The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025466	Klebsiella pneumoniae strain JS187 chromosome, complete genome	5359967	1099255	1112069	5359967	transposase,integrase	Enterobacteria_phage(70.0%)	13	1087389:1087403	1111606:1111620
1087389:1087403	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_014342877.1|1099255_1101589_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.4	0.0e+00
WP_002889911.1|1101922_1102150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|1102146_1102704_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1102700_1102967_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|1103508_1104246_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|1104242_1104488_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|1104505_1105072_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_001752311.1|1105713_1106745_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_004152979.1|1106795_1107221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1107220_1108171_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1108158_1109349_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1109701_1110955_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1110965_1112069_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1111606:1111620	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 2
NZ_CP025466	Klebsiella pneumoniae strain JS187 chromosome, complete genome	5359967	1321624	1367658	5359967	head,tRNA,transposase,integrase,terminase	Escherichia_phage(17.31%)	65	1324507:1324553	1373468:1373514
WP_004143010.1|1321624_1323010_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1323055_1323268_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1323269_1324136_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1324507:1324553	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_004151318.1|1324566_1325730_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004151317.1|1325606_1325942_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|1325943_1326159_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|1326160_1326379_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_014342888.1|1326375_1327146_-	hypothetical protein	NA	D5LH17	Escherichia_phage	52.0	8.5e-66
WP_014342889.1|1327142_1327670_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	6.4e-57
WP_071570658.1|1327666_1327825_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	5.1e-10
WP_014342890.1|1327821_1328445_-	hypothetical protein	NA	S0A2A9	Cellulophaga_phage	48.1	1.3e-45
WP_023283325.1|1328441_1328945_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	29.5	6.0e-12
WP_014342893.1|1328956_1329241_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	1.5e-28
WP_071646962.1|1329321_1329528_-	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	3.1e-31
WP_039108792.1|1330205_1330553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041937863.1|1330753_1331476_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	9.4e-75
WP_004194000.1|1331544_1331772_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_001548453.1|1331811_1332033_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151297.1|1332257_1333157_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
WP_004151296.1|1333146_1334577_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
WP_004151295.1|1334576_1334870_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|1334866_1335373_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_032419573.1|1335369_1335618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342898.1|1335610_1336285_+	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	63.0	7.8e-07
WP_041937862.1|1336284_1336803_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.7	2.3e-91
WP_004151288.1|1338253_1338709_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_023342724.1|1338708_1338879_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_014342900.1|1338871_1339510_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.3	1.4e-74
WP_041937861.1|1339506_1339686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342901.1|1339682_1339805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041937860.1|1339801_1340581_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	76.7	6.3e-101
WP_004151282.1|1341525_1341774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342902.1|1341776_1342307_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	79.7	9.3e-80
WP_014342903.1|1342303_1342693_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	47.9	1.1e-21
WP_014342905.1|1343151_1343787_+	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	9.4e-103
WP_060613562.1|1343817_1344303_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	79.5	2.2e-67
WP_014342907.1|1344304_1345981_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.4	2.3e-249
WP_014342908.1|1345981_1347502_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.8	2.2e-105
WP_014342909.1|1347554_1348244_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	52.2	6.7e-62
WP_101987939.1|1348307_1349690_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	51.2	2.2e-56
WP_013362812.1|1349921_1350890_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_014342913.1|1351411_1351894_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.2e-33
WP_004196839.1|1351893_1352931_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	1.1e-84
WP_014342914.1|1352932_1353259_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	42.5	2.1e-10
WP_065799716.1|1353258_1353702_+	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	40.5	2.5e-14
WP_014342915.1|1353704_1354268_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.4	2.4e-17
WP_060613554.1|1354264_1354633_+	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	1.6e-06
WP_014342917.1|1354614_1355166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342918.1|1355169_1356651_+	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	35.0	9.3e-61
WP_014342919.1|1356650_1357094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342920.1|1357274_1357832_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	89.3	1.2e-88
WP_001518122.1|1357911_1358388_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	5.5e-07
WP_014342922.1|1358589_1360515_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	53.2	1.7e-38
WP_014342923.1|1360518_1361361_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.1	1.3e-27
WP_032425989.1|1361362_1361668_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	45.5	2.4e-19
WP_032425987.1|1361664_1362519_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.8	2.4e-29
WP_040155013.1|1362520_1363108_+	hypothetical protein	NA	A0A1I9SEV6	Klebsiella_phage	25.9	1.5e-06
WP_100222754.1|1363110_1363461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153255413.1|1363460_1363736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425981.1|1363714_1364077_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	53.5	1.5e-12
