus_phage	55.2	1.9e-29
WP_002322045.1|2138153_2138567_-	autolysin	NA	C9E2P5	Enterococcus_phage	80.3	2.5e-56
WP_002286693.1|2138643_2138940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304475.1|2138936_2139140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304474.1|2139146_2139377_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_002304473.1|2139373_2139685_-	hypothetical protein	NA	A0A0D3MVS9	Staphylococcus_phage	58.0	5.3e-27
WP_002304472.1|2139823_2140639_-	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.4	1.8e-82
WP_002350868.1|2140635_2140962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292988.1|2140958_2141120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304469.1|2141134_2141494_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	47.5	6.8e-18
WP_002304468.1|2141490_2142342_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	3.0e-27
WP_002303278.1|2142356_2143157_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002303277.1|2143199_2144090_-	hypothetical protein	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303275.1|2144091_2145033_-	endonuclease	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303273.1|2145265_2145601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304466.1|2145852_2146092_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	1.8e-27
WP_002299038.1|2146400_2146556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304464.1|2146627_2146858_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002303266.1|2147025_2147292_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002303265.1|2147491_2148196_+	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303264.1|2148282_2149572_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303263.1|2149637_2150990_+	recombinase family protein	NA	D2IZV7	Enterococcus_phage	55.3	1.7e-133
WP_002304462.1|2150884_2151556_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002287951.1|2151610_2152264_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|2152253_2153567_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|2153876_2156522_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
>prophage 13
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	2330393	2354222	2869275	protease,bacteriocin,transposase	Bacillus_phage(37.5%)	22	NA	NA
WP_002288860.1|2330393_2331056_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002303458.1|2331131_2332424_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303461.1|2332593_2333223_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|2333325_2334135_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002305460.1|2334189_2335059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288852.1|2335059_2336376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294131.1|2336372_2338208_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	5.2e-37
WP_002288850.1|2338212_2338917_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002294132.1|2339106_2339967_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	4.6e-12
WP_002322652.1|2339953_2340523_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002294609.1|2341471_2341858_-	DUF4064 domain-containing protein	NA	NA	NA	NA	NA
WP_002294608.1|2341854_2342376_-	RDD family protein	NA	NA	NA	NA	NA
WP_002294607.1|2342377_2343412_-	signal peptide peptidase SppA	NA	A0A1C9LW82	Vibrio_phage	29.2	6.6e-13
WP_002348772.1|2343444_2344860_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_002303464.1|2344828_2346982_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	7.0e-41
WP_002303465.1|2347239_2347476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294603.1|2347494_2347710_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002348773.1|2348412_2349102_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002348774.1|2349225_2350545_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_002296840.1|2352118_2353306_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002294600.1|2353660_2353807_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_101701471.1|2353910_2354222_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 14
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	2489420	2613970	2869275	protease,tRNA,holin,transposase	Bacillus_phage(20.69%)	91	NA	NA
WP_002297218.1|2489420_2490716_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294493.1|2490870_2491554_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_002285996.1|2491555_2492392_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002302556.1|2492402_2494157_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.1e-39
WP_002285994.1|2494432_2494774_-	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	34.9	1.3e-10
WP_002294492.1|2494841_2497013_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002285989.1|2497223_2498081_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002285988.1|2498151_2499009_-	ROK family protein	NA	NA	NA	NA	NA
WP_002285985.1|2498993_2501696_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_002294491.1|2501708_2502998_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_002302559.1|2503147_2504194_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285980.1|2504195_2506349_+	alpha-1,2-mannosidase	NA	NA	NA	NA	NA
WP_002304851.1|2506821_2508273_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002285976.1|2508269_2509994_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010782528.1|2509986_2510601_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002285974.1|2510945_2512403_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002285972.1|2512443_2513364_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002285971.1|2513375_2514323_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002285969.1|2514801_2515521_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002304848.1|2515569_2517216_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002285964.1|2517394_2517985_+	transporter	NA	NA	NA	NA	NA
WP_002285962.1|2518076_2519582_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002285961.1|2519665_2521018_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002285960.1|2521017_2521536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285954.1|2521551_2521878_-	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002285949.1|2521890_2523870_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002285948.1|2523890_2524205_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002285944.1|2524372_2524666_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002321621.1|2524743_2525856_-	FUSC family protein	NA	NA	NA	NA	NA
