The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	254573	304815	5220976	transposase,plate	Enterobacteria_phage(25.0%)	47	NA	NA
WP_000224516.1|254573_255920_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013423.1|255922_256447_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433564.1|256443_257736_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896714.1|257740_258790_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863402.1|258753_260595_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000946068.1|260600_261026_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|261030_262515_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|262537_263041_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|263746_264265_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000571853.1|266573_267620_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528852.1|267612_269052_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|269026_269317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|271164_271653_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|271923_272694_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|272847_273321_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973137.1|273363_275808_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|276047_276626_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001331866.1|276830_277598_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|277568_278309_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|278620_279370_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_000006241.1|279545_280043_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_014639450.1|280125_280284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555810.1|280362_282102_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001350632.1|282061_282832_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|282902_283958_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|284009_284303_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|284305_284704_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_001059895.1|284713_285166_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001331869.1|285343_286495_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
WP_000602123.1|286491_287106_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|287162_288620_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291988.1|288880_289339_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189577.1|289430_290675_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|290732_291134_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749902.1|291243_292299_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|292587_293691_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|293702_294956_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
WP_001273869.1|296470_297022_-	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	3.2e-30
WP_000606594.1|298954_299524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000639937.1|299533_299803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083574856.1|299899_300283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580785.1|300340_300544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390657.1|300543_300852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807036.1|301837_302035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000013184.1|302039_302423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999105.1|302437_303469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948620.1|303602_304815_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
>prophage 3
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	857899	933132	5220976	plate,terminase,portal,integrase,capsid,tail,head,lysis,protease	Salmonella_phage(66.04%)	80	848814:848828	877735:877749
848814:848828	attL	GAGTGCCGGACGTTT	NA	NA	NA	NA
WP_000290937.1|857899_858952_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_021574262.1|859034_860711_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
WP_000107903.1|860731_861328_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	1.1e-39
WP_000188448.1|861423_861645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460892.1|861677_862187_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956192.1|862194_862491_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|862608_862950_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244224.1|863017_863251_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000752610.1|863250_863478_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001544405.1|863474_864332_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_001513674.1|864328_866743_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_001154434.1|866896_867085_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217562.1|867095_867329_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_023150399.1|867457_868198_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	91.1	1.2e-133
WP_000008839.1|868585_869995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032162483.1|870042_871077_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.4	1.4e-169
WP_001098431.1|871076_872843_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_032162482.1|872985_873819_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	1.7e-123
WP_000742511.1|873835_874894_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059191.1|874897_875548_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673530.1|875643_876108_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_001518824.1|876107_876311_+	hypothetical protein	NA	E5G6M9	Salmonella_phage	92.5	1.8e-31
WP_000171568.1|876314_876530_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_072161437.1|876549_877023_+	lysozyme	NA	E5G6N1	Salmonella_phage	90.4	1.4e-79
WP_000727853.1|877024_877402_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080935.1|877398_877827_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	1.6e-45
877735:877749	attR	AAACGTCCGGCACTC	NA	NA	NA	NA
WP_001039935.1|877922_878354_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_032200200.1|878346_878793_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	86.3	3.0e-63
WP_033562173.1|878861_879440_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.7e-93
WP_000177580.1|879436_879796_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_032200202.1|879782_880691_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	1.6e-143
WP_033562172.1|880683_881289_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	90.5	3.5e-107
WP_033562171.1|881285_882911_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.7	3.7e-196
WP_000356478.1|882910_883513_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.9	3.6e-88
WP_000046126.1|883647_884820_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_001207660.1|884829_885345_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|885399_885702_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|885716_885836_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_033562170.1|885828_888906_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980420.1|888902_889388_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_001011772.1|889384_890485_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.2e-174
WP_000972391.1|890575_890794_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|891029_892715_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681104.1|892984_893362_+	membrane protein	NA	NA	NA	NA	NA
WP_001195230.1|893391_893649_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_001201575.1|893808_894096_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|894079_894802_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|894862_895765_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|895852_896329_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|896678_897791_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|897885_899019_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105433.1|899028_899982_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|899978_900824_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|900883_901372_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149763.1|901412_902540_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