WP_014342925.1|1364192_1364369_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_101987940.1|1364439_1365414_+	hypothetical protein	NA	A5VW58	Enterobacteria_phage	84.5	2.8e-98
WP_001518114.1|1365481_1365838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342927.1|1365845_1367078_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.7	3.9e-105
WP_014342928.1|1367070_1367658_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.9	1.0e-34
1373468:1373514	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP025466	Klebsiella pneumoniae strain JS187 chromosome, complete genome	5359967	1813139	1887090	5359967	head,plate,tRNA,lysis,integrase,terminase,capsid,protease,portal,tail	Salmonella_phage(56.82%)	74	1813047:1813065	1843347:1843365
1813047:1813065	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004151720.1|1813139_1814192_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
WP_001154434.1|1816196_1816385_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1816395_1816629_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1816743_1817421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|1817696_1819439_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|1819500_1820526_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|1820525_1822292_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|1822434_1823268_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|1823284_1824343_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|1824346_1824997_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1825092_1825557_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|1825556_1825760_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|1825763_1825979_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|1825959_1826469_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|1826473_1826857_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|1826853_1827282_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896172.1|1827377_1827809_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|1827801_1828248_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|1828244_1828937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|1829031_1829604_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|1829600_1829963_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|1829949_1830858_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|1830850_1831450_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|1831451_1834403_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|1834406_1835138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|1835134_1835338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|1835367_1836444_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|1836582_1837755_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1837764_1838280_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1838332_1838632_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1838646_1838766_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|1838758_1841386_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|1841382_1841868_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1841864_1842965_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|1843056_1843275_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_004179131.1|1843494_1845180_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
1843347:1843365	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_002896351.1|1845446_1845830_+	membrane protein	NA	NA	NA	NA	NA
WP_002896352.1|1845836_1846100_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896354.1|1846302_1846590_+	YbjC family protein	NA	NA	NA	NA	NA
WP_002896363.1|1847411_1848314_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896365.1|1848402_1848882_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896368.1|1849230_1850343_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896370.1|1850506_1851640_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896371.1|1851650_1852604_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|1852600_1853446_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896376.1|1853503_1853992_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896378.1|1854033_1855161_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896380.1|1855239_1855956_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896382.1|1855952_1857425_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896384.1|1857467_1858199_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004150852.1|1858382_1859051_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896386.1|1859050_1859767_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_002896390.1|1859773_1860505_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896392.1|1860525_1861254_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896394.1|1861480_1861996_-	lipoprotein	NA	NA	NA	NA	NA
WP_004150851.1|1862873_1864013_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896397.1|1864044_1864875_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_002896399.1|1864871_1865885_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896401.1|1865972_1867415_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896404.1|1867425_1868427_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896406.1|1868465_1870184_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896408.1|1870335_1870770_+	DoxX family protein	NA	NA	NA	NA	NA
WP_002896412.1|1871895_1873548_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_004147773.1|1873691_1874591_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896434.1|1874706_1875402_-	aquaporin Z	NA	NA	NA	NA	NA
WP_002896437.1|1875821_1877480_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896440.1|1877626_1878742_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1878738_1880679_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1880755_1880977_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1881302_1881620_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1881650_1883930_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1884050_1884269_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1884622_1885324_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|1885368_1887090_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 4
NZ_CP025466	Klebsiella pneumoniae strain JS187 chromosome, complete genome	5359967	2310681	2349147	5359967	terminase,integrase	uncultured_Caudovirales_phage(34.04%)	56	2308762:2308776	2317702:2317716