WP_002297280.1|2526008_2526233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285932.1|2526242_2526422_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2526615_2526786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016252731.1|2527209_2528229_-	collagen binding domain-containing protein	NA	NA	NA	NA	NA
WP_002285924.1|2528375_2531447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303189.1|2533353_2534115_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285920.1|2534214_2535936_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.7e-37
WP_002285918.1|2535950_2537735_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.7e-46
WP_002285917.1|2538115_2539669_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2540016_2542431_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2542857_2544876_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2545245_2545902_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2545901_2546858_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2546857_2547424_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_000997695.1|2548042_2549221_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_076005178.1|2549244_2549436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|2549628_2550816_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_025479400.1|2550912_2551215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303477.1|2551989_2553009_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002301818.1|2553019_2553226_-|holin	holin	holin	NA	NA	NA	NA
WP_002301399.1|2553358_2554318_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002304713.1|2554520_2555453_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
WP_002341521.1|2555524_2555881_+	hypothetical protein	NA	U4KJ82	Streptococcus_phage	42.2	9.2e-15
WP_000997695.1|2555978_2557157_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2558027_2559367_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002301355.1|2559492_2561265_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.2e-54
WP_002285883.1|2561267_2562980_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002285876.1|2563094_2563763_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295567.1|2563829_2564618_-	esterase family protein	NA	NA	NA	NA	NA
WP_002295566.1|2564700_2566173_-	MFS transporter	NA	NA	NA	NA	NA
WP_002289731.1|2566302_2567496_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002297218.1|2567850_2569146_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296055.1|2577327_2578824_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	8.7e-91
WP_002290055.1|2578934_2579939_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002296053.1|2579939_2580827_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002287418.1|2581043_2583155_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002287415.1|2583244_2583790_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287414.1|2583789_2585235_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287412.1|2585354_2585825_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287409.1|2585870_2586296_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287407.1|2586362_2586632_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_101701472.1|2586642_2588238_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287403.1|2588252_2591774_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002287401.1|2591790_2592351_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002287399.1|2592703_2593678_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002287397.1|2593847_2595248_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_002287391.1|2595325_2596048_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287389.1|2596126_2596633_-	membrane protein	NA	NA	NA	NA	NA
WP_002322796.1|2596755_2598555_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_002297218.1|2598716_2600012_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002322795.1|2600144_2601683_-	hypothetical protein	NA	B5LJD6	Mycobacterium_phage	50.5	2.3e-17
WP_000122610.1|2602062_2603355_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002297218.1|2603499_2604795_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287385.1|2604966_2605476_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002296044.1|2605479_2606334_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002287382.1|2606488_2607127_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_002287380.1|2607127_2607778_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002287379.1|2607790_2608690_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_002287377.1|2608854_2610924_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	30.3	3.5e-21
WP_002287376.1|2610920_2611661_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_002287374.1|2611673_2613032_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002287372.1|2613031_2613970_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.7	5.2e-09
>prophage 15
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	2696500	2709618	2869275		Streptococcus_phage(83.33%)	16	NA	NA
WP_002297366.1|2696500_2696815_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2696827_2697202_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|2697202_2697547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343904.1|2697629_2698775_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	62.8	6.0e-132
WP_002297361.1|2699489_2701349_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_002297360.1|2701442_2701682_+	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	80.3	2.1e-23
WP_002297358.1|2701759_2702434_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|2702666_2703101_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2703101_2703809_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2703798_2704089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2704347_2705532_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2705528_2705666_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_101701473.1|2706411_2708325_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	1.3e-35
WP_033658092.1|2708428_2708653_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2708665_2709169_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2709228_2709618_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
>prophage 16
NZ_CP023784	Enterococcus faecium strain Efaecium_ER04120.3A chromosome, complete genome	2869275	2736796	2770069	2869275	integrase,transposase	Bacillus_phage(37.5%)	36	2753725:2753740	2763970:2763985