WP_001295905.1|902568_903300_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|903525_904194_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001692.1|904193_904910_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|904916_905648_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|905665_906394_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001298306.1|906611_907127_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|907252_907576_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255187.1|907572_908403_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001305933.1|908399_909413_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136572.1|909511_910942_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566391.1|910952_911954_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815373.1|911990_913709_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000178694.1|913841_914810_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|914821_916474_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|916617_917517_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|917837_918533_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599804.1|918958_920617_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|920613_921570_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746477.1|921720_922836_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188147.1|922832_924779_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|924851_925076_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|925398_925719_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|925749_928026_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|928918_929902_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|929898_933132_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
>prophage 4
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	1180474	1239479	5220976	terminase,transposase,portal,integrase,capsid,tail,head,lysis,tRNA	Enterobacteria_phage(53.66%)	73	1173110:1173125	1224818:1224833
1173110:1173125	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_001298466.1|1180474_1181581_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1181634_1182096_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|1182105_1182759_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1182930_1184181_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1184294_1185437_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1185426_1185663_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1185802_1186042_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1186025_1186352_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1186351_1186573_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|1186959_1187151_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1187123_1187306_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1187302_1187983_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001308572.1|1187979_1188714_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	5.0e-140
WP_001204776.1|1190145_1190529_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1190717_1191800_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1192388_1192604_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_016239222.1|1192603_1193098_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.3e-88
WP_001228695.1|1193314_1193497_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_016239223.1|1193587_1193872_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.6	3.7e-43
WP_000830178.1|1194360_1194687_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1194893_1195076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|1195638_1196187_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_083574874.1|1196158_1198087_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.5e-260
WP_000258997.1|1198070_1198277_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|1198273_1199866_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253914.1|1199855_1201361_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|1201397_1201745_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|1201802_1202831_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|1202882_1203257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1203249_1203603_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|1203614_1204193_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_101408907.1|1204189_1204585_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
WP_001351266.1|1204592_1205333_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|1205348_1205771_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459474.1|1205752_1206187_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_032142408.1|1206179_1208741_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.8	0.0e+00
WP_000847405.1|1208737_1209067_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|1209066_1209765_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|1209770_1210514_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|1210450_1211083_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515327.1|1211143_1214626_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000290543.1|1214684_1216745_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|1216741_1217020_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000355360.1|1217032_1217326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968127.1|1217417_1218275_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101730.1|1218271_1219129_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983716.1|1219125_1219953_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	29.0	1.9e-07
WP_001304451.1|1221567_1222326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|1222797_1222950_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001445545.1|1223033_1223159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373104.1|1223212_1223617_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332310.1|1223837_1224569_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.0	9.3e-54
WP_001298110.1|1224773_1225985_-	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
1224818:1224833	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_000554153.1|1226298_1226535_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_000858013.1|1226577_1226850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000888771.1|1226878_1227145_+	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_001065750.1|1227257_1227506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072105022.1|1227929_1228697_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001065862.1|1228828_1229047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295611.1|1231021_1231351_-	YmgD family protein	NA	NA	NA	NA	NA
WP_000726974.1|1231360_1231705_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000120100.1|1231706_1231880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001331738.1|1231980_1232166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131456.1|1232126_1232246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185665.1|1232996_1233263_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000101055.1|1233266_1234079_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000072536.1|1234102_1234798_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_001056851.1|1235317_1235686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693755.1|1235805_1236207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295992.1|1236448_1236742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284277.1|1236813_1237473_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000807627.1|1237549_1238011_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_085949152.1|1238205_1239479_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