2308762:2308776	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2310681_2311443_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2311659_2313192_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2313390_2313939_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2314135_2315317_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2315297_2315540_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152149.1|2315718_2316198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|2316194_2316407_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|2316403_2316628_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2316617_2317328_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2317333_2317852_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2317702:2317716	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2317956_2318784_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2318780_2318975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2318971_2319397_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|2319393_2319612_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|2319583_2319838_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|2319830_2320196_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2320365_2320554_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2320546_2320861_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2321031_2321700_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2321797_2322019_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2322595_2324254_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2324255_2325218_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2325214_2325691_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2325687_2326470_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|2326875_2327124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|2327126_2327657_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2327653_2328043_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2328277_2328598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152171.1|2328699_2329452_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152172.1|2329402_2330803_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2331040_2332492_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2332547_2333096_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2333147_2334350_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2334353_2334848_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_014343020.1|2334859_2335801_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	3.9e-137
WP_000725700.1|2335840_2336122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2336090_2336510_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2336506_2337013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2337012_2337399_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2337493_2337934_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2337937_2339083_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|2339093_2339534_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|2339537_2339963_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2339998_2340151_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2340140_2342144_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|2342143_2342743_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152568.1|2342743_2343046_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152569.1|2343048_2344071_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2344070_2344412_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2344461_2344644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2344686_2345253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2345306_2345960_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2345961_2346315_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2346314_2347511_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2347507_2348281_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|2348280_2349147_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
>prophage 5
NZ_CP025466	Klebsiella pneumoniae strain JS187 chromosome, complete genome	5359967	2575268	2581705	5359967		Escherichia_phage(100.0%)	6	NA	NA
WP_002210516.1|2575268_2575889_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2575881_2577147_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|2577158_2578061_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004176269.1|2579111_2579972_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2580269_2580530_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2580616_2581705_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
>prophage 6
NZ_CP025466	Klebsiella pneumoniae strain JS187 chromosome, complete genome	5359967	3581485	3589862	5359967		Escherichia_phage(28.57%)	8	NA	NA
WP_004175262.1|3581485_3582490_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_004144151.1|3582890_3583013_+	small membrane protein	NA	NA	NA	NA	NA
WP_004175261.1|3583435_3584602_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004175260.1|3584781_3585336_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004175259.1|3585350_3586241_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175258.1|3586272_3587142_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_014343304.1|3587168_3588233_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.2e-105
WP_014343305.1|3588455_3589862_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 7
NZ_CP025466	Klebsiella pneumoniae strain JS187 chromosome, complete genome	5359967	3631988	3638893	5359967	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|3631988_3633467_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|3633463_3634186_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|3634504_3635866_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|3636111_3637005_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|3637245_3638019_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|3638029_3638893_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 8
NZ_CP025466	Klebsiella pneumoniae strain JS187 chromosome, complete genome	5359967	4044087	4113566	5359967	head,plate,tRNA,holin,lysis,integrase,terminase,capsid,portal,tail	Escherichia_phage(31.91%)	71	4067445:4067460	4086776:4086791
WP_002914079.1|4044087_4044825_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4044956_4046288_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4046333_4046717_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4047030_4047720_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4047777_4048863_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4049066_4049492_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4049561_4050260_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004188841.1|4050294_4052946_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4053066_4054422_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4054463_4054787_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4054790_4056089_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4062054_4064628_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4064757_4065489_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4065485_4066466_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4066597_4067335_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