WP_002297332.1|2736796_2736991_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077828743.1|2737182_2737338_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002297326.1|2739194_2740811_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_002317220.1|2740928_2741147_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2741341_2741803_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002304820.1|2741995_2742235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297324.1|2742258_2743782_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002322279.1|2743799_2743922_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002304819.1|2743951_2744935_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|2744958_2745108_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|2745128_2745506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|2745537_2745717_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|2745731_2746001_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002297310.1|2746523_2748266_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-30
WP_002297309.1|2748249_2750004_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002297308.1|2750113_2750683_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002311663.1|2750700_2752125_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.9e-20
WP_002297304.1|2752126_2752795_-	cobalt transporter	NA	NA	NA	NA	NA
WP_071858995.1|2752925_2753510_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2753725:2753740	attL	ACCTTTTCTAAAATAA	NA	NA	NA	NA
WP_002297302.1|2753840_2754074_-	iron-dependent repressor	NA	NA	NA	NA	NA
WP_002297295.1|2754088_2755039_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297294.1|2755035_2755878_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002297293.1|2756199_2757387_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002297292.1|2757478_2758219_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002320809.1|2758906_2759065_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297291.1|2759136_2760363_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002348684.1|2760692_2761313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002364278.1|2761393_2761804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298782.1|2763353_2764130_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
2763970:2763985	attR	TTATTTTAGAAAAGGT	NA	NA	NA	NA
WP_002322873.1|2764227_2764875_-	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.4	4.5e-12
WP_002298780.1|2764874_2765705_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002298779.1|2765704_2766454_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298777.1|2766467_2766932_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002312606.1|2766981_2767443_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298774.1|2767424_2768399_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_076005180.1|2768605_2770069_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	2.2e-123
>prophage 1
NZ_CP023785	Enterococcus faecium strain Efaecium_ER04120.3A plasmid pER04120.3A.1, complete sequence	199876	12910	20581	199876	transposase	Temperate_phage(16.67%)	12	NA	NA
WP_002321302.1|12910_13384_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	62.0	5.6e-44
WP_002321303.1|13749_14010_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
WP_002296239.1|14454_14661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305766.1|14660_14912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305764.1|14927_15344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348912.1|15325_15598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305759.1|15764_16166_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	43.1	1.4e-24
WP_002305757.1|16177_17323_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D9J0Y9	Brochothrix_phage	74.6	7.7e-164
WP_002287514.1|17560_17824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321032.1|17817_18168_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002318230.1|18191_18806_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.9	2.6e-17
WP_002348911.1|19255_20581_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.6	1.2e-99
>prophage 2
NZ_CP023785	Enterococcus faecium strain Efaecium_ER04120.3A plasmid pER04120.3A.1, complete sequence	199876	36063	145161	199876	protease,transposase,holin,integrase,bacteriocin	Streptococcus_phage(21.88%)	96	82730:82755	129511:129536
WP_002300034.1|36063_38121_-|protease	serine protease	protease	NA	NA	NA	NA
WP_002300033.1|38265_38457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300032.1|38644_39100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305782.1|39096_39339_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002302862.1|39356_39659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302860.1|39727_41782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302859.1|41781_44394_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_002302858.1|44390_46769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302857.1|46829_47372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302856.1|47449_47782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302855.1|47782_48376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302854.1|48397_50422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302853.1|50421_51621_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	38.1	2.5e-32
WP_002302852.1|51636_52281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302851.1|52291_53098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582323.1|53508_54444_+	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_002305788.1|54487_54757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302849.1|55032_55308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302844.1|55349_55772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582318.1|55791_57384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302842.1|57404_57740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302840.1|57885_58080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|58215_59466_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305801.1|59875_62248_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002353594.1|62308_63778_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|63788_65798_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002303484.1|66143_66740_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002303483.1|66752_67652_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|67654_67786_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|67807_68140_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002303482.1|68184_68418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|68576_68699_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|68888_69113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|69555_69762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|69761_70013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|70193_70466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|70910_71090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|71148_71505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|72473_73427_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|73547_73811_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000997695.1|74182_75361_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002332708.1|75892_76801_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002300835.1|78745_79201_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|79214_80543_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|80576_80861_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|80862_81378_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|81393_82056_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|82062_82635_+	SIS domain-containing protein	NA	NA	NA	NA	NA