>prophage 5
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	1297325	1387818	5220976	terminase,transposase,portal,holin,integrase,capsid,tail,head,lysis,protease	Escherichia_phage(30.91%)	99	1290720:1290736	1343637:1343653
1290720:1290736	attL	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_001111620.1|1297325_1298525_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|1299317_1300160_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|1300209_1300668_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1300780_1301686_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|1301777_1302791_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1302992_1303901_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1304044_1304458_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|1305061_1305679_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|1307136_1309812_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|1310288_1310936_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_000051910.1|1311093_1311255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297114.1|1311673_1313305_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|1313390_1314311_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|1314325_1315234_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|1315245_1316259_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|1316255_1317260_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|1317312_1317642_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|1317676_1319137_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|1319279_1319453_+	YciY family protein	NA	NA	NA	NA	NA
WP_001313775.1|1319507_1320761_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|1321060_1321357_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|1321580_1322297_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|1322336_1322735_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_016239390.1|1322840_1323380_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|1323409_1324153_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|1324508_1325147_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|1325192_1326323_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_023150470.1|1326300_1326549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000048435.1|1326613_1329085_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|1329177_1329369_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1329365_1329554_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|1329954_1330119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|1330119_1330341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1330500_1330656_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|1330948_1331287_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|1331678_1331921_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|1331904_1332330_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|1332401_1333472_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151216.1|1333512_1333935_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_014639476.1|1334126_1335089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|1335104_1336106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|1336514_1336622_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|1336666_1336879_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_011478175.1|1337046_1337325_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|1337326_1338373_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|1338385_1338760_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|1338756_1339578_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|1339802_1340000_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_001513760.1|1340150_1341200_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.8	1.4e-196
WP_001331709.1|1342474_1342702_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|1342970_1343186_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|1343190_1343535_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|1343500_1343773_-	hypothetical protein	NA	NA	NA	NA	NA
1343637:1343653	attR	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_000992052.1|1343878_1344412_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
WP_001082537.1|1344710_1345175_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|1345482_1345893_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|1345950_1346184_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|1346570_1347119_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_032140073.1|1347090_1349019_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	1.7e-259
WP_000259002.1|1349002_1349209_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|1349205_1350798_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_001253958.1|1350787_1352293_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000256823.1|1352329_1352677_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|1352734_1353763_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201495.1|1353814_1354198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|1354190_1354544_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|1354559_1355093_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|1355089_1355485_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|1355492_1356245_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_083574881.1|1356258_1356690_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|1356716_1357130_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|1357110_1359684_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847402.1|1359680_1360010_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152522.1|1360009_1360708_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|1360712_1361456_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|1361392_1361995_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|1362068_1362407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515773.1|1362473_1365953_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001233195.1|1366020_1366620_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_016230679.1|1366771_1369747_+|tail	phage tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	85.3	2.1e-48
WP_000885580.1|1369746_1370331_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240999.1|1370385_1371054_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1371110_1371380_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001079492.1|1372152_1372659_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|1372704_1373205_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|1373290_1373470_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|1373850_1374657_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|1374656_1375850_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001513786.1|1375861_1377220_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|1377223_1378819_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|1378818_1380381_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1380472_1380517_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001513787.1|1380654_1381536_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1381532_1382153_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_024187306.1|1382180_1384076_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1384288_1385164_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|1385203_1385794_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|1385790_1386549_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|1386768_1387818_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	1779969	1827446	5220976	plate,terminase,portal,integrase,holin,capsid,tail,head,tRNA	Enterobacteria_phage(75.47%)	64	1782371:1782395	1820087:1820111
WP_000029464.1|1779969_1780719_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154199.1|1780718_1781270_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_016239258.1|1781331_1782312_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