4067445:4067460	attL	TTATCGGGTTCGACAA	NA	NA	NA	NA
WP_002914111.1|4067605_4067941_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4068047_4068095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|4068195_4069356_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4069352_4070225_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4070287_4071409_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4071418_4072489_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_044531920.1|4072831_4073341_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|4073333_4074557_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|4074570_4075053_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4075061_4076432_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4076488_4076947_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_014343376.1|4077178_4078210_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	83.7	1.6e-173
WP_101987948.1|4078212_4079085_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	44.8	2.1e-68
WP_023317540.1|4079210_4079438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343379.1|4079469_4079979_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	94.1	4.1e-85
WP_040165606.1|4079986_4080187_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	71.0	9.3e-17
WP_014343381.1|4080267_4080555_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	55.9	2.3e-24
WP_014343382.1|4080620_4080845_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	71.9	4.4e-15
WP_014343383.1|4080844_4081072_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	76.4	1.8e-24
WP_014343384.1|4081068_4081650_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	77.7	2.6e-83
WP_014343385.1|4081646_4081919_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	73.3	1.1e-31
WP_042945817.1|4081915_4082197_+	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	50.0	1.3e-11
WP_101987949.1|4082187_4084404_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.6	0.0e+00
WP_004152765.1|4084550_4086035_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014343387.1|4086441_4086624_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	78.3	5.3e-19
WP_064172876.1|4086627_4086858_+	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	69.7	4.8e-25
4086776:4086791	attR	TTATCGGGTTCGACAA	NA	NA	NA	NA
WP_014343389.1|4086937_4087669_+	hypothetical protein	NA	Q37850	Escherichia_phage	85.6	2.4e-118
WP_014343390.1|4087782_4088580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343391.1|4088951_4089995_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	2.6e-166
WP_014343392.1|4089994_4091764_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	2.4e-305
WP_014343393.1|4091929_4092784_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	4.8e-126
WP_040230952.1|4092857_4093916_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	1.4e-164
WP_101987951.1|4093919_4094663_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	80.3	6.7e-100
WP_014343397.1|4094759_4095266_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_014343398.1|4095265_4095469_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	79.1	3.6e-24
WP_004195910.1|4095473_4095764_+|holin	holin	holin	O80308	Escherichia_phage	85.7	5.3e-37
WP_014343399.1|4095750_4096248_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	87.7	3.0e-80
WP_014343400.1|4096244_4096676_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	3.7e-42
WP_014343402.1|4096771_4097239_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.8	6.3e-64
WP_085841837.1|4097231_4097681_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	1.9e-49
WP_085841838.1|4097749_4098391_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	3.4e-92
WP_014343405.1|4098387_4098735_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_014343406.1|4098739_4099648_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	70.5	1.9e-112
WP_101987952.1|4099640_4100240_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	57.0	4.9e-53
WP_101987953.1|4100244_4104471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343410.1|4104486_4105557_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.8	8.9e-29
WP_014343411.1|4105667_4106849_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.9	2.1e-196
WP_014343412.1|4106862_4107378_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_004195711.1|4107438_4107714_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_014343413.1|4107746_4107866_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_014343414.1|4107858_4110300_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	72.1	1.1e-289
WP_101987954.1|4110313_4110793_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	82.2	9.3e-71
WP_014343416.1|4110792_4111953_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	81.2	9.8e-175
WP_071839001.1|4112033_4112252_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	84.7	7.8e-33
WP_002914145.1|4112411_4112759_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4112798_4113566_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP025466	Klebsiella pneumoniae strain JS187 chromosome, complete genome	5359967	4845518	4894361	5359967	head,tRNA,terminase,capsid,protease,portal,tail	uncultured_Caudovirales_phage(66.67%)	55	NA	NA
WP_002918465.1|4845518_4846013_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|4846016_4846655_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|4846624_4846909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|4846966_4847359_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|4847374_4847803_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|4848068_4849196_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|4849386_4849785_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|4849958_4851326_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|4851413_4852472_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|4852608_4853547_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|4853961_4854432_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|4854807_4855071_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|4855169_4855436_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|4855486_4855762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|4855841_4857809_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|4857814_4858747_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|4858754_4858958_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|4859089_4860019_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|4860054_4861500_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|4861588_4865386_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|4865423_4866893_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|4866895_4867477_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|4867484_4867973_