82730:82755	attL	CGTAAGCGCCCCATAGAACAGTACCT	NA	NA	NA	NA
WP_002303202.1|82806_84354_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	2.8e-44
WP_002287659.1|84455_84809_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|84798_84993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300843.1|85174_86695_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|86937_87123_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|87106_87289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|88242_88842_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|88905_89505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305879.1|90520_91393_-	ROK family protein	NA	NA	NA	NA	NA
WP_002303302.1|91656_93603_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|93787_95227_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|95228_96191_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|96360_97787_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|98029_98485_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|99070_99301_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|99530_100349_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|100509_101199_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|101212_102715_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|102727_103204_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|103701_104864_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|105981_106500_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|108575_109661_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|109768_110722_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002348774.1|111803_113123_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_002324322.1|114385_115564_+|transposase	IS256-like element ISEfm2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	24.9	2.6e-29
WP_002301128.1|116143_117139_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|117154_118324_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|118339_119074_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087043335.1|119844_121007_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_002301811.1|121575_122868_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|123141_123402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|123652_124831_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_073120200.1|125182_125479_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	6.7e-19
WP_002287876.1|126427_126823_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287875.1|126832_127681_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287874.1|127695_128523_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002285758.1|129593_129788_+	hypothetical protein	NA	NA	NA	NA	NA
129511:129536	attR	CGTAAGCGCCCCATAGAACAGTACCT	NA	NA	NA	NA
WP_002287659.1|129777_130131_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|130232_131780_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002300493.1|131985_133155_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_099745857.1|133494_134181_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
WP_000195429.1|134804_135977_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002348774.1|136227_137547_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_000997695.1|138638_139817_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_158294579.1|140837_142385_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	1.1e-06
WP_002304894.1|142442_142709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303113.1|143384_143936_-	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_002319817.1|144480_145161_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
>prophage 1
NZ_CP023786	Enterococcus faecium strain Efaecium_ER04120.3A plasmid pER04120.3A.2, complete sequence	40911	1656	9025	40911	transposase	Streptococcus_phage(100.0%)	9	NA	NA
WP_011117477.1|1656_2343_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	6.5e-126
WP_001814874.1|2482_2566_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038792.1|2690_3428_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	7.0e-134
WP_000085862.1|3432_3564_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	100.0	7.9e-17
WP_000567888.1|4721_4967_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228166.1|5069_5939_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000662263.1|5919_6654_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_000627290.1|7595_8138_+	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001096887.1|8230_9025_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
>prophage 2
NZ_CP023786	Enterococcus faecium strain Efaecium_ER04120.3A plasmid pER04120.3A.2, complete sequence	40911	27783	40250	40911	transposase	Streptococcus_phage(37.5%)	13	NA	NA
WP_000195429.1|27783_28956_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002354485.1|30821_31508_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_016171138.1|31555_32815_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.2	1.1e-54
WP_010782630.1|32964_33579_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	4.9e-16
WP_002288787.1|33892_34315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|34324_34528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|34738_35323_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_016171137.1|35491_36817_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.8	4.1e-100
WP_000568378.1|36809_37160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001021554.1|37156_37336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000026576.1|37471_37762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|38059_39232_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000101106.1|39461_40250_+	ParA family protein	NA	H7BUL8	unidentified_phage	35.7	4.7e-27