1782371:1782395	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000997174.1|1782520_1782850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028119965.1|1782957_1783290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247211.1|1783322_1784261_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000904674.1|1784349_1784658_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_001151410.1|1784754_1785033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101408909.1|1785047_1785386_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	84.5	7.1e-49
WP_099770322.1|1785396_1785675_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	1.1e-34
WP_000357028.1|1785686_1785929_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021714.1|1785925_1786039_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	86.5	2.0e-08
WP_000812400.1|1786129_1786447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032213123.1|1786436_1786640_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	1.9e-25
WP_099770323.1|1786636_1786882_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	96.3	2.1e-39
WP_000022529.1|1786878_1787175_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	78.8	1.9e-34
WP_001060886.1|1787185_1787389_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	92.5	7.7e-27
WP_023140813.1|1787385_1788216_+	SPFH/Band 7/PHB domain protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.6	3.3e-132
WP_101408910.1|1788269_1788890_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	39.0	2.6e-09
WP_000599374.1|1788886_1789252_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	1.9e-60
WP_143354376.1|1789258_1792081_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.6	0.0e+00
WP_000686540.1|1792157_1793117_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_000211292.1|1793121_1793436_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000201251.1|1793455_1793887_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000224220.1|1793888_1794152_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_000087812.1|1794663_1795710_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613756.1|1795709_1797461_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_024175680.1|1797615_1798452_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	1.5e-148
WP_001545864.1|1798475_1799528_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.6	7.5e-190
WP_001545863.1|1799573_1800374_+|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	3.8e-125
WP_000063100.1|1800475_1800970_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|1800969_1801170_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|1801172_1801496_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072341.1|1801492_1801885_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_099770325.1|1801881_1802277_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	92.6	3.9e-59
WP_001545861.1|1802415_1804296_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.3	3.4e-302
WP_021573188.1|1804319_1804787_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	9.3e-84
WP_000356358.1|1804779_1805415_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271944.1|1805411_1805993_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
WP_000213453.1|1805989_1806340_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	6.0e-59
WP_021522491.1|1806343_1807240_+|plate	phage baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	5.1e-155
WP_099770326.1|1807232_1807841_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	73.9	1.3e-85
WP_101408911.1|1807837_1809520_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	46.4	7.5e-107
WP_000072166.1|1810042_1810657_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_024244939.1|1810663_1811137_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	51.2	6.9e-34
WP_032342196.1|1811147_1811651_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	48.9	3.9e-35
WP_001375851.1|1811722_1812322_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.0e-86
WP_000979945.1|1812348_1812837_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_021573185.1|1812849_1815654_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.8	0.0e+00
WP_000333494.1|1815640_1815796_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000665313.1|1815804_1816170_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	6.4e-56
WP_000290450.1|1816224_1816737_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005454.1|1816736_1817921_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	1.9e-221
WP_000185904.1|1818077_1819187_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	9.0e-194
WP_000488107.1|1819227_1819488_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|1819679_1819820_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|1820128_1820428_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
1820087:1820111	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672426.1|1820432_1822820_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|1822834_1823818_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|1824101_1824146_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|1824268_1824625_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1824677_1824875_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1824971_1825514_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|1825517_1827446_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 7
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	1927674	2018826	5220976	terminase,portal,holin,integrase,capsid,tail,head,protease,tRNA	Enterobacteria_phage(40.98%)	102	2004347:2004362	2020385:2020400
WP_000984517.1|1927674_1928556_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055805.1|1928747_1930796_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	4.0e-86
WP_000431376.1|1930815_1931514_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001029108.1|1931610_1932108_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207278.1|1932237_1933521_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001332098.1|1933489_1936123_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001350670.1|1936202_1937642_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1937759_1937996_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|1938100_1938292_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812741.1|1938292_1938949_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.5	1.4e-56
WP_000984819.1|1939343_1939685_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879320.1|1939697_1940570_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|1940573_1940948_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1941086_1941317_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011664.1|1941418_1942075_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1942097_1942760_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936959.1|1942756_1944817_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024728.1|1945025_1945685_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|1946011_1946368_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|1946434_1946725_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173466.1|1946858_1948037_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|1948092_1948734_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_016239262.1|1948770_1950582_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301724.1|1950816_1952292_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	3.4e-79