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|4867972_4868965_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|4869035_4870079_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|4870384_4872325_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|4872404_4872596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|4872824_4873826_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|4873825_4874434_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|4874657_4875110_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|4875132_4875600_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|4875610_4876960_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|4877070_4877313_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|4877302_4878754_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|4878765_4879647_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|4880004_4880970_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4880994_4881291_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|4881444_4881636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|4881638_4883300_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|4883283_4883640_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150959.1|4883915_4884359_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|4884358_4884658_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|4884654_4884990_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|4884986_4886228_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|4886229_4886790_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|4886841_4888008_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|4888271_4888784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|4888832_4889168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4889510_4891646_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|4891645_4892011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4892007_4892376_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|4892372_4892687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|4892679_4892868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|4892860_4893130_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|4893581_4894361_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 1
NZ_CP025467	Klebsiella pneumoniae strain JS187 plasmid p187-1, complete sequence	246557	53625	67348	246557		Salmonella_phage(53.85%)	21	NA	NA
WP_014839967.1|53625_53946_+	hypothetical protein	NA	J9Q750	Salmonella_phage	53.8	8.2e-31
WP_014839968.1|54627_54831_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	64.2	2.8e-16
WP_025999286.1|54873_55485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839969.1|55549_55795_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	65.8	6.1e-18
WP_062878103.1|55941_56130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900706.1|56122_56857_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	36.3	9.4e-14
WP_014839970.1|57122_57347_+	hypothetical protein	NA	B1GS76	Salmonella_phage	51.2	2.3e-08
WP_017900705.1|57350_58424_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.8	1.1e-18
WP_017900703.1|58840_59248_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	56.1	3.5e-18
WP_017900702.1|59244_59529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839971.1|60018_60231_+	hypothetical protein	NA	J9Q804	Salmonella_phage	50.0	3.0e-13
WP_017900701.1|60487_61120_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	55.9	1.5e-28
WP_017900700.1|61159_61681_+	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	68.5	5.4e-64
WP_009654227.1|61773_62061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654204.1|62313_62634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900698.1|62723_63158_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	28.3	4.3e-06
WP_017900697.1|63243_63876_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	41.2	8.3e-27
WP_025999285.1|64157_64502_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_017900695.1|64498_64744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099501131.1|64817_65207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900693.1|66106_67348_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	29.4	8.7e-12
>prophage 2
NZ_CP025467	Klebsiella pneumoniae strain JS187 plasmid p187-1, complete sequence	246557	92031	101686	246557		Salmonella_phage(66.67%)	12	NA	NA
WP_002210513.1|92031_92793_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|92813_93674_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_014342145.1|95591_95867_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
WP_019704582.1|95917_96355_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_014342147.1|96510_97041_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_004109892.1|97674_98325_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_014342149.1|98375_98579_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	5.4e-28
WP_014342150.1|99173_99656_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.0	2.9e-64
WP_032734118.1|100267_100675_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	45.0	3.6e-23
WP_040212587.1|100794_101106_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.9	1.8e-30
WP_014342155.1|101242_101455_-	hypothetical protein	NA	J9Q804	Salmonella_phage	74.3	7.6e-25
WP_014342156.1|101467_101686_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	6.4e-27
>prophage 3
NZ_CP025467	Klebsiella pneumoniae strain JS187 plasmid p187-1, complete sequence	246557	105631	188767	246557	integrase,transposase	Salmonella_phage(71.7%)	76	162553:162572	185450:185469
WP_014342160.1|105631_107188_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	5.8e-106
WP_014342161.1|107184_108381_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_101987963.1|108456_111573_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.8	6.0e-25
WP_014342165.1|111634_111850_-	restriction endonuclease subunit M	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
WP_014342166.1|111978_112557_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	5.1e-55
WP_014342167.1|112684_112840_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_019704567.1|112839_113265_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_154496327.1|113565_114198_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	46.5	1.5e-28
WP_101987964.1|114251_114860_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	93.1	2.6e-110
WP_014342171.1|115449_115683_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	85.5	9.2e-32
WP_014342172.1|115885_116479_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	94.9	2.6e-107
WP_014342173.1|116663_117497_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	1.1e-63
WP_014342174.1|117622_118180_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_014342175.1|118189_118609_-	hypothetical protein	NA	J9Q743	Salmonella_phage	73.4	1.9e-51
WP_014342176.1|118672_119317_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	76.6	6.8e-93