WP_001056695.1|1952629_1953499_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091149.1|1953626_1955069_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_001296141.1|1955200_1956172_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|1956290_1957613_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|1957628_1958561_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1958639_1959395_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|1959391_1960177_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1960393_1961404_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1961412_1962024_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072123646.1|1962162_1962228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024939.1|1962299_1962902_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1962903_1963425_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|1963459_1964200_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077393227.1|1964228_1964681_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258675.1|1964673_1966446_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|1966755_1967322_+	hydrolase	NA	NA	NA	NA	NA
WP_001217553.1|1967676_1967925_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_068863085.1|1968042_1968330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235970.1|1968372_1969413_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	81.4	4.1e-156
WP_000654145.1|1969422_1969704_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	2.4e-18
WP_101408912.1|1969703_1972082_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	76.6	1.8e-186
WP_101408913.1|1972146_1972746_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	2.6e-102
WP_101408914.1|1972813_1976293_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_000741576.1|1976353_1977001_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_101408915.1|1976898_1977642_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_101408916.1|1977647_1978346_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	6.2e-132
WP_001114906.1|1978345_1978687_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.5	4.6e-40
WP_101408917.1|1978679_1981919_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	97.2	0.0e+00
WP_071605788.1|1981968_1982310_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	41.1	4.4e-06
WP_001406803.1|1982368_1982647_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	87.6	4.8e-35
WP_077883720.1|1982670_1983057_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	98.4	2.9e-62
WP_065273910.1|1983056_1983761_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	98.7	7.2e-120
WP_001209399.1|1983821_1984166_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_001147820.1|1984607_1984946_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000983037.1|1984954_1985260_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_000601355.1|1985271_1985460_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000257507.1|1985510_1986716_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_001193631.1|1986730_1987381_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466247.1|1987358_1988600_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_045171680.1|1988599_1988782_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	95.0	1.1e-24
WP_001140903.1|1988793_1990551_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_001317918.1|1990550_1991033_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_001140099.1|1991182_1991533_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001228685.1|1991637_1991823_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_097411251.1|1992039_1992573_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.6	8.1e-100
WP_059332741.1|1992709_1992991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839572.1|1993461_1993677_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_062859935.1|1994530_1995283_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	1.5e-136
WP_096002668.1|1995296_1996286_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	3.6e-194
WP_068862778.1|1996338_1996596_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	68.4	2.3e-20
WP_068862781.1|1996592_1997993_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	91.8	1.4e-244
WP_068862783.1|1997989_1998880_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.7	7.5e-82
WP_097411250.1|1998899_1999709_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	71.2	3.1e-90
WP_044863057.1|1999774_2000035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101408918.1|2000117_2000783_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	86.0	6.0e-100
WP_024245791.1|2000885_2001593_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	90.6	1.6e-114
WP_059276185.1|2001589_2001853_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	51.4	3.1e-12
WP_000144248.1|2001972_2002665_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	47.2	1.3e-49
WP_068862788.1|2002808_2003264_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	60.0	2.1e-27
WP_024235200.1|2003593_2003791_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	96.8	1.4e-28
WP_101408919.1|2003997_2004186_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	91.9	9.4e-27
WP_024235202.1|2004182_2004764_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	87.6	1.2e-99
2004347:2004362	attL	TGCCGGATTGCTGGGA	NA	NA	NA	NA
WP_024235203.1|2004766_2005045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024235206.1|2005226_2006054_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	98.5	4.0e-130
WP_068862793.1|2006094_2006454_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	87.8	7.0e-55
WP_024235208.1|2006485_2006728_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	96.2	1.7e-36
WP_001030152.1|2006731_2006878_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	97.9	2.2e-23
WP_000528717.1|2006886_2007123_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	9.9e-42
WP_059277615.1|2007178_2008492_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	97.7	1.1e-251
WP_050576360.1|2008473_2009244_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_001313931.1|2009296_2009692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2009732_2010476_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564725.1|2010472_2011444_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176867.1|2011608_2014038_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_001214282.1|2014062_2015163_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185753.1|2015550_2016297_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001304291.1|2016310_2016877_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025351.1|2017092_2018826_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.3	3.7e-85
2020385:2020400	attR	TCCCAGCAATCCGGCA	NA	NA	NA	NA
>prophage 8
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	2190785	2198520	5220976		Enterobacteria_phage(33.33%)	8	NA	NA
WP_001033086.1|2190785_2191892_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.6	5.9e-44
WP_001332228.1|2191884_2192352_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_032139969.1|2192338_2192749_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000857507.1|2192766_2193642_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.6e-107
WP_001023648.1|2193700_2194600_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	8.2e-28
WP_000699453.1|2194599_2195685_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.6e-100
WP_000183029.1|2196057_2196951_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.4	1.3e-46
WP_001116045.1|2197125_2198520_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
>prophage 9
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	2293867	2303312	5220976		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|2293867_2295004_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_016239290.1|2295000_2297004_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.2	0.0e+00
WP_001296231.1|2297128_2297590_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2297630_2298101_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2298147_2298867_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2298863_2300549_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|2300770_2301502_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|2301561_2301669_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|2301649_2302381_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|2302385_2303312_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 10
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	2548465	2566291	5220976	transposase	Enterobacteria_phage(70.83%)	26	NA	NA
WP_001198454.1|2548465_2548915_-	hypothetical protein	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
WP_000064337.1|2548923_2549490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011703616.1|2549686_2550016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950973.1|2551749_2551926_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000177653.1|2551918_2552344_-	DUF2591 domain-containing protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_001254264.1|2552340_2552517_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000814617.1|2552513_2552924_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_000229808.1|2553553_2553760_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_001248388.1|2553832_2555209_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_101408925.1|2555205_2556153_-	replication protein	NA	A5VW95	Enterobacteria_phage	99.7	2.2e-156
WP_001244621.1|2556155_2556428_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|2556450_2556744_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|2556852_2557038_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|2557118_2557769_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000219332.1|2558290_2558590_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	4.5e-31
WP_000167596.1|2558598_2559069_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
WP_085948620.1|2561475_2562689_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_000951332.1|2563045_2563429_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|2563452_2563749_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|2563843_2564362_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_000215166.1|2564358_2564658_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|2564659_2565232_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_001621581.1|2565231_2565516_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	98.9	1.5e-47
WP_000002106.1|2565508_2565793_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|2565865_2566033_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|2566090_2566291_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 11
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	2705920	2715098	5220976	holin,integrase	Escherichia_phage(87.5%)	9	2704223:2704238	2715743:2715758
2704223:2704238	attL	AAAAAAGCCCGCAACG	NA	NA	NA	NA
WP_001297323.1|2705920_2707129_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	53.7	5.5e-120
WP_001336051.1|2707562_2708045_-	DUF2514 domain-containing protein	NA	A0A2R9YJI7	Escherichia_phage	93.8	6.9e-74
WP_101408926.1|2708041_2708671_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	96.7	1.1e-111
WP_000256103.1|2708660_2708969_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
WP_001276090.1|2708955_2709360_-	membrane protein	NA	G9L6E6	Escherichia_phage	94.8	7.4e-61
WP_101408927.1|2709666_2712786_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	95.7	0.0e+00
WP_001188252.1|2712981_2713239_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
WP_000451764.1|2713261_2713990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617183.1|2714387_2715098_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	81.1	1.8e-102
2715743:2715758	attR	CGTTGCGGGCTTTTTT	NA	NA	NA	NA
>prophage 12
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	2718195	2751689	5220976	terminase,integrase,tail	Escherichia_phage(59.46%)	38	2727604:2727621	2758620:2758637
WP_101408928.1|2718195_2721216_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	97.0	0.0e+00
WP_061336245.1|2721215_2723924_-	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	90.8	0.0e+00
WP_000336178.1|2723923_2724502_-	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	79.8	7.1e-57
WP_000568023.1|2724501_2724966_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_101408929.1|2724965_2727437_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
WP_000179259.1|2727436_2728042_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	1.1e-111
2727604:2727621	attL	GCCAGGCCAACGCCTCCA	NA	NA	NA	NA
WP_083574918.1|2728098_2728434_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	3.8e-55
WP_021535130.1|2728444_2728882_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	99.3	6.3e-74
WP_000268715.1|2728933_2729920_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_001048079.1|2729934_2730630_-	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_000133160.1|2730632_2730929_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_097749428.1|2730925_2732605_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	8.0e-303
WP_000335899.1|2732619_2732826_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_083574919.1|2733528_2733948_+	hypothetical protein	NA	A0A2H4ZJ80	Enterobacter_phage	86.0	8.8e-17
WP_033551247.1|2734038_2735514_-	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.0	2.2e-296
WP_001090120.1|2735510_2736185_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_001124396.1|2736181_2736394_-	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_001129701.1|2736411_2736750_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	86.6	1.9e-49
WP_021518484.1|2736742_2737024_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	7.6e-49
WP_000253289.1|2737016_2737301_-	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_083574921.1|2737300_2738182_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	83.1	1.6e-137
WP_101408930.1|2739327_2739792_-	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	55.1	2.0e-30
WP_001231252.1|2739853_2740198_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.2	4.8e-61
WP_001406039.1|2740315_2741101_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
WP_080849403.1|2741097_2741913_-	primosomal protein	NA	Q286X4	Escherichia_phage	95.3	6.6e-117
WP_000402893.1|2741928_2742129_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_001282459.1|2742279_2742510_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836296.1|2742664_2743249_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	98.5	1.7e-103
WP_001102257.1|2743557_2743857_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	100.0	3.4e-47
WP_033551254.1|2743853_2744675_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	97.8	7.5e-161
WP_033551255.1|2744671_2745589_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	49.3	3.4e-69
WP_000675390.1|2745638_2745887_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001341620.1|2746044_2746296_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_001525367.1|2746288_2746939_+	hypothetical protein	NA	G9L699	Escherichia_phage	99.5	6.6e-128
WP_001077941.1|2746935_2747130_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	100.0	1.9e-27
WP_033551257.1|2747136_2748384_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	99.8	7.9e-239
WP_000138282.1|2748576_2750154_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|2750222_2751689_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
2758620:2758637	attR	TGGAGGCGTTGGCCTGGC	NA	NA	NA	NA
>prophage 13
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	2883789	2899836	5220976	transposase	Shigella_phage(40.0%)	18	NA	NA
WP_000353910.1|2883789_2884563_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_085949152.1|2884612_2885885_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_085948620.1|2886775_2887989_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001250269.1|2888308_2888488_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|2888663_2889215_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|2889258_2889459_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2889549_2890224_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_085948620.1|2890900_2892113_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_157830610.1|2892079_2892241_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.6e-06