WP_019704561.1|119316_119793_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.0	1.9e-71
WP_019704560.1|119789_120203_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	2.3e-54
WP_014342179.1|120204_121308_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
WP_014342180.1|121501_122377_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
WP_014342181.1|122454_123597_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_014342182.1|123727_126031_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
WP_014342183.1|126106_126676_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
WP_019704557.1|126685_127432_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	1.2e-77
WP_101987965.1|127421_129338_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.6	1.6e-299
WP_014342188.1|129567_130653_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
WP_019704555.1|131305_132865_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
WP_014342193.1|133178_133823_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	8.3e-99
WP_019704554.1|134143_135241_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.2e-73
WP_014342074.1|135692_135905_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_019704552.1|135904_136240_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
WP_019704550.1|136949_138026_-	recombinase	NA	J9Q736	Salmonella_phage	96.4	3.8e-197
WP_019704549.1|138028_138295_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_014342079.1|138294_139239_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	1.1e-171
WP_014342080.1|139299_140307_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.3	1.6e-144
WP_014342081.1|140426_140858_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.4e-65
WP_014342082.1|141022_141322_-	lipoprotein	NA	NA	NA	NA	NA
WP_023343104.1|141333_141714_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	64.3	1.0e-43
WP_026005933.1|141953_142397_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	8.9e-60
WP_019704546.1|142393_145912_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.0	0.0e+00
WP_019704545.1|146092_147325_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.6	1.3e-212
WP_014342089.1|147421_149707_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	66.1	8.0e-245
WP_014342091.1|150309_150690_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_023343103.1|150684_151785_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.0	9.4e-18
WP_004152765.1|151871_153356_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_019704541.1|154044_154404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342093.1|154468_154879_-	toxin YafO	NA	NA	NA	NA	NA
WP_100206813.1|154888_155299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026005930.1|155588_155834_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
WP_014342096.1|155964_156738_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.0	1.1e-89
WP_014342097.1|156978_158568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704538.1|159863_160280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138014.1|160343_163310_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
162553:162572	attL	TTGAGCAGGCGGTTCTGGTG	NA	NA	NA	NA
WP_001161490.1|163313_163874_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000993245.1|164049_164262_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|164224_164344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|164327_164564_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|164560_164926_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|164943_166629_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|166667_167093_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|167120_167396_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_011091028.1|170374_171250_+	class A extended-spectrum beta-lactamase CTX-M-3	NA	A0A1B0VBP7	Salmonella_phage	82.1	5.4e-125
WP_013023839.1|171296_171773_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_000027057.1|172031_172892_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000971921.1|173712_175083_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_001330846.1|176385_176631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|176636_176828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000679427.1|178229_178577_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_012477387.1|178745_179378_-	type B-2 chloramphenicol O-acetyltransferase CatB2	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	44.4	4.1e-26
WP_001206317.1|179430_180222_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_019407932.1|180338_181133_-	aminoglycoside O-phosphotransferase APH(3')-XV	NA	Q75ZG1	Hepacivirus	39.4	1.3e-40
WP_003159191.1|181203_181758_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_013263789.1|181865_182666_-	subclass B1 metallo-beta-lactamase VIM-1	NA	NA	NA	NA	NA
WP_000845054.1|182832_183846_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001162012.1|184151_184709_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_094898591.1|184711_187684_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.0	0.0e+00
185450:185469	attR	CACCAGAACCGCCTGCTCAA	NA	NA	NA	NA
WP_000427614.1|187762_188767_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP025468	Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence	129684	88966	100125	129684		Escherichia_phage(50.0%)	10	NA	NA
WP_001568041.1|88966_89668_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|90104_90335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214012.1|90397_91069_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|91071_92043_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152765.1|92291_93776_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568036.1|94185_94617_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_013214011.1|94616_95888_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_086523286.1|95969_96947_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977818.1|96943_98149_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_004118283.1|99258_100125_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
>prophage 1
NZ_CP025470	Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence	106402	81805	88265	106402	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000792636.1|81805_82339_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_002210549.1|83310_83652_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	7.3e-62
WP_001067855.1|83688_84393_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|84697_85255_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|85437_86298_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|86467_87223_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_014342204.1|87303_87852_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_099147893.1|87872_88265_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.5e-22