WP_000135691.1|2892720_2893083_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|2893148_2893973_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|2894100_2894625_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|2894733_2895600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|2895641_2895848_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|2895808_2896981_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
WP_000060412.1|2896972_2897572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244589.1|2897600_2897927_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_085948620.1|2898623_2899836_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
>prophage 14
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	2973954	2981094	5220976		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|2973954_2976516_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|2976621_2977278_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|2977328_2978096_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|2978291_2979200_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001513947.1|2979196_2980459_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_001279003.1|2980455_2981094_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 16
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	4115171	4151645	5220976	transposase,integrase,tRNA	Enterobacteria_phage(37.5%)	35	4125994:4126008	4156649:4156663
WP_001070179.1|4115171_4115861_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000678408.1|4115866_4117948_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000468826.1|4117981_4119187_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|4119466_4120858_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_000668610.1|4120978_4122688_+	AsmA family protein	NA	NA	NA	NA	NA
WP_001332278.1|4122731_4123412_-	D-lyxose/D-mannose family sugar isomerase	NA	NA	NA	NA	NA
WP_000559088.1|4123392_4124325_-	ROK family protein	NA	NA	NA	NA	NA
WP_000961378.1|4124372_4125233_-	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000457124.1|4125313_4126165_-	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
4125994:4126008	attL	CAGGAAAATGCGCCA	NA	NA	NA	NA
WP_000662199.1|4126176_4127268_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001028073.1|4127292_4127607_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_000355547.1|4127624_4128095_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001314234.1|4128121_4129675_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000702905.1|4129969_4132288_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834420.1|4132297_4133680_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001218908.1|4134366_4135551_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_101408940.1|4136416_4136812_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.5e-53
WP_000027057.1|4136994_4137855_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|4138004_4138406_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|4138452_4139157_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|4139912_4140764_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|4141071_4141887_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|4141947_4142751_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4142750_4143587_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|4143647_4144352_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014966191.1|4144398_4145697_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|4145735_4146443_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|4146439_4146676_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|4146672_4147035_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|4147052_4148747_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|4148798_4149221_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|4149256_4149532_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|4149545_4149896_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|4149967_4150402_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000844627.1|4151402_4151645_+|transposase	transposase	transposase	NA	NA	NA	NA
4156649:4156663	attR	CAGGAAAATGCGCCA	NA	NA	NA	NA
>prophage 17
NZ_CP025401	Escherichia coli strain MS8345 chromosome, complete genome	5220976	5148372	5191470	5220976	terminase,portal,holin,integrase,capsid,tail,head,protease	Escherichia_phage(36.73%)	56	5145345:5145358	5159545:5159558
5145345:5145358	attL	CGCCTGGCGGGTCA	NA	NA	NA	NA
WP_001513547.1|5148372_5149608_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.3	4.5e-234
WP_001105426.1|5149766_5150900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513548.1|5151303_5151924_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	92.2	3.6e-115
WP_001513549.1|5151925_5152255_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	36.6	6.9e-25
WP_000476211.1|5152251_5152491_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	98.7	2.2e-36
WP_001513550.1|5152483_5152687_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	97.0	5.2e-31
WP_001242718.1|5152683_5153046_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_001401560.1|5153036_5153573_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_000081278.1|5153700_5154525_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135680.1|5154590_5154953_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001513551.1|5155521_5156016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450740.1|5156372_5156999_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	3.2e-47
WP_000205494.1|5157096_5157297_+	cell division protein	NA	NA	NA	NA	NA
WP_000514174.1|5157334_5157919_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001250270.1|5158094_5158307_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_021500370.1|5158887_5159256_+	hypothetical protein	NA	U5P0A0	Shigella_phage	98.4	3.0e-69
WP_001573323.1|5159252_5159747_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
5159545:5159558	attR	TGACCCGCCAGGCG	NA	NA	NA	NA
WP_000210176.1|5159746_5160073_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|5160069_5160459_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001513553.1|5160478_5161276_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.6e-150
WP_001433852.1|5161283_5162273_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_001204806.1|5162290_5162671_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_077462104.1|5162768_5163101_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.9	2.0e-48
WP_000839572.1|5163832_5164048_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193289.1|5164052_5164403_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992100.1|5164466_5165000_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001228685.1|5165216_5165402_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001100260.1|5165619_5165886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000351660.1|5165891_5166431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111090.1|5166569_5166920_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
WP_001330091.1|5167067_5167550_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	2.5e-84
WP_001140907.1|5167549_5169307_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_101408949.1|5169454_5170681_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	9.0e-203
WP_000999828.1|5170673_5171273_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000766109.1|5171287_5172505_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719066.1|5172581_5172899_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_001147816.1|5172907_5173246_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	89.3	1.7e-50
WP_023910305.1|5173242_5173692_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.9	2.7e-64
WP_001206699.1|5173688_5174033_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.8e-55
WP_001441850.1|5174092_5174797_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	94.4	1.8e-115
WP_001324129.1|5174796_5175183_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_063101268.1|5175224_5175485_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.8	7.1e-41
WP_000224012.1|5175531_5178759_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	92.9	0.0e+00
WP_000807954.1|5178751_5179093_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_016230622.1|5179092_5179791_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
WP_001513560.1|5179795_5180539_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	1.7e-151
WP_071592395.1|5180475_5181108_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	7.2e-95
WP_001513561.1|5181168_5184648_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001513563.1|5184715_5185315_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	1.8e-108
WP_001513564.1|5185379_5187440_+|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	63.4	1.2e-146
WP_001204581.1|5187436_5187715_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_001513565.1|5187724_5188012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217553.1|5188129_5188378_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000202563.1|5188597_5190184_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5190576_5191182_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5191308_5191470_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 1
NZ_CP025402	Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence	241162	52131	91598	241162	transposase	Salmonella_phage(27.27%)	34	NA	NA
WP_085948620.1|52131_53344_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_000128631.1|55317_56055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071885.1|56051_56537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004209.1|57295_58096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140953.1|58097_58610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196728.1|59203_60250_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001257292.1|60239_61655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000386159.1|61663_65617_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001284752.1|65797_67087_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
WP_024136329.1|67194_67761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494967.1|67843_68383_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000720274.1|68530_69280_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000843244.1|69304_69697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025803.1|69730_70153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000620990.1|70212_70824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031377.1|70930_71740_+	DsbA family protein	NA	NA	NA	NA	NA
WP_042634445.1|71785_73045_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
WP_000111290.1|73028_73463_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_001130842.1|73656_74274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770127.1|74423_74780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152919720.1|75030_75201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|75237_75942_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000237816.1|76546_76999_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_015059985.1|77244_78501_+	EreA family erythromycin esterase	NA	NA	NA	NA	NA
WP_001209508.1|78586_79378_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001393253.1|83061_83394_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_101408952.1|83440_84274_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	78.9	1.1e-116
WP_000608644.1|84529_85792_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_153593977.1|85973_86159_-	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	100.0	5.4e-27
WP_001067855.1|86198_86903_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|87009_87870_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|87882_88425_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|89618_90323_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_085959879.1|90469_91598_+|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
>prophage 1
NZ_CP025403	Escherichia coli strain MS8345 plasmid pMS8345B, complete sequence	133281	63443	127991	133281	transposase	Enterobacteria_phage(20.0%)	52	NA	NA
WP_012478345.1|63443_64418_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000624110.1|64534_64819_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_000052618.1|64805_65351_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_002430925.1|65280_65643_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_101408959.1|65639_66986_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_101408960.1|66982_69805_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_001299727.1|69825_70323_+	type IV secretion-like conjugative transfer system protein TraS	NA	NA	NA	NA	NA
WP_001447147.1|70354_71086_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_001496532.1|71337_73536_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_101408961.1|73535_78806_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205759.1|78825_79572_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	1.1e-09
WP_000139359.1|79626_80187_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001311693.1|80324_80537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233870.1|80779_81181_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.0	3.0e-14
WP_000083818.1|81225_81486_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|81711_81786_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130940.1|81778_82636_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000079941.1|83551_83821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969996.1|83817_84099_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001057989.1|84144_84993_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	2.0e-28
WP_001283335.1|85178_87059_+	colicin	NA	NA	NA	NA	NA
WP_001080729.1|87080_87416_-	colicin 1A immunity protein	NA	NA	NA	NA	NA
WP_000142431.1|87544_87802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350923.1|87821_88412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343091.1|88408_88669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000670963.1|88961_89414_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001017350.1|89469_89736_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000379710.1|89732_90002_-	membrane protein	NA	NA	NA	NA	NA
WP_001323890.1|90941_91178_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001259758.1|91155_91467_+	colicin V	NA	NA	NA	NA	NA
WP_001183604.1|91636_93751_-	microcin H47 export transporter peptidase/ATP-binding subunit MchF	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001332356.1|93725_94967_-	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
WP_001324224.1|95681_95879_+	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_000969988.1|95875_96058_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000377483.1|96156_96465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001190234.1|97024_98059_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_001222183.1|98909_101087_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_000271277.1|101131_102088_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933672.1|102172_103402_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_011402704.1|103505_107291_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_001318220.1|107304_108420_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000738422.1|111565_111859_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_112041681.1|112485_113713_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.8e-174
WP_085948620.1|114484_115697_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_000450494.1|116250_117444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000547191.1|118784_120113_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_001312828.1|120483_121854_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000733252.1|121857_123798_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	3.0e-35
WP_000928804.1|123794_124982_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_024133197.1|126323_126470_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.0e-06
WP_085949156.1|126435_127649_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_001312823.1|127832_127991_+|transposase	transposase	transposase	NA	NA	NA	NA
